Literature DB >> 31638187

Redd1 protects against post‑infarction cardiac dysfunction by targeting apoptosis and autophagy.

Pianpian Huang1, Jun Fu2, Long Chen3, Chenhui Ju3, Kefei Wu1, Hongxia Liu1, Yun Liu1, Benming Qi4, Benling Qi1, Lihua Liu1.   

Abstract

Post‑infarction remodeling is accompanied and influenced by perturbations in the mammalian target of rapamycin (mTOR) signaling. Regulated in development and DNA damage response‑1 (Redd1) has been reported to be involved in DNA repair and modulation of mTOR activity. However, little is known about the role of Redd1 in the heart. In the present study the potential contribution of Redd1 overexpression to the chronic phase of heart failure after myocardial infarction (MI) was explored and the mechanisms underlying Redd1 actions were determined. Redd1 was downregulated in the mouse heart subjected to MI surgery. To determine the role of Redd1 in the process of MI, adeno‑associated virus 9 mediated overexpression of Redd1 was used to enhance Redd1 content in cardiomyocytes. Redd1 overexpression improved left ventricular dysfunction and reduced the expansion index. Additionally, Redd1 overexpression resulted in suppressed myocardial apoptosis and improved autophagy. Furthermore, the studies revealed that Redd1 overexpression could inhibit the phosphorylation of mTOR and its downstream effectors P70/S6 kinase and 4EBP1. In conclusion, this study demonstrated that Redd1 overexpression protects against the development and persistence of heart failure post MI by reducing apoptosis and enhancing autophagy via the mTOR signaling pathway. The present study clearly demonstrated that Redd1 is a therapeutic target in the development of heart failure after MI.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31638187      PMCID: PMC6844599          DOI: 10.3892/ijmm.2019.4366

Source DB:  PubMed          Journal:  Int J Mol Med        ISSN: 1107-3756            Impact factor:   4.101


Introduction

Myocardial infarction (MI) constitutes one of the most serious cardiac events with high morbidity and mortality worldwide (1,2). Myocardial remodeling occurs after MI as a compensatory mechanism to decrease wall stress which may lead to inevitable cardiac dilatation, followed by heart failure (3). At present, pharmacological intervention remains the most effective treatment for preventing post-infarction cardiac remodeling and dysfunction (4). The one year mortality rate of patients hospitalized for heart failure after MI was as high as 43.2% (5). Therefore, it has been crucial to exploit effective intervention targets for attenuating cardiac remodeling and dysfunction post MI, thereby preventing the development of heart failure in post-infarction patients (6). Apoptosis and autophagy are reported to participate in physiological processes that occur constitutively in the myocardium (7,8). The roles of apoptosis and autophagy in ischemic myocardial injury have been extensively demonstrated in ischemic induced myocardial injury. Increasing evidence suggests that apoptosis and autophagy disruption results in the development of severe left ventricular dysfunction (9,10). As a result, developing a strategy aimed at regulating apoptosis and autophagy is necessary to protect against post-MI cardiac dysfunction. Therefore, the accurate molecular mechanisms that regulate apoptotic and autophagic responses are pivotal for preventing the development of heart failure post MI. The mammalian target of rapamycin (mTOR) is a highly conserved serine/threonine kinase, belonging to the phosphoinositide kinase-related kinase family (11). mTOR has been reported to activated via the protein kinase B/phosphoinositide 3 kinase pathway (12). This signaling mechanism is centrally involved in physiological hypertrophy but also takes part in pathological remodeling of the heart (12). It is well established that mTOR plays an important role in regulating cellular physiology, metabolism and stress responses (11). Previous studies have confirmed that mTOR can concurrently modulate apoptosis and autophagy related pathogenesis in numerous heart diseases (13-15). Furthermore, inhibiting mTOR induced apoptosis and autophagy may exert a protective influence against MI injury (16,17). The exact mechanisms explaining how this signaling pathway regulates apoptosis and autophagy during MI remain to be clarified. Regulated in development and DNA damage response-1 (Redd1), located on chromosome 10 (10q22.1), is a 232 amino acids protein which is transcriptionally induced by DNA damage in various types of cells (18,19). Redd1 plays a vital role in biological, physiological functions and cellular functions, such as cell growth, inflammation and autophagy (20-22). Despite its relationship with mTOR and extensive research in multiple diseases, such as neurodegenerative disorders (23) and cancer (24), little is known about the role of Redd1 in the heart. Few previous studies have evaluated the hypothesis that Redd1 may have relevance to cardiac physiopathology. Studies have shown that Redd1 inhibition protected cardiomyocytes from ischemia-reperfusion (I/R) injury (25) or methamphetamine-induced myocardial damage (26). Paradoxically, Liu et al (27) demonstrated that Redd1 attenuated cardiac hypertrophy induced by phenylephrine via enhancing autophagy. These observations imply that Redd1 is possibly associated with cardiac dysfunction. However, there was no study on whether Redd1 could ameliorate the prognosis of cardiac dysfunction post MI. At present, the role of Redd1 in the heart remains unknown. Nonetheless, extrapolating experimental data from other cell types, Redd1 appears to play a pivotal role in inhibiting mTOR activation (28-30). In this context, the present study aimed to explore the potential contribution of Redd1 during the development of heart failure after MI. The study presented here demonstrates the critical role of Redd1 overexpression in cardiomyocytes during the chronic phases of MI. A single intravenous injection of an adeno-associated virus 9 (AAV9) vector expressing Redd1 reduced left ventricular dysfunction. In addition, Redd1 improved cardiac function after myocardial infarction through apoptosis inhibition and autophagy enhancement mediated by mTOR inactivation. The results of the present study suggest the critical importance of Redd1 in the development of heart failure post MI.

