Fang Wei1, Mofei Wang1, Zhen Li1, Yong Wang1, Yong Zhou1. 1. Department of General Surgery, The Fourth Affiliated Hospital of China Medical University, Shenyang, Liaoning 110033, P.R. China.
Abstract
Increasing evidence suggests that microRNAs (miRNAs or miRs) serve a critical role in tumor development. However, the role of miRNAs in non‑small cell lung cancer (NSCLC) progression remains largely unknown. The present study observed that miR‑593 was significantly impaired in patients with NSCLC and was a novel regulator of NSCLC progression. Patients whose tumors had high expression levels of miR‑593 had longer overall survival than patients whose tumors had low levels of miR‑593 expression (P=0.0219). miR‑593 expression levels were inversely correlated with zinc finger protein SNAI2 (SLUG) messenger RNA (mRNA) levels in 87 clinical tissue specimens of NSCLC (P<0.001). A luciferase assay demonstrated that miR‑593 interacted with the binding sites present in the SLUG 3'‑untranslated region and reduced the expression of SLUG. Introduction of a miR‑593 mimic suppressed cell proliferation by inactivating the SLUG/protein kinase B (Akt)/cyclin D1/CDK4 or CDK6 signaling pathway, while it induced apoptosis by activating the SLUG/Akt/Bcl‑2/BAX signaling pathway. Furthermore, introduction of a miR‑593 mimic recovered the expression of E‑cadherin at the protein and mRNA level, and inhibited cell migration and invasion. In conclusion, these results indicated that miR‑593 may act as a tumor suppressor in NSCLC to decelerate cancer aggressiveness by inhibiting SLUG expression.
Increasing evidence suggests that microRNAs (miRNAs or miRs) serve a critical role in tumor development. However, the role of miRNAs in non‑small cell lung cancer (NSCLC) progression remains largely unknown. The present study observed that miR‑593 was significantly impaired in patients with NSCLC and was a novel regulator of NSCLC progression. Patients whose tumors had high expression levels of miR‑593 had longer overall survival than patients whose tumors had low levels of miR‑593 expression (P=0.0219). miR‑593 expression levels were inversely correlated with zinc finger protein SNAI2 (SLUG) messenger RNA (mRNA) levels in 87 clinical tissue specimens of NSCLC (P<0.001). A luciferase assay demonstrated that miR‑593 interacted with the binding sites present in the SLUG 3'‑untranslated region and reduced the expression of SLUG. Introduction of a miR‑593 mimic suppressed cell proliferation by inactivating the SLUG/protein kinase B (Akt)/cyclin D1/CDK4 or CDK6 signaling pathway, while it induced apoptosis by activating the SLUG/Akt/Bcl‑2/BAX signaling pathway. Furthermore, introduction of a miR‑593 mimic recovered the expression of E‑cadherin at the protein and mRNA level, and inhibited cell migration and invasion. In conclusion, these results indicated that miR‑593 may act as a tumor suppressor in NSCLC to decelerate cancer aggressiveness by inhibiting SLUG expression.
Currently, lung cancer remains the leading cause of cancer-associated mortality worldwide. Of all the patients with lung cancer, >85% are diagnosed with non-small cell lung cancer (NSCLC); of these, ~70% present with unresectable disease. Although molecular targeted therapies are markedly improving and systematic chemotherapeutic regimens are currently available, the outcomes of patients with advanced NSCLC are usually poor (1). Therefore, targeting genes associated with NSCLC progression may be an alternative therapeutic strategy to prolong the survival of patients with this refractory cancer.SLUG, a zinc-finger transcriptional repressor encoded by the SNAI2 gene, inhibits E-cadherin expression, resulting in epithelial-mesenchymal transition (EMT) (2), and has been implicated in a variety of cancer types, including NSCLC. The messenger RNA (mRNA) expression of SLUG has been revealed to be inversely correlated with estrogen receptor 1 (ESR1) mRNA expression. In addition, SLUG and ESR1 have been demonstrated to be independent prognostic factors for survival in metastatic NSCLC (3). In lung squamous cell cancer, SLUG expression was revealed to have a poor prognostic significance and an independent prognostic value (4). SLUG increased sensitivity to tubulin-binding agents and mediated the malignant phenotype of the lung cancer cells A549 and NCI-NCI-H1299 (5). Suppression of SLUG expression inhibited cell growth, invasion and metastasis in lung cancer (6–8). A previous study revealed that suppression of SLUG induced by microRNA (miRNA or miR)-1 prevented cancer malignancy in NCI-NCI-H1299 cells undergoing EMT (9). Ectopic expression of miR-140 inhibited EMT and decreased invasion by targeting SLUG in esophageal cancer (10). Knockdown of SLUG by miR-203 reversed EMT in glioblastoma cells and sensitized these cells to chemotherapy (11). However, the mechanism of SLUG regulation by miRNAs in lung cancer remains to be fully elucidated.Since miRNAs have been proposed as regulators of cancer metastasis and SLUG appears to be an oncogene, the present study aimed to identify SLUG-targeting miRNAs and to assess whether these miRNAs have prognostic or therapeutic implications in NSCLC. miR-593 has been revealed to decrease cisplatin sensitivity by targeting the 3′-untranslated region (UTR) of mitochondrial fission factor in tongue squamous cell carcinoma (12). miR-593 reduced polo-like kinase 1 expression, decreased cell proliferation and increased the number of cells in the G2/M phase (13).However, the molecular mechanism through which SLUG functions in lung cancer development remains unknown. The present study identified SLUG as a target gene of miR-593 and determined that the mechanism of miR-593-mediated proliferation, apoptosis and invasion processes involves the regulation of SLUG expression in NSCLC cells.
