Literature DB >> 31667022

Chloroplast primers for clade-wide phylogenetic studies of Thalictrum.

Diego F Morales-Briones1,2,3,4, Tatiana Arias5,6,7, Verónica S Di Stilio7, David C Tank1,2,3.   

Abstract

PREMISE: Chloroplast primers were developed for phylogenetic and comparative studies in Thalictrum (Ranunculaceae). METHODS AND
RESULTS: We assembled and annotated the complete plastome sequence of T. thalictroides by combining multiple whole genome sequencing libraries. Using transcriptome-sequencing libraries, we also assembled a partial plastome of the related species T. hernandezii. From the newly assembled plastomes and one previously sequenced plastome, we designed and validated 28 primer pairs to target variable portions of the chloroplast genome in Thalictrum. Furthermore, we tested the validated primers in 62 species of Thalictrum. The total alignment length of the 28 regions was 15,268 bp with 2443 variable sites and 92% character occupancy.
CONCLUSIONS: The newly developed chloroplast primer pairs improve the phylogenetic resolution (bootstrap support and tree certainty) in Thalictum and will be a useful resource for future phylogenetic and evolutionary studies for species in the genus and in close relatives in Thalictroideae.
© 2019 Morales‐Briones et al. Applications in Plant Sciences is published by Wiley Periodicals, Inc. on behalf of the Botanical Society of America.

Entities:  

Keywords:  Ranunculaceae; Thalictrum thalictroides; chloroplast genome; high‐throughput sequencing; meadow‐rue; microfluidic PCR

Year:  2019        PMID: 31667022      PMCID: PMC6814179          DOI: 10.1002/aps3.11294

Source DB:  PubMed          Journal:  Appl Plant Sci        ISSN: 2168-0450            Impact factor:   1.936


The chloroplast genome (cpDNA) has been particularly useful for resolving evolutionary relationships in plants for the past 30 years (reviewed in Gitzendanner et al., 2018). High‐throughput sequencing has facilitated the development of various approaches for collecting multiple regions or complete sequences of this genome (reviewed in Twyford and Ness, 2016). Furthermore, approaches based on PCR target enrichment in combination with high‐throughput sequencing (e.g., Uribe‐Convers et al., 2016) have proven to be a cost‐effective approach for sequencing multiple chloroplast regions simultaneously, and have been successfully applied in phylogenetic studies (e.g., Jacobs et al., 2018; Morales‐Briones and Tank, 2019). Thalictrum L. (Thalictroideae, Ranunculaceae) is a clade of ca. 190 species of herbaceous perennials distributed primarily in northern temperate regions (Tamura, 1995) with a diversity of sexual systems (hermaphroditic, dioecious, andromonoecious, or gynomonoecious [Boivin, 1944]), pollination mode (insect or wind [Soza et al., 2012; Wang et al., 2018]), and ploidy (from 2x =14 to 30x = 210 [Soza et al., 2013]). To date, molecular phylogenetic studies of Thalictrum have relied on sequences of the nuclear ribosomal DNA (nrDNA) cistron, especially the internal transcribed spacer (ITS) and external transcribed spacer (ETS) regions, and up to five cpDNA regions (Soza et al., 2012, 2013; Wang et al., 2018). Although Soza et al. (2013) surveyed several cpDNA regions from Shaw et al. (2007), only one was identified as sufficiently variable for phylogenetic analyses in Thalictrum. Here, we assembled and annotated the complete plastome of T. thalictroides (L.) A. J. Eames & B. Boivin, assembled a partial plastome of T. hernandezii Tausch ex J. Presl, and designed and validated PCR primers that target highly variable chloroplast regions in Thalictrum to aid in future phylogenetic studies of this group and close relatives.

METHODS AND RESULTS

Plastome assembly

Genomic libraries of T. thalictroides and transcriptome libraries of T. hernandezii were downloaded from the National Center for Biotechnology Information (NCBI) Sequence Read Archive (Appendix 1). Due to low cpDNA coverage in the transcriptome libraries, a reference‐guided assembly of T. hernandezii was carried out using Alignreads version 2.5.2 (Straub et al., 2011) with T. coreanum H. Lév. as a reference (Park et al., 2015), with one inverted repeat (IR) removed. We obtained a plastid consensus sequence made of 151 contigs representing 116,700 bp (after removal of regions not covered in the reference) for T. hernandezii. Given the availability of multiple genome sequencing libraries for two samples of T. thalictroides (Appendix 1), we performed de novo assemblies for this species. Assemblies were carried out for the two individuals of T. thalictroides (WT478 and WTBG) separately using the Fast‐Plast version 1.2.6 pipeline (McKain and Wilson, 2017). Single contigs representing the complete chloroplast genome of T. thalictroides were obtained. The resulting complete plastomes of T. thalictroides were annotated using CpGAVAS (Liu et al., 2012). Genes encoding for tRNAs were verified using tRNAscan‐SE version 2.0 (Lowe and Chan, 2016). Annotations were verified and edited in Geneious version 7.1.9 (Kearse et al., 2012) using other available Ranunculaceae plastomes as references (Appendix 1). The genome map was drawn with OGDraw version 1.2 (Lohse et al., 2013). Characterization of the T. thalictroides plastome and its comparison with the plastome of T. coreanum (Park et al., 2015) can be found in Appendix S1.