Materials and methods

Animals

A total of 30 C57BL/6 male mice weighing 14-16 g (4-5 weeks) were purchased from the Beijing HFK Bioscience Co., Ltd. Mice were kept in cages at 22±2°C with 40±5% humidity under a 12 h light/dark cycle in the Tongji Medical School Experimental Animal Center, and fed a chow diet and water. Animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the National Institute of Health and were approved by the Institutional Animal Care and Use Committee at Tongji Medical College, Huazhong University of Science and Technology.

Injection of AAV9 vectors

The AAV9 vectors carrying enhanced green fluorescent protein (AAV9-GFP) or mouse Redd1 (AAV9-Redd1) were purchased from Weizhen Biotechnology Company. The sequence of the Redd1 vector was consistent with the coding sequence of mouse Redd1, shown as follows, ATGCCTAGCCTCTGGGATCGTTTCTCGTCCTCCTCTTCCTCTTCGTCCTCGTCTCGAACTCCGGCCGCTGATCGGCCGCCGCGCTCCGCCTGGGGGTCTGCAGCCAGAGAAGAGGGCCTTGACCGCTGCGCGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCGGGCCGGAGGAAGACTCCTCATACCTGGATGGGGTGTCCCTGCCCGACTTTGAGCTGCTCAGTGACCCCGAGGATGAGCACCTGTGTGCCAACCTGATGCAGCTGCTGCAGGAGAGCCTGTCCCAGGCGCGATTGGGCTCGCGGCGCCCTGCGCGTTTGCTCATGCCGAGCCAGCTGGTGAGCCAGGTGGGCAAGGAACTCCTGCGCCTGGCATACAGTGAGCCGTGCGGCCTGCGGGGGGCACTGCTGGACGTGTGTGTGGAGCAAGGCAAGAGCTGCCATAGCGTGGCTCAGCTGGCCCTCGACCCCAGCCTGGTGCCCACCTTTCAGTTGACCCTGGTGCTGCGTCTGGACTCTCGCCTCTGGCCCAAGATCCAGGGGCTGTTAAGTTCTGCCAACTCTTCCTTGGTCCCTGGTTACAGCCAGTCCCTGACGCTAAGTACCGGCTTCAGAGTCATCAAGAAGAAACTCTACAGCTCCGAGCAGCTGCTCATTGAAGAGTGTTGA. Mice were injected with viral solution (2.8×1011 vector genomes per mouse) via the tail vein 4 weeks before MI surgery (31).

