Literature DB >> 31663061

Acinetobacter baumannii in sheep, goat, and camel raw meat: virulence and antibiotic resistance pattern.

Neda Askari1, Hassan Momtaz2, Elahe Tajbakhsh2.   

Abstract

Acinetobacter genus belongs to a group of Gram-negative coccobacillus. These bacteria are isolated from human and animal origins. Antimicrobial agents play a vital role in treating infectious diseases in both humans and animals, and Acinetobacter in this regard is defined as an organism of low virulence. The current study aimed to evaluate antibiotic resistance properties and virulence factor genes in Acinetobacter baumannii strains isolated from raw animal meat samples. Fresh meat samples from 124 sheep, 162 goat, and 95 camels were randomly collected from Isfahan and Shahrekord cities in Iran. Most A. baumannii strains isolated from sheep meat samples represented fimH (82.35%), aac(3)-IV (78.43%), sul1 (78.43%) and Integron Class I (96.07%) genes. Moreover, more than 50% of A. baumannii strains isolated from sheep samples were resistant to streptomycin (54.90%), gentamycin (74.50%), co-trimoxazole (70.58%), tetracycline (82.35%), and trimethoprim (62.74%). Current findings revealed significant association between the presence of fimH, cnfI, afa/draBC, dfrA1, sulI, aac(3)-IV genes in sheep samples. Furthermore, significant association was observed between fimH, cnfI, sfa/focDE and dfrA1genes in goat meat samples. In sheep meat samples, significant differences were identified in resistance to gentamicin, tetracycline, and co-trimoxazole in comparison with other antibiotics. Finally, there were statistically significant differences between the incidences of resistance to gentamicin, tetracycline, and co-trimoxazole in comparison with other antibiotics in all strains. In conclusion, the presence of virulence factors and antibiotic resistance in A. baumannii strains isolated from animal meat samples showed that animals should be considered as a potential reservoir of multidrug-resistant A. baumannii.
© 2019 the Author(s), licensee AIMS Press.

Entities:  

Keywords:  Acinetobacter baumannii; Iran; antibiotic resistance pattern; ruminant meat; virulence factors

Year:  2019        PMID: 31663061      PMCID: PMC6787353          DOI: 10.3934/microbiol.2019.3.272

Source DB:  PubMed          Journal:  AIMS Microbiol        ISSN: 2471-1888


Introduction

Acinetobacter baumannii (A. baumannii) has been considered a major nosocomial pathogen, especially in intensive care units (ICUs), which can produce numerous infections such as septicemia, nosocomial meningitis, urinary tract infection, bacteremia, wound infection, infection of skin and soft tissue, and high-mortal pneumonia [1]. Interestingly, it can be identified in a range of food items, such as fruits, raw vegetables, milk, and dairy products [2]. There are few science reports of infections due to A. baumannii in animals and only a scarce number of studies have reported such cases [3]. Of this genus, A. baumannii strains revealed more resistant patterns than other species and often express a multi-drug resistant (MDR) phenotype. Consequently, during the past 30 years, strains of A. baumannii have obtained resistance against newly developed antimicrobial agents. This fact has become prevalent in some hospitals in the world and has been identified as a complicated nosocomial pathogen [4]. Antimicrobial agents are essential for treating infectious diseases in both humans and animals [5]. Based on the degree of antimicrobial resistance for Acinetobacter spp., there are three different terms: multidrug resistant (MDR), extensive drug resistant (XDR), and pan-drug resistant (PDR). MDR Acinetobacter spp. refers to resistance pattern to a minimum of three classes of antimicrobial drugs such as penicillin and cephalosporin, fluoroquinolone, and aminoglycoside [6]. Another multidrug resistance definition belongs to the resistance pattern to more than two of the following five antibiotic drug classes: antipseudomonal cephalosporin (ceftazidime or cefepime), antipseudomonal carbapenem (imipenem or meropenem), ampicillin-sulbactam, fluoroquinolone (ciprofloxacin or levofloxacin), and aminoglycoside (gentamicin, tobramycin, or amikacin) [7]. Acinetobacter is defined as an organism of low virulence, which among the possible virulence factors, one can mention cell surface hydrophobicity, outer membrane proteins (OMPs), toxic slime polysaccharides, and verotoxins. Many factors like extracellular enzymes, cytotoxins and secreted vascular permeability are produced by A. baumannii that are involved in the pathogenesis and cause harm to host tissues particularly in respiratory tract infections [8]. The pathogenesis in bacteria can be due to the prevalence of virulence factors, which are involved in some performances such as colonizing on the epithelium, evading and inhibiting the host's immune response through biofilm formation, and obtaining nutrition from the host [9]. However, there is little information about the virulence factors in A. baumannii and identifying these factors can develop novel therapeutic alternatives for the control of clinically relevant pathogen [10]. Only few research studies have stimulated data regarding A. baumannii in veterinary medicine. The issue of emerging pathogen in veterinary medicine with a high potential for multidrug resistance and prevalence of A. baumannii is becoming alarmingly evident [10]. Actually, Acinetobacter spp. have been isolated from different animal sources such as birds, fish, and rainbow trout. Moreover, some chicken septicemia, mastitis and metrititis in cows, abortions in cattle, pigs and horses, keratoconjunctivitis in cattle, omphalitis in calves, ear infections in cats, and respiratory infections and balanoposthitis in horses have been identified [10]. Based on research by Vaneechoutte et al. [11], seven A. baumannii isolates were identified from jugular catheter tips placed in horses, but the organism was only indicated as responsible for local infection or colonization. Francey et al. [12] identified the clinical characteristics of several pets, which suffer from different A. baumannii infections such as urinary, respiratory, wound and bloodstream infections, reporting an overall attributable mortality of 47%. Studies regarding the association of A. baumannii strains with foodborne illnesses are somewhat limited. Therefore, the present investigation was done to study the prevalence rate and phenotypic characterization of antibiotic resistance of the A. baumannii strains isolated from sheep, goat, and camel raw meat samples.