Materials and methods
Patients
Patients with NSCLC were recruited at the Fourth Affiliated Hospital of China Medical University between May 2011 and September 2016 for the present study. The diagnosis of lung cancer was performed by surgeons and pathologists at The Fourth Affiliated Hospital of China Medical University (Shenyang, China). Patients with one of the following conditions were excluded: Recurrent lung cancer; use of immune suppressive agents; having severe organ diseases; and suffering from autoimmune diseases. The information concerning the patients, including sex, age, cigarette smoking history and pathological features are provided in Table I. The study procedures were approved by the Human Ethics Committee at The Fourth Affiliated Hospital of China Medical University. All the experiments were performed in accordance with the Declaration of Helsinki and the approved guidelines (14). Informed written consent was obtained from each participant.
Table I.
The relationship between miR-593 expression and clinicopathological features in NSCLC.
miR-593 expression
Parameters
Description
No. of patients
Low
High
χ2
P-value
Sex
Male
52
29
23
1.880
0.170
Female
28
20
8
Age (years)
<40
35
16
19
0.632
0.229
≥40
45
23
22
Cigarette smoking
Yes
52
31
21
0.167
0.683
no
28
18
10
Tumor size (cm)
<5
32
15
17
4.643
0.031[a]
≥5
48
34
14
Depth of invasion (pT)
T1, T2
36
21
15
0.235
0.628
T3, T4
44
28
16
Lymph node metastasis (pN)
No
32
14
18
6.88
0.009[a]
Yes
48
35
13
Distant metastasis (pM)
No
73
42
31
4.853
0.028[a]
Yes
7
7
0
TNM stage
I–II
48
25
23
4.248
0.039[a]
III–IV
32
24
8
P<0.05, indicating a statistically significant difference. NSCLC, non-small cell lung cancer; T, tumor; N, node; M, metastasis; p, pathological stage.
Cell culture and transfection
A549, NCI-H1299, NCI-H358 and NCI-H1993 cells cover most histological types and common mutants in NSCLC, including TP53, RAS and EGFR. These cell lines were selected to investigate the mechanisms underlying the inhibition of NSCLC progression by miR-593. These four cell lines were purchased from the American Type Culture Collection and were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovineserum (FBS) at 37°C in a 5% CO2 and 95% air atmosphere. All the reagents were purchased from Gibco (Thermo Fisher Scientific, Inc.). The miR-593 mimic, miR-593 inhibitor, negative control (NC) RNA, SLUG small interfering RNA (siRNA) and siRNA NC were purchased from Shanghai GenePharma Co., Ltd. The oligonucleotide sequences were as follows: miR-593 mimic, 5′-UGUCUCUGCUGGGGUUUCUT-3′; miR-593 inhibitor, 5′-CGAAACCCCAGCAGAGCAUU-3′; NC RNA, 5′-UUGUCCGAACGUGUCACGUUU-3′; SLUG siRNA, sense, 5′-GAUCCGCGAUUGACACCAGAUUCAAGAGAUCTGGGTACUGCAUUGGUCUUUUUUC-3′ and antisense, 5′-AGCUUUCCAAAAAAGACCAAUGCAGUACCCAGAUCUCUUGAAUCUGGGUACUGCAUUGGUCA3′; and siRNA NC, sense, 5′-UUUUCCGAACGUGTCACGU-3′ and antisense, 5′-ACGUGACACGUUCGGAGAA-3′. Cells were transfected with Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.
Luciferase reporter assay
The wild-type (wt) or mutant (mut) 3′-UTR of the SLUG promoter was amplified and cloned into the pGL4.74 vector with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Inc.) according to the manufacturer's instructions. The primers were as follows: SLUG wt, forward, 5′-GTATACTATTTTCAGAGACTTTACTTGC-3′ and reverse, 5′-GCAAGTAAAGTCTCTGAAAATAGTATAC-3′; and SLUG mut, forward, 5′-GTATACTATTTTCTCAGACTTTACTTGC-3′ and reverse, 5′-GCAAGTAAAGTCTGAGAAAATAGTATAC-3′. The SLUG 3′-UTR wt, SLUG 3′-UTR mut and corresponding miRNA vectors were co-transfected into A549 cells. Luciferase activity was assessed using the Dual-Luciferase® Reporter Assay System (Promega Corporation) 24 h post-transfection.
MTT assays
NSCLC cell lines were transfected with NC RNA, miR-593 mimic or miR-593 inhibitor using Lipofectamine 3000. After 24 h, 1×104 cells were plated in 0.1 ml medium containing 10% FBS in each well of a 96-well plate. Upon incubation, cell proliferation was assessed by MTT assay. For this, 0.01 ml MTT solution at 5 mg/ml in PBS was added to each well. After 4 h of incubation at 37°C, the medium was replaced with 0.15 ml dimethyl sulfoxide. After 15 min incubation at 37°C, the optical density at 570 nm was determined using a microplate reader (Bio-Rad Laboratories, Inc.).