Primer design

Plastome sequences of T. thalictroides, T. hernandezii, and T. coreanum (all with one IR removed) were aligned using MAFFT version 7.017b (Katoh and Standley, 2013). The most variable regions of the alignment, spanning 400–600 bp, were identified using a custom R script (Uribe‐Convers et al., 2016). Primer design was carried out using Primer3 (Untergasser et al., 2012) following the specifications of the microfluidic PCR Access Array system protocol (Fluidigm, San Francisco, California, USA), with an annealing temperature of 60°C (±1°C) and no more than three continuous nucleotides of the same base. Primer validation followed Uribe‐Convers et al. (2016) by simulating the four‐primer reaction of the microfluidic PCR. We used our target‐specific primers and 5′ conserved sequence (CS) tags to provide annealing sites for Illumina sequencing adapters and sample‐specific barcodes. PCR validations were done using genomic DNA from three Thalictrum species (Appendix 2) and a negative control that did not contain DNA. Amplicons were visualized in a QIAxcel Advanced System (QIAGEN, Valencia, California, USA) and scored following Uribe‐Convers et al. (2016). A total of 81 primer pairs were designed, of which 28 passed the validation step (Table 1), 32 failed (i.e., failed to amplify in one or more species, produced significant primer dimers, and/or produced multiple amplicons), and 21 were not validated (Appendix S2). In order to test cross‐amplification of the 28 validated PCR primer pairs, we amplified and sequenced these regions on 75 individuals of Thalictrum representing 62 species from 13 of 14 described sections of the genus (Tamura, 1995). Our sampling represents 33% of Thalictrum species and 70% of the sampling used in the most recent molecular phylogeny of the genus (Wang et al., 2018). Additionally, we amplified the newly designed regions from one individual each of three related genera in Thalictroideae (Aquilegia L., Leptopyrum Rchb., and Paraquilegia J. R. Drumm. & Hutch.; Appendix 2) using previously extracted DNA samples by Soza et al. (2012). Microfluidic PCR was carried out on the Access Array system (Fluidigm) following the manufacturer's protocol. PCR amplicons were multiplexed, and sequenced in an Illumina MiSeq (San Diego, California, USA) with 300‐bp paired‐end reads. Raw reads were cleaned, demultiplexed, and merged using the dbcAmplicons pipeline (Uribe‐Convers et al., 2016). Consensus sequences for each sample in all amplicons were generated using the ‘reduce_amplicons’ R script (part of dbcAmplicons). Each chloroplast region was aligned with MAFFT and alignment summary statistics were calculated with AMAS (Borowiec, 2016).
Table 1