Material and methods

Study samples

A total of 124 sheep, 162 goat, and 95 camels fresh raw meat samples were randomly selected from 106 meat shops in Isfahan and Shahrekord. All samples were taken from the femur muscle of animal species. Thirty grams of meat were collected from each animal. The cross-sectional study was conducted from December 2015 to September 2016. It is notable that all the samples were approved (healthy) by the specialized veterinarians of Shahrekord Azad University.

Isolation and identification of A. baumannii

Specimens were collected by a laboratory technician, properly labeled, and transferred immediately to the microbiology laboratory. Each of these samples were streaked on blood agar (Merck, Germany) and MacConkey agar (Merck, Germany), and then incubated aerobically at 37 °C for 24 hours. Further, non-hemolytic, opaque and creamy colonies on blood agar and non-lactose fermenting colonies on MacConkey agar were sub-cultured on MacConkey agar and incubated for 24 hours at 37 °C to achieve pure colonies. The isolated organisms were identified based on colonial and microscopic characteristics and different biochemical tests according to standard laboratory methods. Stock cultures were conserved in both agar slant and 20% sterile buffered glycerin and were maintained at -70 °C [13]. A DNA Extraction Kit (Cinnagen, Iran) was used to extract genomic DNA from the bacterial isolates according to the manufacturer's instructions. To confirm and recognition of the isolates, conventional polymerase chain reaction (PCR) was performed by amplification of 16S–23S ribosomal DNA and the primer pairs shown in Table 1.
Table 1.

Primers used for detection of virulence genes in A. baumannii [14].

