| Literature DB >> 31683967 |
Hang Yin1, Xing Du2, Qiqi Li3, Zengxiang Pan4, Wangjun Wu5, Honglin Liu6, Qifa Li7.
Abstract
Bone morphogenetic protein 7 (BMP7) and BMP15, which encode members of the BMP family, have been identified by whole-genome resequencing as breeding-related genes that overlap with a known quantitative trait locus for reproductive traits. In this study, we investigated the effects of variants at the BMP7 and BMP15 gene loci on sow reproductive traits. We isolated 669 and 1213 bp sequences of the 3'-untranslated region (3'-UTR) of the porcine BMP7 and BMP15 genes, respectively, and detected several RNA regulatory elements, such as miRNA response elements and AU-rich elements. Pooled DNA sequencing identified two novel point mutations (viz., BMP7 c.1569A>G and BMP15 c.2366G>A) in the 3'-UTR. Association analysis showed that the c.1569A>G polymorphism was associated with the litter weight trait in a Large White pig population. Furthermore, analysis of the combined genetic effects revealed that AA/GA and AG/GG were the favorable combined genotypes for the total number of piglets born (TNB) and the total number of piglets born alive (NBA), whereas. Together, our findings confirm that BMP7 and BMP15 are candidate genes for porcine reproductive performance.Entities:
Keywords: BMP15; BMP7; Large White pig; reproductive trait; variant
Year: 2019 PMID: 31683967 PMCID: PMC6912256 DOI: 10.3390/ani9110905
Source DB: PubMed Journal: Animals (Basel) ISSN: 2076-2615 Impact factor: 2.752
Primers used in this study.
| Gene | Primer Sequences (5’-3’) | Annealing Temp (°C) | Product Size (bp) | Accession No. | |
|---|---|---|---|---|---|
| P1 |
| F: GTGTTCCAGGTCCACTTCAT | 54 °C | 822 | XM_005673044.3 |
| P2 |
| F: GTGCCTATTAGCATCCTCC | 54 °C | 1063 | NM_001005155.2 |
| P3 |
| F: TTTGAGGGAAACAGAAGG | 54 °C | 723 | NM_001005155.2 |
Figure 1Characterization of the partial sequence of the 3’-untranslated region of the Large White pig bone morphogenetic protein 7 (BMP7) gene. The transcription start codon was assumed as +1 (GenBank ID: XM_005673044.3). The underline indicates the regulatory elements. Red arrows indicate the mutation c.1569A>G.
Figure 2Mutation c.1569A>G in the 3’-untranslated region of the Large White pig BMP7 gene. (A) Sequence of different genotypes at the mutation c.1569A>G. The arrow indicates the substitution position. (B) Genotype frequency of the mutation c.1569A>G. (C) Allele frequency of the mutation c.1569A>G. n = 227.
Effect of the c.1569A>G polymorphism within the 3’-untranslated region of BMP7 on the reproductive traits of the Large White pig population.
| Genotypes ( | Traits (LSM ± SE) | |||
|---|---|---|---|---|
| TNB | NBA | NSB | LW | |
| AA (83) | 12.26(±0.53) a | 12.07(±0.52) a | 0.18(±0.15) a | 17.00(±0.70) b |
| AG (99) | 12.10(±0.54) a | 11.87(±0.54) a | 0.23(±0.16) a | 18.03(±0.72) a |
| GG (45) | 11.65(±0.63) a | 11.60(±0.62) a | 0.16(±0.17) a | 17.40(±0.82) ab |
Data represent the least squares means ± SE. n = 227. TNB = the total number of piglets born; NBA = the total number of piglets born alive; NSB = number of stillborn; LW = litter weight. Values in each line with different lowercase superscripts are at p < 0.05; those with same lowercase superscripts mean that there were no differences (p > 0.05).
Figure 3Characterization of the partial sequence of the 3’-untranslated region of the Large White pig BMP15 gene. The transcription start codon was assumed as +1 (GenBank ID: NM_001005155.2). The underline indicates the regulatory elements. Red arrows indicate the mutation c.2366G>A.
Figure 4Mutation c.2366G>A in the 3’-untranslated region of the Large White pig BMP15 gene. (A) Sequence of different genotypes at the mutation c.2366G>A. The arrow indicates the substitution position. (B) Genotype frequency of the mutation c.2366G>A. (C) Allele frequency of the mutation c.2366G>A. n = 227.
Effect of the c.2366 G>A polymorphism on reproductive traits of a Large White pig population.
| Genotypes ( | Traits (LSM ± SE) | |||
|---|---|---|---|---|
| TNB | NBA | NSB | LW | |
| GA(56) | 12.56(±0.44) a | 12.24(±0.42) a | 0.21(±0.15) a | 17.20(±0.72) a |
| GG(171) | 12.63(±0.43) a | 12.34(±0.42) a | 0.20(±0.15) a | 17.57(±0.71) a |
Data represent the least squares means ± SE. n = 227. TNB = the total number of piglets born; NBA = the total number of piglets born alive; NSB = number of stillborn; LW = litter weight. No markers means that there were no differences (p > 0.05).
Figure 5Genotype frequencies of the mutations BMP7 c.1569A>G and BMP15 c.2366G>A in Large White pig population. n = 227.
Combination effect of the genotypes formed by BMP7 c.1569A>G and BMP15 c.2366G>A on reproductive traits.
| Genotypes ( | Traits (LSM ± SE) | |||
|---|---|---|---|---|
| TNB | NBA | NSB | LW | |
| AA/GA(25) | 12.44(±0.60) a | 12.21(±0.59) a | 0.03(±0.20) a | 17.08(±0.95) a |
| AA/GG(58) | 12.02(±0.59) ab | 11.91(±0.58) ab | 0.07(±0.20) a | 17.06(±0.93) a |
| AG/GA(20) | 11.17(±0.67) b | 11.04(±0.66) b | 0.04(±0.22) a | 17.04(±1.09) a |
| AG/GG(79) | 12.31(±0.56) a | 12.08(±0.56) a | 0.14(±0.19) a | 18.25(±0.90) a |
| GG/GA(11) | 11.81(±0.80) ab | 11.78(±0.80) ab | 0.01(±0.26) a | 17.36(±1.32) a |
| GG/GG(34) | 11.49(±0.69) ab | 11.48(±0.68) ab | 0.04(±0.23) a | 16.97(±1.09) a |
Data represent the least squares means ± SE. n = 227. TNB = the total number of piglets born; NBA = the total number of piglets born alive; NSB = number of stillborn; LW = litter weight. Values in each line with different lowercase superscripts are at p < 0.05. Same lowercase superscripts means that there were no differences (p > 0.05).