Cell migration and invasion assays
Migration and invasion assays were performed using modified Boyden chambers with a polycarbonate Nuclepore membrane. The invasion assay was performed using BioCoat Matrigel Invasion Chambers (BD Biosciences). Cells (1×105 in 100 µl serum-free DMEM supplemented with 0.1% bovineserum albumin) were placed in the upper compartment of each chamber, whereas the lower compartments were filled with 600 µl DMEM containing 10% FBS. After incubating for 24 h at 37°C, the non-invaded cells were removed from the upper surface of the filter with a cotton swab, while the invaded cells on the lower surface of the filter were fixed with 600 µl 70% ethanol at room temperature for 10 min and stained with 600 µl 0.2% crystal violet at room temperature for 10 min. Then images were obtained of the stained cells, which were counted under high-power (magnification, ×100) with an Olympus IX73 routine light microscope (Olympus Corporation). The migration assay was performed in a similar manner to the invasion assay, except for the use of Matrigel.
Flow cytometric analysis with Annexin V/propidium iodide (PI) staining
Upon transfection with miR-593 mimic or inhibitor, the apoptosis of A549 and NCI-H1299 cells was determined by flow cytometry using fluorescence-activated cell sorting (FACS) (BD Biosciences). Apoptotic cells were identified with an Annexin V-fluorescein isothiocyanate (FITC)/PI apoptosis detection kit according to the manufacturer's protocol (cat. no. V13242; BD Biosciences). The ratios of PI−/Annexin V+, representing the apoptosis percentage, were calculated with CellQuest software version 5.2 (BD Biosciences).
Total RNA from cells incubated with NC, miR-593, or miR-593 inhibitor was extracted after 24 h using TRIzol (Ambion; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Fresh tissues, including normal adjacent tissues and cancer tissues, were collected by surgeons following the standard operating procedure and were sent to the Department of Pathology, the Fourth Affiliated Hospital of China Medical University within 30 min. Liquid nitrogen was used to flash freeze the specimens and the frozen specimens were stored in −80°C. The frozen tissues were thawed on ice and total RNA was extracted using Qiagen RNeasy Mini kit (cat no. 74106; Qiagen GmbH) according to the manufacturer's protocol. The quality of the total RNA was evaluated with a NanoDrop® ND-1000 spectrophotometer. Total TNA (1 µg) was reverse-transcribed into complementary DNA in a total volume of 20 µl using a reverse transcription system (Promega Corporation). RT-qPCR was performed using the Mx3000P Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and SYBR® Premix Ex Taq™ (Takara Bio, Inc.) as a DNA-specific fluorescent dye. The reaction protocol involved pre-heating for 20 sec at 95°C, followed by 40 cycles at 95°C for 10 sec and 60°C for 30 sec. Primer sequences for the detection of mRNA expression were synthesized as indicated in Table II. Gene expression levels were calculated relative to the expression of the housekeeping gene β-actin or the small nuclear RNA U6 using the ΔΔCq method (15). Three independent experiments were performed to analyze the relative gene expression and each sample was analyzed in triplicate.
Table II.
Primer sequences for detection of mRNA expression.
To determine the expression of proteins, whole cell lysates were prepared from 1×106 cells in lysis buffer [20 mM Tris pH 7.4, 250 mM sodium chloride, 0.1% (v/v) Triton X-100, 2 mM EDTA, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 0.5 mM phenylmethylsulfonyl fluoride, 4 mM sodium orthovanadate and 1 mM dithiothreitol], and 60 µg protein was resolved on 10% SDS-polyacrylamide gels. Upon electrophoresis, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes (EMD Millipore). The membrane was blocked with 5% skim milk in TBS-Tween 20 (20 mM Tris pH 7.6, 137 mM NaCl and 0.05% Tween-20) for 1 h at room temperature, and the proteins were probed with specific antibodies against SLUG (cat. no. sc-166476; 1:1,000), phosphorylated (p)-Ser473 Akt1 (cat. no. sc-52940; 1:1,000), Akt1 (cat. no. sc-377457; 1:1,000), cyclin D1 (cat. no. sc-450; 1:1,000), cyclin-dependent kinase 4 (CDK4) (cat. no. sc-23896; 1:1,000), cyclin-dependent kinase 6 (CDK6) (cat. no. sc-7961; 1:1,000), apoptosis regulator Bcl-2 (Bcl-2) (cat. no. sc-23960; 1:500), apoptosis regulator BAX (Bax) (cat. no. sc-70407; 1:500), E-cadherin (cat. no. sc-71009; 1:1,000), vimentin (cat. no. sc-6260; 1:1,000) and β-actin (sc-47778; 1:2,000) for 12 h at 4°C. Then membranes were incubated with the anti-mouse IgG secondary antibody sc-516102 (1:2,500) for 2 h at room temperature. All the antibodies were purchased from Santa Cruz Biotechnology, Inc. To assure equal loading, gels were probed with antibodies against β-actin. All PVDF membranes were evaluated by enhanced chemiluminescence (Pierce; Thermo Fisher Scientific, Inc.). The qualification of western blotting was performed with Image Lab version 6.0 software (Bio-Rad Laboratories, Inc.).