GenePrimer namePrimer Sequence (5′–3′)Size of product (bp)
afa/draBCafa1GCTGGGCAGCAAACTGATAACTCTC750
afa2CATCAAGCTGTTTGTTCGTCCGCCG
cnf1cnf1AAGATGGAGTTTCCTATGCAGGAG498
cnf2CATTCAGAGTCCTGCCCTCATTATT
cnf2cnf2aAATCTAATTAAAGAGAAC543
cnf2bCATGCTTTGTATATCTA
csgAM464ACTCTGACTTGACTATTACC200
M465AGATGCAGTCTGGTCAAC
cvaCColV-CFCACACACAAACGGGAGCTGTT680
ColV-CRCTTCCCGCAGCATAGTTCCAT
fimHFimH FTGCAGAACGGATAAGCCGTGG508
FimH RGCAGTCACCTGCCCTCCGGTA
fyuAFyuA fTGATTAACCCCGCGACGGGAA880
FyuA RCGCAGTAGGCACGATGTTGTA
ibeAibe10 FAGGCAGGTGTGCGCCGCGTAC170
fibe10 RTGGTGCTCCGGCAAACCATGC
iutAAerJ FGGCTGGACATCATGGGAACTGG300
AerJ RCGTCGGGAACGGGTAGAATCG
kpsMT IIkpsII FGCGCATTTGCTGATACTGTTG272
kpsII RCATCCAGACGATAAGCATGAGCA
PAIRPAi FGGACATCCTGTTACAGCGCGCA930
RPAi RTCGCCACCAATCACAGCCGAAC
papCpap1GACGGCTGTACTGCAGGGTGTGGCG328
pap2ATATCCTTTCTGCAGGGATGCAATA
PapG II, IIIpGfCTGTAATTACGGAAGTGATTTCTG1070
pGrACTATCCGGCTCCGGATAAACCAT
sfa/focDEsfa1CTCCGGAGAACTGGGTGCATCTTAC410
sfa2CGGAGGAGTAATTACAAACCTGGCA
traTTraT FGGTGTGGTGCGATGAGCACAG290
TraT RCACGGTTCAGCCATCCCTGAG
A. baumannii detection16S-23S(F) CATTATCACGGTAATTAGTG208
ribosomal DNA(R) AGAGCACTGTGCACTTAAG
PCRs were carried out in 50 µL volume, the ingredients of which consisted of 5 µL of 10X PCR buffer, 2 mM of MgCl2, 150 µM of dNTPs mix, one unit of Taq DNA polemerase (Fermentas-Lithuania), 1 µM of reverse and forward primers, and 3 µL of template DNA (being the DNA of the isolates). PCR program was set to a cycle of 6 min at 94 °C, 30 repetitive cycles, of 95 °C for 60 s, 58 °C for 60 s, and 72 °C for 40 s, as well as a last cycle of 72 °C for 5 min, respectively (Table 3) [15]. (Tavakol 2018). All PCR reactions were performed in a thermocycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel-Hinz GmbH, Hamburg, Germany), and products of PCR amplification were visualized by electrophoresis in 1.5% agaros gel. Ultimately, fragment amplifications with a size of 208 bp illustrated the presence of A. baumannii in isolated samples.
Table 3.

PCR conditions for virulence genes, antibiotic resistance genes and integrons detection in A. baumannii.