MI surgery and experimental groups

MI was induced by permanent ligation of the left-anterior descending coronary artery (LAD) as previous reported (32). Briefly, mice were anesthetized with 3% pentobarbital sodium (50 mg/kg) by intraperitoneal injection. Mice were mechanically ventilated. A thoracotomy was conducted between the left third and fourth ribs. The thymus was retracted upwards and the auricular appendix was exposed. The LAD was ligated by a 6-0 silk suture. The sham group mice underwent the same process except for ligating the LAD. Mice were randomly divided into four groups: Sham with AAV9-GFP (Sham+GFP; n=6), Sham with AAV9-Redd1 (Sham+Redd1; n=6), MI with AAV9-GFP (MI+GFP; n=8) and MI with AAV9-Redd1 (MI+Redd1; n=8). Mice were treated with AAV9-Redd1 or AAV9-GFP for 4 weeks before MI or sham operation. Mice were sacrificed at 4 weeks post MI or sham surgery.

Echocardiography

A total of 4 weeks following MI, mice were anesthetized with 1.5% isoflurane via inhalation (33). The depth of anesthesia was determined by immobility and assessing the absence of the withdrawal reflex of the right paw. Subsequently, cardiac function was measured by transthoracic echocardiography with a Vevo 2100 high-resolution micro imaging system (VisualSonics, Inc.). The echocardiography images were acquired from the long axes and the short axis. The following parameters were measured in M-mode: Left ventricular end-diastolic diameter (LVEDd) and left ventricular end-systolic diameter (LVESd). The percentage of left ventricular fractional shortening (LVFS, %) and left ventricular ejection fraction (LVEF, %) were automatically calculated. The parameters were acquired and averaged from six cardiac cycles.

Masson's trichrome staining and picrosirius red staining

Heart tissues were fixed with 4% paraformaldehyde for 24 h at room temperature, subsequently paraffin embedded and sectioned into 5 µm thick slices. Masson's trichrome and picrosirius red staining were carried out in accordance with standard procedures (34). The stained sections were used to estimate scar thickness, infarct size and expansion index as previously stated (35,36). Picrosirius red staining was applied to calculate the percentage of collagen content in the border zone of the infarcted heart. The images were acquired at ×200 magnification in the border zone of the infarct area, using a light microscope (Olympus Corporation), and analyzed with Image-Pro Plus software 6.0 (Media Cybernetics, Inc.).

Immunofluorescent assay

Paraffin slides were deparaffinized for immunofluorescent staining. All sections were incubated with primary antibodies for Redd1 (1:50; cat. no. ab106356; Abcam) and LC3B (1:50; cat. no. Arg55799; Arigo Biolaboratories, Corps.) at 4°C overnight. Fluorescein tetramethylrhodamine-conjugated secondary antibody affinipure goat anti-rabbit Immunoglobulin G (H+L; 1:50; cat no. 111-025-144; Jackson ImmunoResearch Europe, Ltd.,) was incubated for 1 h at room temperature. Then, all slides were stained with 300 nM DAPI (D1306, Invitrogen; Thermo Fisher Scientific, Inc.) for 5 min at room temperature. In each sample, three random fields were observed by fluorescence microscopy at ×200 magnification. The relative fluorescence intensity was estimated with ImageJ software (version 1.51, National Institutes of Health).

Terminal deoxynucleotidyl-transferase mediated dUTP nick-end labeling (TUNEL) assay

The cardiac cell apoptosis level in the infarct zone of the heart was determined by TUNEL staining. In accordance with the manufacturer's protocol supplied by the TUNEL detection kit (Roche Diagnostics), the heart sections were treated with TUNEL reagent for 1 h at 37°C. Subsequent to washing with twice PBS, the sections were counterstained with 300 nM DAPI (D1306, Invitrogen; Thermo Fisher Scientific, Inc.) for 5 min at room temperature. In each sample, images of three random fields were captured with a 100X lens by fluorescence microscopy. The percentage of positive apoptotic cells was estimated with ImageJ software.