Sequence of validated primers for the Thalictrum chloroplast genome.a

LocusPrimer sequences (5′–3′)b Amplification region Chloroplast regionAmplicon length, bpc
thal‐13F: GCAATAAGTCCGGTTTGCAT atpA, (atpAatpF) IGS, atpF LSC550
R: GGGCGATGAAAGAAATAAACG
thal‐15F: ACATGGCTTTCTTCCATAACG(atpH‐aptI) IGS, atpI LSC574
R: GAATCCATGGAGGGTCATCA
thal‐44F: TGAAGTGATAGCCCGATTCC(rbcL‐accD) IGS, accD LSC518
R: TTTCCAGTTCATTCCGATCA
thal‐45F: TGATGGGTCTAAGAGTGACAATCA accD LSC419
R: CGATTCTTTCTGAACTGCTCATT
thal‐46F: TTTGCAGCATTGAGTAAGGAAC(ycf4‐cemA) IGS LSC577
R: CCCGAACGAGTCATTTCAA
thal‐47F: GAGAAGGTTCAATTGTCCGAAA petA, (petA‐psbJ) IGS, psbJ LSC572
R: GGTATTCTTGTGATCGGTTTACTAGG
thal‐50F: TGAGGTGATTGGATTTGCAC(rpl20‐clpP) IGS, clpP LSC558
R: CGAAGACATGGAAAGGGATG
thal‐51F: AACCCTTGTGAGGGTTTCG clpP LSC541
R: GAGGCCTCTTTCCAATATTTATGTTA
thal‐52F: TTACATATTGCGAAGGCATAGTCT clpP LSC414
R: TGAACCGTATGCATCCAAAG
thal‐53F: AAGAATCAATGTGCTGATTCCA clpP LSC534
R: GTATCCAGGCTCCGTTCAGA
thal‐54F: TCTGAACGGAGCCTGGATAC clpP, (clpP‐psbB) IGS LSC560
R: TTCGTAGGAACAAAGATAAGCAGA
thal‐55F: TGCTCTTGTATCTTTCGCCTCT(psbB‐psbT) IGS, psbT, (psbT‐psbN) IGS, psbN, (psbN‐psbH) IGS LSC525
R: CATTGCGGTCTTGCAATTT
thal‐57F: CTGGCTCCGTAAGATCCAGT petD LSC513
R: CGAAGGAACCGGACATGATA
thal‐58F: GGAGCAACATTGCCTATTGATAA petD, (petD‐rpoA) IGS, rpoA LSC546
R: CAATCAAGGCAGGGTTACTTTAC
thal‐59F: TAACCCTGCCTTGATTGTCC rpoA LSC565
R: GGAACATGTATCACACGAGCA
thal‐61F: TCGAATTGTTATTCAACCCTATAGAA(rpl16‐rps3) IGS, rps3 LSC597
R: AATCGATCTGATCCAGGTCATAA
thal‐62F: CCCTCGGTCTATTAGTGAACCA ycf2 IR562
R: CCAAGCTCGAAGTACCATTTG
thal‐64F: ATATGCGCCCTCCACCTAC ndhF SSC379
R: TTTGATTGGTATGAATTTGTGAGAA
thal‐65F: ATGGATCCGACGAACAAAGT ndhF SSC541
R: GGCTCTTATGGGCGGTTTA
thal‐68F: TGTGTGGATCATTATTATCAGTAGCTC ccsA SSC506
R: TGAACCATAACTATGCAGCCCTA
thal‐69F: AAAGGTCTTACAAATCCAATACGC(ccsA‐ndhD) IGS, ndhD SSC581
R: CTCGATGGCTTCTCTTGCAT
thal‐70F: CCCAGAACTCCCATTAAGAGAA ndhD SSC483
R: TTTCCCTCATAGAGGAAATAAGGTT
thal‐72F: CCGATGGATAATAAATAGGCACTC ndhE, (ndhE‐ndhG) IGS, ndhG SSC591
R: TGTGATGTTCATCAATGGTTCA
thal‐74F: TCCGCTTAGCTTAACCCTTG ndhA SSC525
R: TCGTTTATTCAGTATCGGACCA
thal‐75F: AACACTCCGATCTCCTATCAGAA ndhH SSC530
R: GGATAGATAAATGTTTGGATTTCTGTG
thal‐78F: TGCGGCACTAATCTAGACCATC ycf1 SSC542
R: TCCCGACTAATACGTAAATGTCAC
thal‐80F: TCTGAATACCGTCGATTAACCA ycf1 SSC503
R: ATGCGTGCTCAAAGACGTAA
thal‐81F: CGTATCAAAGCCACTTCGTCT ycf1 SSC578
R: CATCGCGGAACAATCAAA

IR = inverted repeat region; LSC = large single copy region; SSC = small single copy region.

Primer pairs were designed for an annealing temperature of 60°C (±1°C). Validation consisted of successful (single amplicon) amplification on three test species and absence of (or minimal) primer dimer detection.

Conserved sequence tags CS1 (5′‐ACACTGACGACATGGTTCTACA) and CS2 (5′‐TACGGTAGCAGAGACTTGGTCT) were added to each primer to make target‐specific primer for microfluidic PCR.

Estimated from three Thalictrum species, including primer length.

Sequence of validated primers for the Thalictrum chloroplast genome.a IR = inverted repeat region; LSC = large single copy region; SSC = small single copy region. Primer pairs were designed for an annealing temperature of 60°C (±1°C). Validation consisted of successful (single amplicon) amplification on three test species and absence of (or minimal) primer dimer detection. Conserved sequence tags CS1 (5′‐ACACTGACGACATGGTTCTACA) and CS2 (5′‐TACGGTAGCAGAGACTTGGTCT) were added to each primer to make target‐specific primer for microfluidic PCR. Estimated from three Thalictrum species, including primer length. The cross‐amplification and sequencing resulted in regions with 15–75 (mean 69) consensus sequences of Thalictrum. Two regions, thal‐53 and thal‐55, had lower amplification success, with 15 and 40 sequences, respectively (Table 2, Fig. 1, Appendix S3). The amplification success per sample ranged from 19 to 28 (mean 26) regions. The amplification success in Aquilegia, Leptopyrum, and Paraquilegia was 12, 26, and 23 regions, respectively (Fig. 1), showing the potential utility of the newly developed primers on related genera in Thalictroideae. Thalictrum‐only alignment lengths ranged from 335 to 658 bp (mean 525 bp; Appendix S3), with the number of variable sites ranging from nine to 195 (mean 73). Alignments including the other Thalictroideae genera ranged from 335 to 725 bp (mean 544; Appendix S3) in length and contained 29–218 (mean 86) variable sites (Table 2). The total alignment length of the 28 regions (including all genera) was 15,268 bp, with 2443 variable sites and 92% character occupancy.
Table 2