draBC, cnf1, csgA, cvaC, iutA, fyuA1 cycle: 95 °C ------------ 4 min. 30 cycle: 95 °C ------------ 50 s 58 °C ------------ 60 s 72 °C ------------ 45 s 1 cycle: 72 °C ------------ 8 min5 µL PCR buffer 10X 1.5 mM Mgcl2 200 µM dNTP (Fermentas) 0.5 µM of each primers F & R 1.25 U Taq DNA polymerase (Fermentas) 2.5 µL DNA template
cnf2, kpsMT II, PAI, papC1 cycle: 94 °C ------------ 6 min. 34 cycle: 95 °C ------------ 50 s 58 °C ------------ 70 s 72 °C ------------ 55 s 1 cycle: 72 °C ------------ 10 min5 µL PCR buffer 10X 2 mM Mgcl2 150 µM dNTP (Fermentas) 0.75 µM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
fimH, ibeA, PapG II-III, sfa/focDE, traT1 cycle: 95 °C ------------ 4 min. 34 cycle: 94 °C ------------ 60 s 56 °C ------------ 45 s 72 °C ------------ 60 s 1 cycle: 72 °C ------------ 10 min5 µL PCR buffer 10X 2 mM Mgcl2 200 µM dNTP (Fermentas) 0.5 µM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 5 µL DNA template
16S-23S ribosomal DNA1 cycle: 94 °C ------------ 6 min. 30 cycle: 95 °C ------------ 60 s 58 °C ------------ 60 s 72 °C ------------ 40 s 1 cycle: 72 °C ------------ 5 min5 µL PCR buffer 10X 2mM Mgcl2 150 µM dNTP (Fermentas) 1 µM of each primers F & R 1 U Taq DNA polymerase (Fermentas) 3 µL DNA template
aadA1, aac(3)-IV, sul1, blaSHV, CITM, cat1, cmlA, tet(a), tet(B), dfrA1, and qnr.1 cycle: 94 °C ------------ 6 min. 33 cycle: 95 °C ------------ 70 s 55 °C ------------ 65 s 72 °C ------------ 90 s 1 cycle: 72 °C ------------ 8 min5 µL PCR buffer 10X 2 mM Mgcl2 150 µM dNTP (Fermentas) 0. 5 µM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 2 µL DNA template
imp, vim, and sim1 cycle: 95 °C ------------ 4 min. 30cycle: 95 °C ------------ 45 s 58 °C ------------ 60s 72 °C ------------ 40 s 1 cycle: 72 °C ------------ 5min5 µL PCR buffer 10X 1.5 mM Mgcl2 100 µM dNTP (Fermentas) 1 µM of each primers F & R 1 U Taq DNA polymerase (Fermentas) 2.5 µL DNA template
Oxa-23-like, Oxa-24-like, Oxa-51-like, Oxa-58-like)1 cycle: 94 °C ------------ 5 min. 32 cycle: 95 °C ------------ 50 s 60 °C ------------ 60 s 72 °C ------------ 70 s 1 cycle: 72 °C ------------ 10 min5 µL PCR buffer 10X 2.5 mM Mgcl2 200 µM dNTP (Fermentas) 0.5 µM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 2 µL DNA template
Int I/II/III1 cycle: 94 °C ------------ 6 min. 35 cycle: 94 °C ------------ 60 s 56 °C ------------ 60 s 72 °C ------------ 45 s 1 cycle: 72 °C ------------ 6 min5 µL PCR buffer 10X 1.5 mM Mgcl2 200 µM dNTP (Fermentas) 0.5 µM of each primers F & R 1 U Taq DNA polymerase (Fermentas) 2.5 µL DNA template

Antimicrobial susceptibility patterns

Susceptibility of antimicrobial agents was assessed by the Kirby–Bauer disk diffusion method using Mueller–Hinton agar (HiMedia Laboratories, Mumbai, India, MV1084), according to the Clinical and Laboratory Standards Institute guidelines. After incubating the inoculated plate aerobically at 37 °C for 18–24 h, the A.baumannii isolates' susceptibility to each antimicrobial agents were measured and the results were interpreted in accordance with interpretive criteria provided by CLSI (2017) [16]. The antibimicrobial agents in this investigation were trimethoprim (5 µg/disk); tetracycline (30 µg/disk); ceftazidime (30 µg/disk); cephalothin (30 µg/disk); co-trimoxazole (23.75/1.25 µg/disk); tobramycin (10 µg/disk); amikacin (30 u/disk); gentamicin (10 µg/disk); streptomycin (10 µg/disk); erythromycin (15 µg/disk); rafampicin (5 µg/disk); azithromycin (15 µg/disk); nitrofurantoin (300 µg/disk); chloramphenicol (30 µg/disk); mupirocin (30 µg/disk); imipenem (10 µg/disk); levofloxacin (5 µg/disk), and ciprofloxacin (5 µg/disk). For quality control purposes, the A. baumannii ATCC 19606 was used to determine antimicrobial susceptibility.

Virulence factors, antibiotic resistance and integrons genes detection

The virulence genes, antibiotic resistance coding genes, and integrons are presented in tables 1 and 2. PCR programs (temperature and volume) for detection of 16S–23S ribosomal DNA and all mentioned genes in A. baumannii are summarized in Table 3 [15]. The PCR amplified products (10µL) were subjected to electrophoresis in a 1.5% agaros gel (Fermentas, Germany) in 1X TBE buffer (Fermentas, Germany) at 80V for 30 minutes, stained with DNA Safe Stain (Cinnagen, Iran), which were subsequently examined under ultra violet illumination (Uvitec, England). In current study, in order to detect the molecular mass of PCR products the 100-bp ladder (Fermentas, Germany) was used as a standard factor, and to finalize the PCR results (confirm or reject), the PCR products of the primary positive samples were purified by a PCR product purification kit (Roche Applied Science, Germany) and sent to the Macrogen Co. (South Korea) for sequencing.
Table 2.