Statistical analysis
Statistical analysis was carried out with GraphPad Prism 7 software (GraphPad Software, Inc.). Data from at ≥3 independent experiments were presented as the mean ± standard deviation. Comparisons of means of two paired groups were performed using paired Student's t-test. One-way analysis of variance (ANOVA) for multiple groups and Dunnett's multiple comparisons test were applied to compare the mean of each group with the mean of the control group. Two-way analysis of variance and Sidak's multiple comparison post hoc test were used to analyze the different means of each group.To assess the correlation between miR-593 and SLUG, Pearson's correlation analysis was performed. The association of sex, age, smoking status, pathological characteristics and miR-593 expression with NSCLC progression was assessed using a χ2 and Fisher's exact tests. Survival curves were calculated with the Kaplan-Meier method. All probability values were two tailed and P<0.05 was considered to indicate a statistically significant difference.
Results
miR-593 expression is inversely correlated with SLUG in lung cancer tissues and predicts poor clinical outcome in lung cancer
Using the miRDB database (16,17), the present study identified miR-593 as a candidate miRNA targeting SLUG (http://mirdb.org/cgi-bin/search.cgi?searchType=miRNA&searchBox=hsa-miR-593-3p&full=1). To evaluate the expression of miR-593 in NSCLC, miR-593 and SLUG mRNA were detected in paired primary tissues and adjacent tissues of 80 patients with NSCLC (Fig. 1A and B). The expression of miR-593 was decreased in cancer tissues (0.518±0.079) compared with adjacent tissues (0.783±0.072). The expression of SLUG was increased in cancer tissues (0.852±0.038) compared with adjacent tissues (0.518±0.048). To further explore the role of miR-593 in NSCLC, the correlation between the expression of miR-593 and SLUG was analyzed using Pearson's correlation test. As revealed in Fig. 1C, the expression of miR-593 and SLUG exhibited a significant inverse correlation (P<0.0001; R2=0.3752).
Figure 1.
Relative miR-593 expression is inversely correlated with SLUG expression and predicts better clinical outcome of lung cancer. Relative expression of (A) miR-593 and (B) SLUG in paired adjacent tissues and lung cancer tissues (n=80). miR-593 and SLUG expression was examined by reverse transcription-quantitative polymerase chain reaction and normalized to U6 or β-actin expression, respectively. The results are represented as the mean ± standard deviation of three independent experiments. *P<0.05, **P<0.01. (C) Pearson's correlation was used to analyze the correlation between the relative expression of miR-593 and SLUG in 80 lung cancer cases. (D) Kaplan-Meier survival analysis indicated that patients with high miR-593 expression (n=29) had better overall survival compared with those with low miR-593 expression (n=51). miR, microRNA; SLUG, zinc finger protein SNAI2.
To better understand the association between miR-593 expression and NSCLC progression, the 80 cases were divided into two groups based on miR-593 expression levels, namely a high miR-593 expression group and a low miR-593 expression group. To select the best cut-offs for grouping the patients most significantly, all relative miR-593 expression values from the 20 to 80th percentiles were used to group the patients, significant differences in the survival outcomes of the groups were examined and the value yielding the lowest log-rank P-value was selected. There were 29 out of 80 cases (36%) with high miR-593 expression and 51 out of 80 cases (64%) with low expression. As revealed in Fig. 1D, the median overall survival was 58 months [95% confidence interval (CI), 56.7–59.1] for cases with high miR-593 expression and 36 months (95% CI, 35.3–38.7) for those with low miR-593 expression (P=0.0111). The association between miR-593 expression and clinicopathological characteristics was evaluated to estimate the clinical significance of miR-593 (Table I). The results revealed that miR-593 expression in NSCLC tissues was significantly associated with tumor size (P=0.031), lymph node metastasis (P=0.009), distant metastasis (P=0.028) and advanced pathological tumor-node-metastasis (TNM) stage (P=0.039), whereas there was no significant association with sex (P=0.170), age (P=0.229), cigarette smoking status (P=0.683) or depth of invasion (P=0.628). Collectively, these results revealed that low expression of miR-593 was negatively correlated with NSCLC progression.
miR-593 targets the 3′-UTR of SLUG and suppresses the promoter activity of SLUG
Since previous studies indicated that miR-593 could interact with the 3′-UTR of targeted genes to suppress gene expression (12,13), it was hypothesized that miR-593 regulates SLUG expression mRNA levels post-transcriptionally. Using the miRDB database (17,18), the present study predicted a putative binding site located in the 3′-UTR of SLUG (positions 1,060-1,066). The schematic diagram of potential binding sites, which was located at position 1,060 of the SLUG 3′-UTR, is presented in Fig. 2A. Luciferase constructs containing wt or mut SLUG 3′-UTR were introduced along with NC RNA, miR-593 mimic or miR-593 inhibitor in A549 cells. The results revealed in Fig. 2B indicated that the relative luciferase activity of wt SLUG 3′-UTR was significantly reduced, while that of mut SLUG 3′-UTR was slightly altered in cells treated with miR-593 mimic compared with NC RNA. The relative activity of wt SLUG 3′-UTR was partially recovered in cells treated with miR-593 inhibitor.