Alignment summary statistics for 28 amplified chloroplast regions in Thalictrum and relatives.

Locus Thalictrum Thalictrum + Aquilegia + Leptopyrum + Paraquilegia
Alignment length, bpNo. of sequencesSequence length range, bp (mean)Pairwise identity, %Variable sites, bp (PI)Alignment length, bpNo. of sequencesSequence length range, bp (mean)Pairwise identity, %Variable sites, bp (PI)
thal‐1351575509–515 (509)99.5028 (12)53178509–522 (509)99.4042 (14)
thal‐1560575434–544 (525)93.7085 (36)63278434–544 (524)93.00128 (45)
thal‐4449653466–479 (473)98.5033 (20)50055457–479 (472)98.1045 (22)
thal‐4537275372–372 (372)99.0024 (15)37277345–372 (371)98.5030 (15)
thal‐4661574500–561 (521)96.10142 (34)63076500–561 (520)95.80152 (43)
thal‐4765875150–554 (518)83.50195 (140)72578150–554 (518)83.40218 (150)
thal‐5054575499–517 (506)97.5030 (14)55677495–517 (506)97.2043 (14)
thal‐5159473461–557 (512)85.20190 (140)59975461–557 (511)85.20197 (142)
thal‐5238175366–377 (370)99.6016 (11)57177366–558 (372)98.1045 (11)
thal‐5358515469–560 (520)85.60126 (78)NANANANANA
thal‐5456772505–558 (514)98.3076 (17)57573505–558 (514)98.2078 (18)
thal‐5550440474–495 (486)97.3028 (19)52441474–501 (486)97.1032 (19)
thal‐5749573464–480 (473)99.0036 (23)49675464–480 (473)98.9045 (25)
thal‐5856874482–556 (485)98.1039 (19)57375458–556 (485)97.9048 (21)
thal‐5952474518–524 (524)99.4033 (18)52477518–524 (524)99.2053 (18)
thal‐6159070532–553 (552)96.10153 (107)59172532–553 (552)96.00165 (110)
thal‐6251975519–519 (519)99.809 (7)52578519–525 (519)99.7029 (7)
thal‐6433572335–335 (335)98.5050 (30)33574335–335 (335)98.4058 (36)
thal‐6557975496–563 (504)96.8077 (34)58678496–563 (504)96.7093 (39)
thal‐6845673447–456 (456)98.9047 (29)47476447–468 (456)98.6071 (38)
thal‐6961672521–558 (545)96.0096 (64)62075462–558 (544)95.30111 (62)
thal‐7043675436–436 (436)99.2038 (20)43678436–436 (436)99.0052 (24)
thal‐7265868530–556 (542)97.1066 (30)66270530–556 (542)96.70103 (42)
thal‐7449574454–488 (482)98.4038 (21)59376454–560 (483)97.6050 (21)
thal‐7548875249–480 (477)97.70104 (15)48678249–480 (477)97.8082 (23)
thal‐7850873469–502 (484)98.1054 (33)55675469–502 (485)97.5083 (35)
thal‐8046072454–460 (460)98.10105 (40)46073454–460 (460)97.90118 (44)
thal‐8154571502–545 (529)97.40121 (62)55174502–545 (529)97.00146 (67)

PI = parsimony informative; NA= not applicable.

Figure 1

Cross‐amplification performance of chloroplast primers for phylogenetic studies in Thalictrum. Amplification results in 62 species of Thalictrum and one species of Aquilegia, Leptopyrum, and Paraquilegia (outgroups) with the 28 validated primer pairs. Darker shades of blue represent longer amplification products; white represents failed amplification. Thalictrum clades sensu Soza et al. (2012, 2013).