Primers used for detection of antibiotic resistance genes in A. baumannii [17].

GenePrimer Sequence (5′-3′)Size of product (bp)
aadA1(F) TATCCAGCTAAGCGCGAACT447
(R) ATTTGCCGACTACCTTGGTC

aac(3)-IV(F) CTTCAGGATGGCAAGTTGGT286
(R) TCATCTCGTTCTCCGCTCAT

sul1(F) TTCGGCATTCTGAATCTCAC822
(R) ATGATCTAACCCTCGGTCTC

blaSHV(F) TCGCCTGTGTATTATCTCCC768
(R) CGCAGATAAATCACCACAATG

CITM(F) TGGCCAGAACTGACAGGCAAA462
(R) TTTCTCCTGAACGTGGCTGGC

cat1(F) AGTTGCTCAATGTACCTATAACC547
(R) TTGTAATTCATTAAGCATTCTGCC

cmlA(F) CCGCCACGGTGTTGTTGTTATC698
(R) CACCTTGCCTGCCCATCATTAG

tet(A)(F) GGTTCACTCGAACGACGTCA577
(R) CTGTCCGACAAGTTGCATGA

tet(B)(F) CCTCAGCTTCTCAACGCGTG634
(R) GCACCTTGCTGATGACTCTT

dfrA1(F) GGAGTGCCAAAGGTGAACAGC367
(R) GAGGCGAAGTCTTGGGTAAAAAC

Qnr(F) GGGTATGGATATTATTGATAAAG670
(R) CTAATCCGGCAGCACTATTTA

Imp(F) GAATAGAATGGTTAACTCTC188
(R) CCAAACCACTAGGTTATC

Vim(F) GTTTGGTCGCATATCGCAAC382
(R) AATGCGCAGCACCAGGATAG

Sim(F) GTACAAGGGATTCGGCATCG569
(R) GTACAAGGGATTCGGCATCG

Oxa-51-like(F) TAATGCTTTGATCGGCCTTG353
(R) TGGATTGCACTTCATCTTGG

Oxa-23-like(F) GATCGGATTGGAGAACCAGA501
(R) ATTTCTGACCGCATTTCCAT

Oxa-24-like(F) GGTTAGTTGGCCCCCTTAAA246
(R) AGTTGAGCGAAAAGGGGATT

Oxa-58-like(F) AAGTATTGGGGCTTGTGCTG599
(R) CCCCTCTGCGCTCTACATAC

IntIF: CAG TGG ACA TAA GCC TGT TC160
R: CCC GAC GCA TAG ACT GTA

IntIIF: TTG CGA GTA TCC ATA ACC TG288
R: TTA CCT GCA CTG GAT TAA GC

IntIIIF: GCC TCC GGC AGC GAC TTT CAG1041
R: ACG GAT CTG CCA AAC CTG ACT

Statistical analysis

The obtained data were analyzed using IBM SPSS software version 18 and P values were calculated using Chi-square and Fisher's exact tests to identify statistically significant association between distribution of virulence genes, and antibiotic resistance properties of the A. baumannii strains isolated from sheep, goat, and camel meat samples. A P value < 0.05 was considered statistically significant.

Results

A total of 381 samples, 124 samples of sheep meat, 162 samples of goat meat and 95 samples from camel meat were obtained; of these, A. baumannii were isolated from 51 (41.12%) sheep meat samples, 19 (11.72%) from goat meat samples and 5 (2.26%) from camel meat samples (Table 4). Moreover, there is significant difference between sheep meat with other samples infected with A. baumannii (P = 0.025)
Table 4.

Incidence of A. baumannii strains in sheep, goat and camel raw meat samples.

SamplesNo. SamplesNo. A. baumanniiIsolation rate
Sheep meat1245141.12%
Goat meat1621911.72%
Camel meat9552.26%
Total3817519.68%
Interestingly, the highest virulence factor genes, which were detected in all strains isolated from samples were fimH (Table 5). Based on statistical analysis, there was significant association between the presence of fimH, cnfI, afa/draBC genes in this virulence factor gene with other genes in sheep samples (P = 0.031). In addition, there was significant association between fimH, cnfI, sfa/focDE genes with other genes in goat meat samples (P = 0.042), and strong association was observed between the presence of fimH, cnfI, sfa/focDE, afa/draBC virulence factor genes with others genes in camel isolated samples (P = 0.029). According to this table, it can be concluded that almost all virulence factor genes were represented in sheep samples except fyuA. For goat and camel samples, the presence of PAI and papGIII genes was not detected.
Table 5.