Figure 2.
miR-593 suppresses SLUG expression and potentially binds to SLUG 3′-UTR. (A) Schematic illustration of the SLUG 3′-UTR with putative binding sites for miR-593. (B) Luciferase reporter assays demonstrated that overexpression of miR-593 mimic reduced the luciferase activity of SLUG 3′-UTR in A549 cells, compared with cells treated with NC RNA or inhibitor. The assays were performed in triplicate and the results correspond to the mean of 3 independent experiments. Column, mean; bars, ± standard deviation. *P<0.05, ***P<0.001. miR, microRNA; SLUG, zinc finger protein SNAI2; UTR, untranslated region; NS, no significance; SLUG-wt, wild-type SLUG 3′-UTR; SLUG-mut, mutant SLUG 3′-UTR; NC, negative control; mimic, miR-593 mimic; inhibitor, miR-593 inhibitor.
miR-593 suppresses the proliferation of lung cancer cells by inactivating the SLUG/Akt/cyclin D1/CDK4/CDK6 signaling pathways
To explore the potential function of miR-593 on NSCLC proliferation, NC RNA, miR-593 mimic or miR-593 inhibitor was introduced into the NSCLC cell lines A549, NCI-H1299, NCI-H358 and NCI-H1993. The expression of miR-593 was determined using RT-qPCR. The results revealed that miR-593 expression levels in A549 and NCI-H1993 cells were higher than those in NCI-H1299 and NCI-H358 cells (Fig. 3A). The transfection efficiency of miR-593 mimic and miR-593 inhibitor was confirmed by RT-qPCR. As revealed in Fig. 3B, the introduction of a miR593-mimic promoted miR-593 expression compared with NC RNA. Conversely, transfection with a miR-593 inhibitor significantly suppressed miR-593 expression. The efficiency of miR-593 on NSCLC cell proliferation was evaluated with MTT assays. The results revealed that miR-593 mimic inhibited NSCLC cell proliferation. In contrast to miR-593 mimic, miR-593 inhibitor markedly promoted cell proliferation (Fig. 3C). Furthermore, the mechanisms underlying miR-593-mediated NSCLC cell proliferation were examined with western blot and RT-qPCR assays. Since Akt and cyclin D1 are key regulators in cell proliferation (19–21), western blotting was performed to detect changes in Akt, cyclin D1, CDK4 and CDK6. The results revealed in Fig. 3D demonstrate that miR-593 mimic suppressed SLUG expression, leading to dephosphorylation of Akt on Ser473 and decrease of cyclin D1, CDK4 and CDK6 expression levels. In addition, consistent with the results of western blot analysis, RT-qPCR demonstrated that the mRNA levels of SLUG, cyclin D1, CDK4 and CDK6 were significantly decreased in cells treated with miR-593 mimic (Fig. 3F).
Figure 3.
miR-593 inhibits the proliferation of lung cancer cells by suppressing the SLUG/Akt/cyclin D1 signaling pathways. (A) miR-593 expression in the non-small cell lung cancer cell lines A549, NCI-H1299, NCI-H358 and NCI-H1993. (B) miR-593 mimic or miR-593 inhibitor transfection efficiency of the indicated cell lines. (C) A549, NCI-H1299, NCI-H358 and NCI-H1993 cells were cultured with miR-593 mimic or miR-593 inhibitor for the indicated time-points in 96-well plates. An MTT assay was performed, and the results represent the mean ± SD of 3 independent experiments. (D) A549 cells were transfected with NC alone or miR-593 mimic for 24 h, and the expression levels of the indicated proteins were detected by western blotting. (E) A549 cells were transfected with NC alone or miR-593 inhibitor for 24 h, and the expression levels of the indicated proteins were detected by western blotting. (F) A549 cells were transfected with NC alone or miR-593 mimic for 24 h, and the mRNA levels of SLUG, cyclin D1 and CDK4/6 were analyzed by RT-qPCR. (G) A549 cells were transfected with NC alone or miR-593 inhibitor for 24 h, and the indicated mRNA levels were analyzed by RT-qPCR. Results represented the mean ± SD of 3 independent experiments. *P<0.05, **P<0.01, ***P<0.001. SLUG, zinc finger protein SNAI2; Akt, protein kinase B; CDK4, cyclin-dependent kinase 4; CDK6, cyclin-dependent kinase 6; Bcl-2, apoptosis regulator Bcl-2; Bax, apoptosis regulator BAX; NC, negative control; mimic, miR-593 mimic; inhibitor, miR-593 inhibitor; miR, microRNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; mRNA, messenger RNA; SD, standard deviation; H1299, NCI-1299; H358, NCI-H358; H1993, NCI-H1993.