Alignment summary statistics for 28 amplified chloroplast regions in Thalictrum and relatives. PI = parsimony informative; NA= not applicable. Cross‐amplification performance of chloroplast primers for phylogenetic studies in Thalictrum. Amplification results in 62 species of Thalictrum and one species of Aquilegia, Leptopyrum, and Paraquilegia (outgroups) with the 28 validated primer pairs. Darker shades of blue represent longer amplification products; white represents failed amplification. Thalictrum clades sensu Soza et al. (2012, 2013). To test the usefulness of the newly generated chloroplast primers for improving phylogenetic resolution within Thalictrum, we inferred a phylogeny of 62 Thalictrum species (one individual per species) and three outgroups using all 28 regions and compared it to an inferred phylogeny of the same species using six chloroplast regions (ndhA, rbcL, rpl16, rpl32‐trnL, trnL‐trnF, and trnV‐ndhC) (Soza et al., 2012, 2013; Wang et al., 2018). For each concatenated matrix, we searched for the best partition scheme followed by maximum likelihood tree inference and 1000 ultrafast bootstrap replicates for node support using IQ‐Tree version 1.6.10 (Nguyen et al., 2014). As an additional measure of tree resolution, we estimated internode certainty scores (Salichos et al., 2014) using the majority rule consensus tree across 1000 bootstrap replicates in RaxML version 8.2.11 (Stamatakis, 2014). The six‐region matrix had an aligned length of 6650 bp and 363 parsimony‐informative sites, whereas the 28‐region matrix had an aligned length of 15,268 bp and 1045 parsimony‐informative sites. Mean bootstrap values of the 28‐region trees were higher than those of the six‐region trees (89% and 79%, respectively; Fig. 2A). Moreover, mean internode certainty scores were also higher in the 28‐region tree (0.68 and 0.51, respectively; Fig. 2B). In summary, these results show that the 28‐region chloroplast matrix produces a tree with overall higher node support than the six‐region matrix, and is therefore suitable for improved phylogenetic studies in Thalictrum and close relatives.
Figure 2

Overall performance of chloroplast primers for phylogenetic studies in Thalictrum. (A) Bootstrap value distribution of the 28‐region (blue) and six‐region (yellow) phylogenies. Dashed lines represent mean values. (B) Internode certainty scores distribution of the 28‐region (blue) and six‐region (yellow) phylogenies. Dashed lines represent median scores.

Overall performance of chloroplast primers for phylogenetic studies in Thalictrum. (A) Bootstrap value distribution of the 28‐region (blue) and six‐region (yellow) phylogenies. Dashed lines represent mean values. (B) Internode certainty scores distribution of the 28‐region (blue) and six‐region (yellow) phylogenies. Dashed lines represent median scores.