Frequency of virulence factor genes in A. baumannii strains isolated from sheep, goat and camel meat samples.

Sample/frequencyfimHfyuAiutAcvaCcsgACnf2Cnf1afa/draBC
Sheep/5142-171211172427
Goat/191477373116
Camel/53--1--11
Sample/frequencytraTSfa/focDEPapG IIIPapG IIpapCibeAPAIKpsMT II
Sheep/51227311810213
Goat/1934-363-4
Camel/511--11--
Table 6 demonstrates the frequency of antibiotic resistance genes in sheep, goat, and camel meat samples, which revealed that none of the three meat sample groups represented the qnr gene. The highest and lowest antibiotic resistance genes were aac(3)-IV, sul1 and sim in sheep meat sample with resistance values of 80.39%, 80.39% and 1.96%, respectively. Moreover, in the studied samples, all genes represented except qnr. Statistical analysis revealed significant association between the presence of dfrA1, sulI, aac(3)-IV genes in sheep isolated samples (P = 0.019); in goat samples, strong association between dfrA1 gene (P = 0.021) were observed, and in all sample groups, dfrA1, sulI, aac(3)-IV genes showed significant difference in comparison to other antibiotic resistance genes (P = 0.025).
Table 6.

Frequency of antibiotic resistance genes in A. baumannii strains isolated from sheep, goat and camel meat samples.

Sample/frequencyaadA1aac(3)-IVsul1blaSHVblaCITMtetAtetBdfrA1qnr
Sheep/512840402421182636-
Goat/19991110107515-
Camel/5122212-3-
Sample/frequencyvimsimImpcat1cmlAOxa-51-likeOxa-23-likeOxa-24-likeOxa-58-like
Sheep/51312255364
Goat/192-13-21-3
Camel/5----21-12
Integron genes are presented in Table 7 and it can be concluded that the most frequent gene in all sample groups was the Integron Class I, but Integron Class III was not found in goat and camel positive samples. Overall, 85.33% of isolated A. baumannii strains represented Class I Integron genes. Statistics confirmed significant association between the presence of Integron Class I in sheep, goat and camel isolated samples (P = 0.019, 0.032 and 0.041, respectively); moreover, the presence of Integron Class I revealed significant difference in comparison to other Integron genes (P = 0.029).
Table 7.

Frequency of Integron genes in A. baumannii strains isolated from sheep, goat and camel meat samples.

Class IClass IIClass IIISample/frequency
49161Sheep/51
116-Goat/19
41-Camel/5
Antimicrobial susceptibility tests conducted using the Kirby-Bauer test revealed that more than 50% of A. baumannii stains isolated from sheep samples were resistant to streptomycin, gentamycin, co-trimoxazole, tetracycline, and trimethoprim (Table 8). The highest resistance was observed in A. baumannii stains isolated from goat and camel meat samples belong to trimetoprim.
Table 8.

Antibiotic resistance pattern in A. baumannii strains isolated from sheep, goat and camel meat samples.

Sample/frequencystreptomycingentamicinamikacintobramycinco-trimoxazolecephalotinceftazidimetetracyclinetrimetoprim
Sheep/51283821203619164232
Goat/19781091110121114
Camel/5-2-12--23
Sample/frequencyciprofloxacinlovofloxacinimipenemmeropenemcloramphenicolnitrofurantoinazithromycinrifampinerythromycin
Sheep/5112757674622
Goat/1973-234248
Camel/51---21--1
Statistical analysis showed significant difference between resistance to gentamicin, tetracycline, and co-trimoxazole in comparison with other antibiotics in isolated strains of sheep meat samples (P = 0.032). Overall, there were statistically significant differences amongst the incidences of resistance to gentamicin, tetracycline, and co-trimoxazole in comparison with other antibiotics in all strains (P = 0.026).