Conversely, the miR-593 inhibitor enhanced the expression of SLUG, p-Ser473 Akt, cyclin D1, CDK4 and CDK6 (Fig. 3E). As anticipated, the expression of cyclin D1 and CDK4/6 was significantly upregulated at the mRNA level in A549 cells with miR-593 inhibitor (Fig. 3G). Collectively, these results indicated that miR-593 inhibited cell proliferation through downregulation of the SLUG/Akt/cyclin D1 axis.
miR-593 induces apoptosis in NSCLC cells via activation of the SLUG/Akt/Bcl2/Bax signaling pathways
Since SLUG expression has been revealed to contribute to the survival of cancer cells (2,22), the present study hypothesized whether miR-593 interferes with cell survival by suppression of SLUG expression. Flow cytometric analysis with Annexin V/PI staining was carried out to calculate the apoptosis rate induced by miR-593 (Fig. 4A). miR-593 mimic increased the apoptosis rate of A549 cells (4.8%), while miR-593 inhibitor decreased it (2.1%) compared with NC RNA (3.2%). The transfection efficiency was confirmed by RT-qPCR (Fig. 4B). The results revealed that the relative expression of miR-593 was significantly increased in A549 cells transfected with miR-593 mimic, whereas the relative expression of miR-593 was markedly reduced in cells upon treatment with miR-593 inhibitor. Similarly, the apoptosis rate of NCI-H1299 cells following treatment with miR-593 mimic increased to 7.1%, while that of cells transfected with miR-593 inhibitor decreased to 2.0% in comparison with untreated NCI-H1299 cells (3.9%) (Fig. 4C). The transfection efficiency of miR-593 mimic or inhibitor was confirmed by RT-qPCR (Fig. 4D). Additionally, the expression of the apoptosis regulators Bcl-2 and Bax was examined by western blotting. The results revealed in Fig. 4E indicated that the expression of p-Ser473 Akt and Bcl-2 were markedly decreased in parallel with the inhibition of SLUG, whereas Bax expression was increased in A549 cells transfected with the miR-593 mimic. Contrary to the effects of the miR-593 mimic, miR-593 inhibitor promoted SLUG expression and Akt phosphorylation on Ser473 with little change in total Akt levels. The expression levels of the antiapoptotic protein Bcl-2 were increased, while those of the pro-apoptotic protein Bax were decreased (Fig. 4F), compared with the NC. To further verify these results, the relative mRNA levels of SLUG, BCL2 and BAX were examined by RT-qPCR. In line with the data presented in Fig. 4E, the mRNA levels of SLUG and BCL2 were significantly decreased, while those of BAX were significantly increased upon overexpression of miR-593 (Fig. 4G). Conversely, BAX expression was downregulated, while SLUG and BCL2 expression was significantly upregulated with the reduction in the expression of miR-593 (Fig. 4H).
Figure 4.
miR-593 induces apoptosis in lung cancer cells by activating the SLUG/Akt/Bcl-2/Bax signaling pathway. (A) A549 and (B) NCI-H1299 cells were transfected with NC, miR-593 mimic or miR-593 inhibitor for 24 h. Then, flow cytometric analysis with Annexin V/PI staining was applied and examined with the BD FACSCalibur™ platform. The relative miR-593 expression in (C) A549 and (D) NCI-H1299 cells was confirmed by RT-qPCR. (E) A549 cells were transfected with NC alone or miR-593 mimic for 24 h, and the expression levels of the indicated proteins were detected by western blotting. (F) A549 cells were transfected with NC alone or miR-593 inhibitor for 24 h, and the expression levels of the indicated proteins were detected by western blotting. (G) A549 cells were transfected with NC alone or miR-593 mimic for 24 h, and the relative mRNA expression of miR-593, SLUG, BCL2 and BAX was determined by RT-qPCR. (H) A549 cells were transfected with NC alone or miR-593 inhibitor for 24 h, and the relative mRNA expression of miR-593, SLUG, BCL2 and BAX was determined by RT-qPCR assays. The results are represented as the mean ± standard deviation of 3 independent experiments. **P<0.01, ***P<0.001. SLUG, zinc finger protein SNAI2; Akt, protein kinase B; Bcl-2, apoptosis regulator Bcl-2; Bax, apoptosis regulator BAX; NC, negative control; mimic, miR-593 mimic; inhibitor, miR-593 inhibitor; miR, microRNA; PI, propidium iodide; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; mRNA, messenger RNA; H1299, NCI-1299.
In summary, miR-593 promoted apoptosis though the suppression of the SLUG/Akt/Bcl-2/Bax signaling pathway.
miR-593 suppresses cellular migration and invasion by impairing the SLUG-mediated EMT
To investigate the potential function of miR-593 on cancer cell motility, Transwell migration and invasion assays were applied to A549 and NCI-H1299 cells. The results revealed that the miR-593 mimic inhibited A549 cell migration (Fig. 5A, top panel) and invasion (Fig. 5A, bottom panel), whereas the miR-593 inhibitor promoted the migration and invasion of A549 cells in comparison with the NC group. The percentage of migrated or invaded A549 cells normalized to those in the NC group are presented in the histogram of Fig. 5B. The transfection efficiency was demonstrated by RT-qPCR assays (Fig. 5C). miR-593 had similar effects on the migration and invasion of NCI-H1299 cells. The results indicated that NCI-H1299 cell migration (Fig. 5D, top panel) and invasion (Fig. 5D bottom panel) were impaired by the miR-593 mimic, while they were enhanced by the miR-593 inhibitor. The percentage of migrated or invaded NCI-H1299 cells is presented in Fig. 5E. The transfection efficiency was demonstrated with RT-qPCR assays (Fig. 5F).