Tissue separation

The atrial tissue was removed and the left ventricle was cut open. The infarct tissue and the border tissue were separated from the heart for western blotting and PCR analysis. As shown in Fig. 1A, the infarcted area was thin and pale, located within the black solid line. The border zone was a transitional pink area, thinner than normal myocardial tissue, located between the black solid line and the black dotted line (37).
Figure 1

Redd1 is downregulated in the heart during the MI process. (A) Representative images of infarct and border area. Upper: Image in front of the heart; Down: Anatomical left ventricle. The black solid line is the boundary of the infarct area; the black dotted line indicates the boundary of the border area. (B) mRNA levels of Redd1 in the heart of sham-operation mice or in infarct region of MI mice at different time points (1 week and 4 weeks) after MI surgery (n=6-8). (C) mRNA levels of Redd1 in the heart of sham-operation mice or in different regions (border area and infarct area) at 4 weeks post MI surgery (n=6-8). (D and E) Redd1 protein expression in the heart of sham-operation mice or in the infarct region of MI mice at different time points (1 and 4 weeks) after MI surgery (n=6-8). (F and G) The protein levels of Redd1 in the heart of sham-operation mice or in different regions (border area and infarct area) at 4 weeks post MI surgery (n=6-8). Data presented as mean ± standard error of the mean. *P<0.05, **P<0.01 and ***P<0.001 vs. the sham group. Redd1, regulated in development and DNA damage response-1; Ctrl, control group; MI, myocardial infarction; Inf, infarction region; Ninf, non-infarction region.

Western blotting

The myocardial total protein was extracted using with RIPA lysis buffer (Beyotime Institute of Biotechnology) at 4°C for 30 min, then quantified with a bicin-choninic acid kit (Beyotime Institute of Biotechnology). Equal amounts of denatured protein samples (100 µg) were separated by 12% SDS-PAGE and were transferred to nitrocellulose membranes. The nitrocellulose membranes were blocked in 5% milk diluted with TBS/0.1% Tween-20 (TBST) for 2 h at room temperature, following by primary antibody incubation overnight at 4°C. The primary antibodies were as follows: Anti-β tubulin (1:1,000; cat. no. 66240-1-Ig, ProteinTech Group, Inc.); anti-Redd1 (1:1,000; cat. no. ab106356; Abcam); anti-Bcl2 (1:1,000; cat. no. A11025, Abclonal Biotech Co., Ltd.); anti-Bax (1:1,000; cat. no. A12009; Abclonal Biotech Co., Ltd.); anti-LC3B (1:1,000; cat. no. Arg55799; Arigo Biolaboratories, Corps.); and anti-Beclin1 (1:1,000; cat. no. A7353; Abclonal Biotech Co., Ltd.); anti-total-mTOR (1:1,000; cat. no. A2445; Abclonal Biotech Co., Ltd.); anti-phosphorylated (phospho)-mTOR (1:1,000; cat. no. AP0094; Abclonal Biotech Co., Ltd.), anti-total-P70/S6 kinase [1:1,000; cat. no. 2708t; Cell Signaling Technology, Inc., (CST)]; anti-phospho-P70/S6 kinase (1:1,000; cat. no. 9208t; CST); anti-total-4EBP1 (1:1,000; cat. no. 9644t; CST); anti-phospho-4EBP1 (1:1,000; cat. no. 9451t; CST). The membranes were washed with TBST 3 times, following by incubation with HRP-conjugated secondary antibodies anti-rabbit IgG (H+L; 1:2,000; cat. no. ANT020) and anti-mouse IgG (H+L; 1:2,000; cat. no. ANT019; both Antgene Biotechnology co., Ltd.) for 2 h at room temperature. Bands were detected with a chemiluminescence detection System (ECL; Thermo Fisher Scientific, Inc.) and quantified by densitometry using ImageJ software.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Myocardial total RNA was extracted with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Complementary DNA was synthesized using the PrimeScript RT Master Mix kit (Takara Bio, Inc.) and then used for qPCR with a SYBR-Green Master Mixture (Takara Bio, Inc.) on the ABI StepOnePlus RT-PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc.). The reverse transcription conditions were as follows: 37°C for 15 min and 85°C for 5 sec. The qPCR cycling conditions were as follows: 95°C for 10 min and 40 cycles of 95°C for 15 sec and 60°C for 15 sec. qPCR was performed with 3 replicates of each sample. The relative expression quantity was analyzed by normalizing to the GAPDH level and calculated with the 2−ΔΔCq method (38). The primers were as follows: 5′-AGG TCG GTG TGA ACG GAT TTG-3′ and 5′-AGG TCG GTG TGA ACG GAT TTG-3′ for GAPDH, 5′-GCT TCC AGG CCA TAT TGG AG-3′ and 5′-GGG GGC ATG ACC TCA TCT T-3′ for natriuretic peptide type A (ANP), 5′-GAG GTC ACT CCT ATC CTC TGG-3′ and 5′-GCC ATT TCC TCC GAC TTT TCT C-3′ for natriuretic peptide type B (BNP), 5′-ACT GTC AAC ACT AAG AGG GTC A-3′ and 5′-TTG GAT GAT TTG ATC TTC CAG GG-3′ for myosin heavy polypeptide 7 (β-MHC), 5′-GCT CCT CTT AGG GGC CAC T-3′ and 5′-CCA CGT CTC ACC ATT GGG G-3′ for collagen I, 5′-ACG TAG ATG AAT TGG GAT GCA G-3′ and 5′-GGG TTG GGG CAG TCT AGT G-3′ for collagen III.