Discussion

In literatures, Acinetobacter are denoted as a heterogeneous group of organisms that are found almost everywhere, frequently distributed in the environment. The isolated strains of this species have frequently originated from animals including birds, fish, and rainbow trout [6]. Researchers have rarely assessed the infections due to A. baumannii in animals. Among previous findings, we could mention the study on A. baumannii isolates from different animals including ducks, pigeons, chickens, donkeys, rabbits, pets (cats and dogs), mules, livestock (cattle, sheep, goats, pigs), horses, lice and arthropods, which outbreaks in human medicine have been reported in several years [18],[19]. In the present study, antibiotic resistance patterns and virulence factors, and antibiotic resistance genes and Integron genes were assessed, which most sheep meat samples with A. baumannii represented fimH, aac(3)-IV, sul1 and Integron Class I genes. Nonetheless, among all isolated stains, all genes except qnr were represented. Eventually, more than 50% of A. baumannii stains isolated from sheep meat samples were resistant to streptomycin, gentamycin, co-trimoxazole, tetracycline, and trimetoprim. The most resistance pattern in A. baumannii stains isolated from goat and camel meat samples belongs to trimetoprim. Some research findings in other research groups revealed the same result as our investigation; however, some research findings contradicted with our findings. For example, Francey et al. showed the clinical characteristics of several pets with various A. baumannii infections such as urinary, respiratory, wound and bloodstream infections. Their findings revealed an overall attributable mortality of 47% [12]. A research discovery presented that all 16 A. baumannii isolates from food-producing animals were sensitive to imipenem, meropenem, and ciprofloxacin and piperacillin/tazobactam; however, those samples were resistant to ceftazidime [20]. In another survey on 16 A. baumannii isolates, the outcomes proved 100% sensitivity to carbapenems, gentamicin, ciprofloxacin, and piperacillin/tazobactam; nonetheless, those samples were resistant to amoxicillin, cefradine, trimethoprim, and chloramphenicol [21]. In a research project by Rafei et al. (2015) [22], a total of 73 water samples, 51 soil samples, 37 raw cow milk samples, 50 cow meat samples, 7 raw cheese samples, and 379 animal samples were analyzed to detect the presence of A. baumannii. A. baumannii was found in 6.9% of water samples, 2.7% of milk samples, 8.0% of meat samples, 14.3% of cheese samples, and 7.7% of animal samples. All isolates in this survey presented a susceptible phenotype to most of the antibiotics tested with seldom findings regarding carbapenemase-encoding genes, except one that harbored a blaOXA-143 gene. This study verified that animals could be a potential reservoir for A. baumannii and dissemination of new emerging carbapenemases. Gram-Negative Bacteria (GNB) that possessed A. baumannii with some other species had been assessed and isolated from mastitic milk samples of dairy cattle. Findings revealed that half of the GNB isolates were resistant to 5 or more of the 12 tested antimicrobial agents [23]. Some antibiotic agents were evaluated in 57 A. baumannii bulk tank milk (BTM) isolated samples; their findings showed resistance patterns to cefepime, imipenem, meropenem, ciprofloxacin, levofloxacin, and colistin [24].

Conclusion

In the current survey, it can be inferred that although most of the isolated samples were resistant against antibiotics, more than half of A. baumannii stains isolated from sheep samples were resistant against streptomycin, gentamycin, co-trimoxazole, tetracycline, and trimetoprim. For goat and camel meat positive samples, the highest resistance belongs to trimetoprim. The most represented antibiotic resistance genes in sheep meat samples were fimH, aac(3)-IV, sul1 and Integron Class I. Interestingly, the dfrA1 gene has been represented in most samples in all three sample groups; however, none of the isolated stains revealed the qnr gene. Entirely, almost 90% of each isolated cluster were represented with Integron Class I. A. baumannii were isolated mainly from sheep, goat and camel meat samples in Iran; hence, animals should be considered as a potential reservoir of multidrug-resistant A. baumannii. Due to various factors involved in the infection in different animal species, further studies are crucial for gaining a better understanding of the origins of this infection in humans. Some limitation factors noted in the current study were restricted sample population, retrospective data analysis, unreliable species identification methods, or unique reports of accidental observations.
  18 in total