Figure 5.
miR-593 suppresses cellular migration and invasion via downregulation of SLUG expression. (A) Migration assays (top panel) and invasion assays (bottom panel) of A549 cells. Cells were treated with NC, miR-593 mimic or miR-593 inhibitor for 24 h. Migration assay (without Matrigel) and Matrigel invasion assay were performed to evaluate the changes in cellular motility. Representative photomicrographs of Transwell results were captured under an ×100 magnification. (B) Percentage of migrated or invaded A549 cells. Cells in 5 visual fields at ×400 magnification were counted in each group, and the percentage was calculated in comparison with the NC group. (C) Relative miR-593 expression was determined by RT-qPCR. (D) Migration assays (top panel) and invasion assays (bottom panel) of NCI-H1299 cells. Cells were treated with NC, miR-593 mimic or miR-593 inhibitor for 24 h. Migration assay (without Matrigel) and Matrigel invasion assay was performed to investigate the changes in cellular motility. Representative photomicrographs of the results were obtained under an ×100 magnification. (E) Percentage of migrated or invaded NCI-H1299 cells. Cells in 5 visual fields at ×400 magnification were counted in each group, and the percentage was calculated in comparison with the NC group. (F) Relative miR-593 expression was evaluated by RT-qPCR. (G) SLUG, E-cadherin and vimentin expression in A549 cells treated with NC or miR-593 mimic, were detected by western blotting. (H) The levels of the indicated proteins were examined in cells treated with NC or miR-593 inhibitor. (I) A549 cells were transfected with NC alone or miR-593 mimic for 24 h, and the relative mRNA expression of miR-593, SLUG, E-cadherin and vimentin was then determined by RT-qPCR. (J) Cells were transfected with NC alone or miR-593 inhibitor for 24 h, and the relative mRNA expression of miR-593, SLUG, E-cadherin and vimentin was then determined by RT-qPCR. (K) A549 cells were treated with siRNA NC, SLUG siRNA or a combination of SLUG siRNA and miR-593 inhibitor for 24 h. Western blotting was carried out upon treatment to verify the changes in the expression levels of the indicated proteins. The results represent the mean ± standard deviation of 3 independent experiments. **P<0.01, ***P<0.001. miRNA, microRNA; SLUG, zinc finger protein SNAI2; NC, negative control; mimic, miR-593 mimic; inh, miR-593 inhibitor; Akt, protein kinase B; CDK4, cyclin-dependent kinase 4; CDK6, cyclin-dependent kinase 6; Bcl-2, apoptosis regulator Bcl-2; Bax, apoptosis regulator BAX; Ecad, E-cadherin; Vim, vimentin; si-NC, siRNA negative control; si-SLUG, SLUG siRNA; siRNA, small interfering RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; mRNA, messenger RNA; H1299, NCI-1299.
Since EMT is considered to serve a pivotal role in the process of cancer motility, the present study attempted to ascertain whether miR-593 was involved in the regulation of SLUG-mediated EMT. The results revealed that the expression of the epithelial marker protein E-cadherin was increased in cells expressing miR-593 mimic in comparison with cells expressing NC RNA, whereas the expression of the mesenchymal marker protein vimentin was markedly decreased (Fig. 5G). In line with the western blot analysis, the miR-593 mimic reduced the mRNA level of vimentin while promoting that of E-cadherin, along with suppression of SLUG (Fig. 5I). Fig. 5H revealed that the miR-593 inhibitor significantly enhanced SLUG expression and vimentin while it decreased E-cadherin expression. Data from RT-qPCR assays were in agreement with the results of western blot analysis (Fig. 5J). Furthermore, a rescue experiment, where cells were treated with a combination of SLUG siRNA and miR-593 inhibitor, was performed to verify the effect of miR-593 on SLUG/Akt signaling. As revealed in Fig. 5K, the phosphorylation of Akt, and the expression levels of cell cycle proteins cyclin D1, CDK4, CDK6, proapoptotic protein Bcl-2 and mesenchymal marker protein vimentin were decreased following the inhibition of SLUG expression by si-SLUG, whereas the expression of the antiapoptotic protein Bax and the epithelial marker protein E-cadherin was increased. Actin served as a loading control. In addition, the combination of si-SLUG and miR-593 inhibitor did not reverse such changes, suggesting that miR-593 inactivated SLUG/Akt-mediated signaling pathways by targeting SLUG. Briefly, the present findings indicated that miR-593 inhibited SLUG expression and blocked EMT, contributing to the suppression of cell migration and invasion.