CONCLUSIONS

Here, we contribute chloroplast primers for phylogenetic and comparative studies of Thalictrum and its close relatives in Thalictroideae. Furthermore, we demonstrate the utility of whole genome and transcriptome libraries as a source of chloroplast sequence data for PCR primer design. Out of the 81 chloroplast primer pairs reported here, 28 were successfully validated for use with the high‐throughput, Fluidigm‐based microfluidic PCR system. Finally, although this was not directly tested here, these primers could also be used for traditional PCR. APPENDIX S1. Characterization of the Thalictrum thalictroides plastome and comparison to the plastome of T. coreanum. Click here for additional data file. APPENDIX S2. Primer sequences of the Thalictrum chloroplast genome that failed to pass our validation criteria or were not validated. Click here for additional data file. APPENDIX S3. Length (in base pairs) of 28 amplified chloroplast regions in Thalictrum and relatives. Click here for additional data file.
SpeciesSample codeUsageAccession no.Notes
Thalictrum hernandezii Tausch ex J. PreslWT441Partial plastome assembly and primer designSRA: SRR6869419, SRR6869420Transcriptome libraries. Libraries represent staminate and hermaphrodite flowers from one andromonoecious individual.
T. thalictroides (L.) A. J. Eames & B. BoivinWT478Whole plastome assembly and primer designSRA: SRR6869426, SRR6869425, SRR6869418Genomic libraries. Each library has different insert size.
T. thalictroides WTBRWhole plastome assemblySRA: SRR6869424, SRR6869423, SRR6869421Genomic libraries. Each library has different insert size.
T. coreanum H. Lév.Primer design and plastome annotationGenBank: NC026103  
Aconitum chiisanense Nakai Plastome annotationGenBank: NC029829  
Megaleranthis saniculifolia Ohwi Plastome annotationGenBank: NC012615  
Ranunculus macranthus ScheelePlastome annotationGenBank: DQ359689  
SpeciesSample codeVoucher (Herbarium)Locality
Aquilegia formosa Fisch. ex DC.Aqfor1V. Di Stilio 128 (WTU)Di Stilio Garden, Seattle, WA, USA
Leptopyrum fumarioides (L.) Rchb.Lefum1A. Liston 819‐13 (RSA)Xinjiang, China
Paraquilegia microphylla (Royle) J. R. Drumm. & Hutch.Pamic1I. Smirnov 277 (RSA)Irkutsk, Arshan, Russia
Thalictrum alpinum L.Thalp2D. E. Boufford et al. 32249 (F)Xizang (Tibet), China
Thalictrum alpinum L.Thalp3V. Di Stilio 115 (WTU)Cultivated from Ion Exchange Nursery, Iowa, USA
Thalictrum amurense Maxim. Thamu1Unvouchered Cultivated at UC Botanical Garden at Berkeley, CA, USA
Thalictrum aquilegiifolium L. Thaqu1V. Di Stilio 108 (WTU)Cultivated material from Cricklewood Nursery, CA, USA
Thalictrum arsenii B. Boivin Thars1A. Liston 1128 (OSC)Mpio. Morelia, Jaripeo, Michoacan, Mexico
Thalictrum atriplex Finet & Gagnep.Thatr1D. E. Boufford et al. 32557 (GH)Xizang (Tibet), China
Thalictrum baicalense Turcz.Thbai1Unvouchered Cultivated at University of Washington Botany Greenhouse, Seattle, USA, from seeds from B & T World Seeds
Thalictrum baicalense Turcz.Thbai2R. Zhang 20120614‐01 (PE)Ecological station, Dong Lin Mtn., China
Thalictrum baicalense Turcz.Thmeg1D. E. Boufford et al. 37958 (GH)Sichuan, Danba Xian, China
Thalictrum cooleyi H. E. AhlesThcoo1Unvouchered The State Botanical Garden of Georgia, Athens, GA, USA
Thalictrum coriaceum (Britton) SmallThcor3A. Floden s.n. (TENN)Greene Co., TN, USA
Thalictrum cultratum Wall. Thcul1D. E. Boufford et al. 31166 (F)Xizang (Tibet), China
Thalictrum cultratum Wall. Thcul4D. E. Boufford et al. 31233 (GH)Xizang (Tibet), China
Thalictrum dasycarpum Fisch. & Avé‐Lall.Thdas1V. Di Stilio 110 (WTU)Cultivated from Ion Exchange Nursery, Iowa, USA
Thalictrum decipiens B. Boivin Thdec3L. Galetto 2089 (CORD)Pampa de Achala, Córdoba, Argentina
Thalictrum delavayi Franch.Thdel1D. E. Boufford et al. 30452 (F)Sichuan, Xiangcheng Xian, China
Thalictrum delavayi Franch.Thdel2V. Di Stilio 121 (WTU)Cultivated from seed from B & T World Seeds, Aigues‐Vives, France
Thalictrum diffusiflorum C. Marquand & Airy ShawThdif1A. Liston 1161 (OSC)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum dioicum L.Thdio3M. Sain 60 (WIS) University of Wisconsin campus, Muir Woods, Madison, WI, USA
Thalictrum dioicum L.Thdio2V. Di Stilio 101 (A)Lithia Springs, South Hadley, MA, USA
Thalictrum fendleri Engelm. ex A. GrayThfen4Unvouchered Cultivated at UW Botany Greenhouse, Seattle, USA
Thalictrum fendleri Engelm. ex A. GrayThfen3V. Soza 1920 (WTU)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum filamentosum Maxim.Thfil2V. Di Stilio 104 (WTU)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum finetii B. BoivinThfin1D. E. Boufford et al. 33172 (GH)Sichuan, Jiulong Xian, China
Thalictrum flavum L. Thfla2V. Di Stilio 109 (WTU)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum foetidum L.Thfoe5Unvouchered Cultivated from Arrowhead Alpines nursery, Michigan, USA