1.  Epidemiology of Acinetobacter baumannii of animal origin.

Authors:  Ahmed Hamouda; Jacqueline Findlay; Leena Al Hassan; Sebastian G B Amyes
Journal:  Int J Antimicrob Agents       Date:  2011-08-09       Impact factor: 5.283

2.  Acinetobacter baumannii isolates from pets and horses in Switzerland: molecular characterization and clinical data.

Authors:  Andrea Endimiani; Kristine M Hujer; Andrea M Hujer; Isabelle Bertschy; Alexandra Rossano; Christoph Koch; Vinzenz Gerber; Thierry Francey; Robert A Bonomo; Vincent Perreten
Journal:  J Antimicrob Chemother       Date:  2011-07-06       Impact factor: 5.790

3.  Rapid and accurate identification of genomic species from the Acinetobacter baumannii (Ab) group by MALDI-TOF MS.

Authors:  P Espinal; H Seifert; L Dijkshoorn; J Vila; I Roca
Journal:  Clin Microbiol Infect       Date:  2011-11-15       Impact factor: 8.067

Review 4.  Acinetobacter species as model microorganisms in environmental microbiology: current state and perspectives.

Authors:  Jaejoon Jung; Woojun Park
Journal:  Appl Microbiol Biotechnol       Date:  2015-02-19       Impact factor: 4.813

5.  Acinetobacter baumannii-infected vascular catheters collected from horses in an equine clinic.

Authors:  M Vaneechoutte; L A Devriese; L Dijkshoorn; B Lamote; P Deprez; G Verschraegen; F Haesebrouck
Journal:  J Clin Microbiol       Date:  2000-11       Impact factor: 5.948

Review 6.  Curli biogenesis and function.

Authors:  Michelle M Barnhart; Matthew R Chapman
Journal:  Annu Rev Microbiol       Date:  2006       Impact factor: 15.500

7.  Extrahuman epidemiology of Acinetobacter baumannii in Lebanon.

Authors:  Rayane Rafei; Monzer Hamze; Hélène Pailhoriès; Matthieu Eveillard; Laurent Marsollier; Marie-Laure Joly-Guillou; Fouad Dabboussi; Marie Kempf
Journal:  Appl Environ Microbiol       Date:  2015-01-23       Impact factor: 4.792

Review 8.  Acinetobacter baumannii: emergence of a successful pathogen.

Authors:  Anton Y Peleg; Harald Seifert; David L Paterson
Journal:  Clin Microbiol Rev       Date:  2008-07       Impact factor: 26.132

9.  Gram-negative non-fermenting bacteria from food-producing animals are low risk for hospital-acquired infections.

Authors:  A Hamouda; L Vali; S G B Amyes
Journal:  J Chemother       Date:  2008-12       Impact factor: 1.714

Review 10.  Acinetobacter spp. as nosocomial pathogens: Epidemiology and resistance features.

Authors:  Saad B Almasaudi
Journal:  Saudi J Biol Sci       Date:  2016-02-11       Impact factor: 4.219

View more
  2 in total

1.  Diversity of bacterial pathogens and their antimicrobial resistance profile among commensal rodents in Qatar.

Authors:  Md Mazharul Islam; Elmoubashar Farag; Mohammad Mahmudul Hassan; Khalid A Enan; K V Mohammad Sabeel; Maryam Mohammed Alhaddad; Maria K Smatti; Abdulla Mohammad Al-Marri; Abdul Azia Al-Zeyara; Hamad Al-Romaihi; Hadi M Yassine; Ali A Sultan; Devendra Bansal; Zilungile Mkhize-Kwitshana
Journal:  Vet Res Commun       Date:  2022-01-27       Impact factor: 2.459

Review 2.  An Overview of Antibiotic Resistance and Abiotic Stresses Affecting Antimicrobial Resistance in Agricultural Soils.

Authors:  Abdullah Kaviani Rad; Angelika Astaykina; Rostislav Streletskii; Yeganeh Afsharyzad; Hassan Etesami; Mehdi Zarei; Siva K Balasundram
Journal:  Int J Environ Res Public Health       Date:  2022-04-12       Impact factor: 4.614

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.