Statistical analysis

Each experiment was repeated ≥3 times. All data were analyzed by Prism 5 (GraphPad Software Inc.) and presented as the mean ± standard error of the mean. The differences in the data were analyzed. Unpaired, two-tailed Student's t-test was used for two groups. One-way analysis of variance was used for multiple comparisons. Post hoc differences were determined by Newman Keuls test. P<0.05 was considered to indicate a statistically significant difference.

Results

Redd1 is downregulated in the heart during the myocardial infarction process

To investigate whether Redd1 is involved in MI, LAD-induced MI models were used (Fig. 1A). Redd1 mRNA and protein levels in the infarct zone declined significantly at different time points (1 and 4 weeks) after MI compared with sham-operation animals (P<0.001; Fig. 1B, D and E). Meanwhile, Redd1 mRNA and protein expression declined significantly in different regions (border area and infarct area) at 4 weeks compared with the sham group (P<0.05; Fig. 1C, F and G). These data indicate that Redd1 expression in the heart is downregulated during MI, suggesting that Redd1 may participate in the process of MI.

Redd1 overexpression protects against cardiac dysfunction after MI

To investigate the influence of Redd1 on cardiac dysfunction and remodeling post-MI, AAV9-Redd1 or control AAV9-GFP was injected via the tail vein 4 weeks prior to permanent LAD ligation. A total of 8 weeks after injection, AAV9-Redd1 group displayed increased fluorescence intensity of Redd1 compared with the AAV9-GFP group (Fig. 2A and B). In addition, heart Redd1 protein level was increased nearly three times in the sham operation mice injected with AAV9-Redd1 compared with the sham operation mice injected with AAV9-GFP. Notably, the heart Redd1 protein level was also increased in MI mice injected with AAV9-Redd1 compared with MI mice injected with AAV9-GFP (Fig. 2C and D). In line with preceding studies, the present study discovered that mice undergoing MI surgery exhibited decreased LVEF and LVFS, as well as increased LVEDd and LVESd (39,40), suggesting that MI surgery successfully leads to cardiac insufficiency and ventricular dilatation (Fig. 2E). Parameters of echocardiography in mice at 4 weeks after sham or MI surgery are listed in Table I. Redd1 overexpression significantly increased LVEF and LVFS (P<0.001; Fig. 2F and G), while LVEDd and LVESd were attenuated (Fig. 2H and I). Sham+Redd1 group mice displayed no significant changes compared with Sham+GFP group mice. Consistently, the MI+Redd1 group mice also displayed decreased mRNA levels of ANP and BNP compared with the MI+GFP group mice in the border zone (Fig. 2J and K). The β-MHC mRNA level was also slightly decreased after the AAV-Redd1 injection but not significantly (Fig. 2L). Collectively, Redd1 overexpression protected against cardiac dysfunction and cardiac dilatation at 4 weeks after MI after MI.
Figure 2