Thalictrum foetidum L.Thfoe2a V. Soza 1923 (WTU)Cultivated from Arrowhead Alpines nursery, Michigan, USA
Thalictrum grandiflorum Maxim.Thgra1Unvouchered Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum grandifolium S. Watson Thgra2G. B. Hinton 20254 (TEX)Coahuila, Mexico
Thalictrum heliophilum Wilken & DeMott Thhel1Mary Waters s.n. (CS)Cathedral Bluffs, Rio Blanco County, CO, USA
Thalictrum henricksonii M. C. Johnst.Thhen1J. Henrickson 13417 (RSA)Zacatecas, Mexico
Thalictrum hernandezii Tausch ex J. PreslThher2a A. Liston 1125 (OSC)Temascaltepec, State of Mexico, Mexico
Thalictrum ichangense Lecoy. ex Oliv.Thich2A. Floden 13116 (TENN)Sapa, Lao Cai Province, Vietnam
Thalictrum isopyroides C. A. Mey.Thiso1V. Di Stilio 111 (WTU)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum kiusianum NakaiThkiu1J. Brunet s.n. (OSC)Cultivated at Corvallis, OR, USA
Thalictrum lecoyeri Franch.Thlec1D. E. Boufford et al. 37972 (GH)Sichuan, Danba Xian, China
Thalictrum leuconotum Franch.Thleu1D. E. Boufford et al. 42102 (GH)Yunnan, Zhongdian Xian, China
Thalictrum lucidum L.Thluc1V. Di Stilio 122 (WTU)Cultivated from Arrowhead Alpines nursery, Michigan, USA
Thalictrum macrostylum Shuttlew. ex Small & A. HellerThmac2Unvouchered “Serpentine Barrens,” Chunky Gal Mountain, NC, USA
Thalictrum minus L.Thmin1H. W. Rickett & F. A. Stafleu 742 (OSC)Gelderland, Netherlands
Thalictrum minus L.Thmin2V. Soza 1910 (WTU)Cultivated at University of Washington Botany Greenhouse, Seattle, WA, USA
Thalictrum occidentale A. GrayThocc2K. A. Beck 200712 (WTU)Lower Boundary Dam Reservoir, Pend Oreille River, WA, USA
Thalictrum omeiense W. T. Wang & S. H. WangThome2A. Liston 1166 (OSC)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum petaloideum L.Thpet3Unvouchered Dong Ling Mt., Betula Forest, Beijing, China
Thalictrum petaloideum L.Thpet2Unvouchered Tong Ling Mt., Yin Ranje, Beijing, China
Thalictrum pinnatum S. WatsonThpin1R. M. Straw & M. Forman 1857 (RSA)Chihuahua, Mexico
Thalictrum podocarpum Kunth ex DC.Thpod1M. Weigend 2000/623 (OSC)Ancash, Huaylas, Pampanomas, Peru
Thalictrum polycarpum (Torr.) S. WatsonThpol3B. Keller s.n. (UC)Cultivated at University of California Botanical Garden at Berkeley, CA, USA
Thalictrum polycarpum (Torr.) S. WatsonThpol2J. F. Smith 4572 (WTU)Cassia County, Idaho, USA
Thalictrum przewalskii Maxim.Thprz1D. E. Boufford et al. 36521 (GH)Sichuan, Dege Xian, China
Thalictrum pubescens PurshThpub1D. Baum & D. Howarth 375 (A)Arnold Arboretum, Jamaica Plain, MA, USA
Thalictrum punctatum H. Lév.Thpun1V. Di Stilio 117 (WTU)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum ramosum B. BoivinThram1A. Larsen s.n. (UC)Cultivated at UC Botanical Garden at Berkeley, CA, USA
Thalictrum reniforme Wall.Thren1B. Keller s.n. (UC)Cultivated at University of California Botanical Garden at Berkeley, CA, USA
Thalictrum reticulatum Franch.Thret1D. E. Boufford et al. 42802 (GH)Sichuan, Muli Xian, China
Thalictrum revolutum DC.Threv2A. Floden 1347 (TENN)Campbell County, TN, USA
Thalictrum revolutum DC.Threv1V. Soza 1917 (WTU)Cultivated from USDA AMES #28275
Thalictrum rhynchocarpum Quart.‐Dill. & A. Rich.Thrhy3W. Kindeketa 820 (MO)Arusha, Tanzania
Thalictrum rutifolium Hook. f. & ThomsonThrut2D. E. Boufford et al. 32127 (GH)Xizang (Tibet), Riwoqe Xian, China
Thalictrum simplex L.Thsim2V. Soza 1914 (WTU)Cultivated from USDA GRIN AMES #23805
Thalictrum smithii B. BoivinThsmi4D. E. Boufford et al. 28205 (A)Sichuan, Daocheng Xian, Gongling, China
Thalictrum sparsiflorum Turcz. ex Fisch. & C. A. Mey.Thspa1M. Williams 1630 (OSC)7 miles from Seward, AK, USA
Thalictrum squamiferum Lecoy.Thsqu2D. E. Boufford et al. 32003 (GH)Xizang (Tibet), Riwoqe Xian, China
Thalictrum squarrosum Stephan ex Willd. Thsqu3X. Duan 20120617 (PE)Cultivated at CAS Botanical Garden, Beijing, China
Thalictrum steyermarkii Standl.Thste1T. B. Croat 40494 (MO)Chiapas, Mexico
Thalictrum tenue Franch.Thten1W. Zhai 20120615 (PE)Wanging, Henan, China
Thalictrum thalictroides (L.) A. J. Eames & B. BoivinThtha10a V. Di Stilio 124 (WTU)Cultivated from Arrowhead Alpines nursery, Michigan, USA
Thalictrum thalictroides (L.) A. J. Eames & B. BoivinThtha9V. Di Stilio 123 (WTU)Cultivated from natural population from Massachusetts, USA
Thalictrum tripeltiferum B. BoivinThtri1L. E. Detling 8788 (ORE)Jalisco, Mexico
Thalictrum uchiyamae Nakai Thuch4V. Di Stilio 113 (WTU)Cultivated from seed from B & T World Seeds, Aigues‐Vives, France
Thalictrum uncatum Maxim.Thunc2D. E. Boufford et al. 30691 (GH)Sichuan, Xiangcheng Xian, China
Thalictrum urbainii Hayata = T. fauriei HayataThfau1A. Liston 1162 (OSC)Cultivated from Heronswood Nursery, Kingston, WA, USA
Thalictrum venulosum Trel. Thven2Voucher lost at OSC NA
Thalictrum virgatum Hook. f. & ThomsonThvir1D. E. Boufford et al. 30496 (GH)Sichuan, Xiangcheng Xian, China
Thalictrum zernyi Ulbr.Thzer2R. E. Gereau & C. J. Kayombo 3976 (MO)Iringa, Ludewa, Tanzania