Discussion
SLUG has been revealed to be associated with multiple biological functions, including cell growth, the cell cycle, cell movement, chemoresistance and maintenance of cell stem features (22–24). SLUG is overexpressed in various cancer types, including lung, gastric, breast and prostate cancer as well as hepatocellular carcinoma (2). High expression of SLUG has been revealed to be associated with the progression of numerous cancer types and to predict poor clinical outcomes (6,25,26). In NSCLC cases, increased expression of SLUG was correlated with increased rate of cancer recurrence and shorter survival (3). Growing evidence suggests that SLUGserves a critical role in NSCLC development; however, the role of miRNAs in the regulation of SLUG remains largely unknown.miRNAs are involved in RNA interference to regulate gene expression post-transcriptionally, contributing to different physiological and pathological functions, including tumor formation and progression (27). The present study identified miR-593 as a candidate miRNA targeting SLUG using the miRDB database. Previous research indicated that miR-593 mediated curcumin-induced radiosensitization in nasopharyngeal carcinoma cells (28). In tongue squamous cell carcinoma cells, miR-593 regulated cisplatin sensitivity (12). Ectopic expression of miR-593 in esophageal cancer cells resulted in suppression of cell proliferation (13). The present study demonstrated, for the first time to the best of our knowledge, that miR-593 inhibited SLUG expression and was associated with NSCLC progression. Transduction of a miR-593 mimic suppressed SLUG protein and mRNA expression, as well as luciferase activity of transfected constructs containing the target SLUG 3′-UTR. This observation indicated that miR-593 directly binds to the SLUG 3′-UTR and decreases SLUG mRNA expression.In clinicopathological analysis, an inverse correlation was established between miR-593 and SLUG expression in NSCLC. Low expression of miR-593 was associated with aggressive NSCLC behavior (lymph node metastasis, distant metastasis and TNM stage). Notably, reduced expression of miR-593 predicted poor outcome of patients with NSCLC (Fig. 1D). These results are in agreement with the apparent association between increased SLUG expression and NSCLC progression (29).Since SLUG promotes the phosphorylation of Akt via the insulin-like growth factor-I receptor/proto-oncogene tyrosine-protein kinase Src (Src) axis (30), and Akt regulates numerous processes such as cell proliferation, cell survival, cell growth and invasion, the present study performed loss-of-function and gain-of-function experiments to analyze cell proliferation, apoptosis, migration and invasion in NSCLC cells. The present study aimed to determine whether SLUG suppression by miR-593 inactivated Akt and regulated Akt-mediated functions in NSCLC cells. As revealed in Fig. 3, the miR-593 mimic downregulated cell proliferation, while the miR-593 inhibitor upregulated cell proliferation through the SLUG/Akt/cyclin D1 signaling pathways. Consistent with previously research reporting that Akt regulated cell apoptosis by targeting Bcl2/Bax (31), the present study demonstrated that miR-593 induced apoptosis in NSCLC cells. The results in Fig. 4 indicated that the miR-593 mimic induced apoptosis, whereas the miR-593 inhibitor did not. In addition to the effect on cell proliferation and apoptosis, the inhibitory mechanisms of miR-593 on the migration and invasion of NSCLC cells were also demonstrated. One of the key events in cancer migration and invasion is the degradation of E-cadherin, which is accompanied by an increase in vimentin (2,23). The present results revealed that miR-593 decreased the migration and invasion of NSCLC cells (Fig. 4) in parallel with downregulation of E-cadherin and upregulation of vimentin.Although the mechanisms underlying the inhibition of NSCLC cells by miR-593 were demonstrated in the present study, further studies are required to verify the association between miR-593 expression and clinical outcomes of advanced NSCLC. For example, one of the well-known risk factors of lung cancer is cigarette smoking; however, smoking was not correlated with miR-593 expression in the present analysis. One of the possible reasons is passive smoking, which triggers lung cancer among non-smoking patients each year. Another probable explanation is that smoking may be associated with miR-593 expression in a stage-specific manner. Additional cases are necessary to clarify this question. Genetic heterogeneity leads to variable miRNA expression patterns in NSCLC. The potential roles of different mutants in regulating miR-593 is worth exploring further with integrated analysis of genomic databases, such as the Catalogue of Somatic Mutations in Cancer. In addition, xenograft models are critical for functional studies of miR-593 in the future.In summary, the present study demonstrated that miR-593 targets the 3′-UTR of SLUG, causing suppression of SLUG expression. The expression of miR-593 was correlated with the progression of NSCLC, and low expression of miR-593 indicated poor outcome of patients with NSCLC. Furthermore, SLUG suppression by miR-593 inactivated Akt and inhibited cell proliferation by the Akt/cyclin D1/CDK4/6 signaling pathway. Inactivation of Akt induced apoptosis through the Akt/Bcl-2/Bax signaling pathway and impeded the motility of NSCLC cells by suppression of E-cadherin expression. Despite the absence of confirmation of these findings by in vivo experiments, the present observations suggest that miR-593 is a promising molecular target for the prognosis of NSCLC.
Authors: Akin Atmaca; Ralph W Wirtz; Dominique Werner; Kristina Steinmetz; Silke Claas; Wolfgang M Brueckl; Elke Jäger; Salah-Eddin Al-Batran Journal: BMC Cancer Date: 2015-04-17 Impact factor: 4.430
Authors: Saira R Ali; Karen J Humphreys; Kaylene J Simpson; Ross A McKinnon; Robyn Meech; Michael Z Michael Journal: Mol Ther Nucleic Acids Date: 2022-08-29 Impact factor: 10.183