Redd1 overexpression protects against cardiac dysfunction after MI. (A) The temporal expression pattern of Redd1 tested in fluorescence in the heart of AAV9-GFP and AAV9-Redd1 mice. (B) Quantitative results of Redd1 fluorescence intensity (n=6). (C) Protein expression of Redd1 at 4 weeks following MI in the myocardium of mice treated with AAV9-GFP or AAV9-Redd1 and (D) the quantitative analysis (n=6-8). (E) Representative M-mode echocardiography image of the LV from the four groups at 4 weeks after MI. (F-I) Quantitative results of (F) LVEF, (G) LVFS, (H) LVESd and (I) LVEDd of mice from the four groups at 4 weeks after MI (n=6-8). (J) ANP, (K) BNP and (L) β-MHC determined by reverse transcription-quantitative PCR assay (n=6-8). Data presented as the mean ± standard error of the mean. &P<0.05, &&P<0.01 and &&&P<0.001 vs. Sham+GFP group; *P<0.05, **P<0.01 and ***P<0.001 vs. the MI+GFP group. Redd1, regulated in development and DNA damage response-1; MI, myocardial infarction; AAV9, adeno-associated virus 9; GFP, green fluorescent protein; LV, left ventricular; LVEF, left ventricular ejection fraction; LVFS, left ventricular fractional shortening; LVEDd, left ventricular end-diastolic diameter; LVESd, left ventricular end-systolic diameter; ANP, natriuretic peptide type A; BNP, natriuretic peptide type B; β-MHC, myosin heavy polypeptide 7.

Table I

Parameters in mice at 4 weeks after sham or MI surgery.

ParametersSham+GFP (n=6)Sham+Redd1 (n=6)MI+GFP (n=8)MI+Redd1 (n=8)
LVEF (%)67.10±1.8464.58±2.359.55±2.01a20.23±1.59b
LVFS (%)36.63±1.4434.76±1.734.00±0.89a9.17±0.76b
LVEDd (mm)3.71±0.043.68±0.065.54±0.10a4.85±0.19b
LVESd (mm)2.35±0.042.40±0.085.42±0.06a4.52±0.12b

Data presented as the mean ± standard error of the mean.

P<0.001 vs. Sham+GFP group;

P<0.01 vs. the MI+GFP group. LVEF, left ventricular ejection fraction; LVFS, left ventricular fractional shortening; LVEDd, left ventricular end-diastolic diameter; LVESd, left ventricular end-systolic diameter.

Redd1 overexpression protects against cardiac expansion and fibrosis after MI

To determine cardiac dilatation post MI, heart tissues were stained with Masson's trichrome 4 weeks after MI (Fig. 3A). In the present study, the MI+Redd1 group displayed a reduced heart expansion index, as well as unaltered scar size and wall thickness compared with the MI+GFP group (Fig. 3B-D). Meanwhile, to analyze cardiac fibrosis, heart tissues were stained with picrosirius red staining in the border zone. The MI+Redd1 group displayed less collagen content compared with the MI+GFP group (Fig. 3E and F). Furthermore, MI+Redd1 group mice also exhibited lower mRNA levels of collagen I and collagen III compared with MI+GFP group mice (Fig. 3G and H). Collectively, Redd1 over-expression protected against cardiac expansion and fibrosis after MI.
Figure 3

Redd1 overexpression protects against cardiac expansion and fibrosis after MI. (A) Representative Masson's trichrome staining of cardiac sections in the four groups. (B) Quantitative analysis of infarct size, (C) relative scar thickness and (D) expansion index at 4 weeks after MI in MI+GFP and MI+Redd1 mice (n=6-8). (E) Representative picrosirius red-stained sections of infarct and border areas in each group at 4 weeks after MI and (F) the quantitative analysis (n=6-8). Relative mRNA levels of (G) collagen I and (H) collagen III in the heart of sham-operation mice or in the border zone at 4 weeks post MI surgery (n=6-8). Data presented as the mean ± standard error of the mean. &&&P<0.001 vs. Sham+GFP group; *P<0.05, **P<0.01 and ***P<0.001 vs. MI+GFP group. NS, not significant; Redd1, regulated in development and DNA damage response-1; MI, myocardial infarction; GFP, green fluorescent protein.