NA = not available; s.n. = unnumbered.

Sample used for primer validation and cross‐amplification.

  20 in total

1.  Timing and consequences of recurrent polyploidy in meadow-rues (thalictrum, ranunculaceae).

Authors:  Valerie L Soza; Kendall L Haworth; Verónica S Di Stilio
Journal:  Mol Biol Evol       Date:  2013-05-31       Impact factor: 16.240

2.  Scent matters: differential contribution of scent to insect response in flowers with insect vs. wind pollination traits.

Authors:  Theresa N Wang; Marie R Clifford; Jesús Martínez-Gómez; Jens C Johnson; Jeffrey A Riffell; Verónica S Di Stilio
Journal:  Ann Bot       Date:  2019-01-23       Impact factor: 4.357

3.  Incongruence in molecular species delimitation schemes: What to do when adding more data is difficult.

Authors:  Sarah J Jacobs; Casey Kristofferson; Simon Uribe-Convers; Maribeth Latvis; David C Tank
Journal:  Mol Ecol       Date:  2018-05-07       Impact factor: 6.185

4.  MAFFT multiple sequence alignment software version 7: improvements in performance and usability.

Authors:  Kazutaka Katoh; Daron M Standley
Journal:  Mol Biol Evol       Date:  2013-01-16       Impact factor: 16.240

5.  Primer3--new capabilities and interfaces.

Authors:  Andreas Untergasser; Ioana Cutcutache; Triinu Koressaar; Jian Ye; Brant C Faircloth; Maido Remm; Steven G Rozen
Journal:  Nucleic Acids Res       Date:  2012-06-22       Impact factor: 16.971

6.  Complete plastome sequence of Thalictrum coreanum (Ranunculaceae) and transfer of the rpl32 gene to the nucleus in the ancestor of the subfamily Thalictroideae.

Authors:  Seongjun Park; Robert K Jansen; SeonJoo Park
Journal:  BMC Plant Biol       Date:  2015-02-05       Impact factor: 4.215

7.  RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies.

Authors:  Alexandros Stamatakis
Journal:  Bioinformatics       Date:  2014-01-21       Impact factor: 6.937

8.  AMAS: a fast tool for alignment manipulation and computing of summary statistics.

Authors:  Marek L Borowiec
Journal:  PeerJ       Date:  2016-01-28       Impact factor: 2.984

9.  OrganellarGenomeDRAW--a suite of tools for generating physical maps of plastid and mitochondrial genomes and visualizing expression data sets.

Authors:  Marc Lohse; Oliver Drechsel; Sabine Kahlau; Ralph Bock
Journal:  Nucleic Acids Res       Date:  2013-04-22       Impact factor: 16.971

10.  A Phylogenomic Approach Based on PCR Target Enrichment and High Throughput Sequencing: Resolving the Diversity within the South American Species of Bartsia L. (Orobanchaceae).

Authors:  Simon Uribe-Convers; Matthew L Settles; David C Tank
Journal:  PLoS One       Date:  2016-02-01       Impact factor: 3.240

View more
  2 in total

1.  Organization, Phylogenetic Marker Exploitation, and Gene Evolution in the Plastome of Thalictrum (Ranunculaceae).

Authors:  Kun-Li Xiang; Wei Mao; Huan-Wen Peng; Andrey S Erst; Ying-Xue Yang; Wen-Chuang He; Zhi-Qiang Wu
Journal:  Front Plant Sci       Date:  2022-05-20       Impact factor: 6.627

2.  Genomic and transcriptomic resources for candidate gene discovery in the Ranunculids.

Authors:  Tatiana Arias; Diego Mauricio Riaño-Pachón; Verónica S Di Stilio
Journal:  Appl Plant Sci       Date:  2021-01-29       Impact factor: 1.936

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.