Redd1 overexpression inhibits myocardial apoptosis after MI

In order to explore the effect of Redd1 on cardiac cell apoptosis in the infarct zone, TUNEL staining was conducted. A total of 4 weeks after MI, it was found that the MI+Redd1 group mice displayed decreased TUNEL-positive cells compared with the MI+GFP group (Fig. 4A and B). In addition, the expression of Bcl-2 family members in the infarct zone was examined through western blot assay. The MI+Redd1 group mice exhibited a significant increase in the expression of Bcl-2 and the ratio of Bcl-2/Bax compared with MI+GFP group mice (P<0.01; Fig. 4C and D). These results showed that Redd1 could attenuate cardiac cell apoptosis in response to ischemia injury.
Figure 4

Redd1 overexpression inhibits myocardial apoptosis after MI. (A) Representative images of TUNEL staining showing cardiac cell apoptosis. (B) Quantitative results of TUNEL-positive cells (n=6-8). (C) Detection of protein levels of Bcl-2 and Bax in each group at 4 weeks after MI. (D) Quantitative results of Bcl-2, Bax and the ratio of Bcl-2/Bax are shown (n=6-8). Data presented as the mean ± standard error of the mean. &&P<0.01 vs. Sham+GFP group; *P<0.05, **P<0.01 and ***P<0.001 vs. MI+GFP group. Redd1, regulated in development and DNA damage response-1; MI, myocardial infarction; TUNEL, Terminal deoxynucleotidyl-transferase mediated dUTP nick-end labeling; GFP, green fluorescent protein.

Redd1 overexpression enhances myocardial autophagy after MI

To investigate the effect of Redd1 on myocardial autophagy in the border zone of the infarction, LC3 and Beclin1 levels were measured through western blotting. A total of 4 weeks following LAD ligation, Beclin1 expression and the LC3-II/LC3-I ratio were increased in the MI+Redd1 group mice compared with in the MI+GFP group mice (Fig. 5A-C). Similarly, the ratio of LC3 puncta positive cells to the total cells in the border zone was increased in the MI+Redd1 group mice compared with in the MI+GFP group mice, as well as LC3 puncta per cell (Fig. 5D-F). These results demonstrated that overexpression of Redd1 could improve cardiac cell autophagy at 4 weeks after MI.
Figure 5

Redd1 overexpression enhances myocardial autophagy after MI. (A) Detection of protein levels of Beclin1 and LC3 in each group at 4 weeks after MI. (B) Quantitative results of Beclin1, LC3-I, LC3-II and (C) the ratio of LC3-II/LC3-I are shown (n=6-8). (D) Detection of autophagosomes by LC3 immunostaining 4 weeks after MI. (E) Quantitative results of LC3 puncta positive cells (n=6-8). (F) Quantitative results of LC3 puncta per cell (n=6-8). Data presented as the mean ± standard error of the mean. &P<0.05, &&P<0.01 and &&&P<0.001 vs. Sham+GFP group; *P<0.05, **P<0.01 and ***P<0.001 vs. MI+GFP group. Redd1, regulated in development and DNA damage response-1; MI, myocardial infarction; LC3, light chain 3; GFP, green fluorescent protein.

Redd1 overexpression downregulates the mTOR/P70/S6 kinase/4EBP1 pathway after MI

To further study whether the mTOR signaling pathway is involved in the regulation of MI mediated by Redd1, the influence of Redd1 overexpression on mTOR phosphorylation level in the border zone of the infarction was measured. MI surgery resulted in increased mTOR phosphorylation, while Redd1 overexpression partially inhibited this effect (Fig. 6A and B). The phosphorylation state of P70/S6 kinase and 4EBP1 was examined and targets of the mTOR1 complex were established. As shown in Fig. 6, Redd1 also significantly decreased the phosphorylation levels of P70/S6 kinase and 4EBP1 (P<0.001; Fig. 6C and D). These results suggested that Redd1 could alleviate ischemia injury induced ventricular dysfunction partly through the mTOR signaling pathway.
Figure 6

Redd1 overexpression reduces phosphorylation of mTOR after MI. (A) Detection of protein levels of phosphorylation of mTOR and other known downstream molecular targets including P70/S6 kinase and 4EBP1 in the heart of each group at 4 weeks after MI. The phosphorylated-to-total protein ratios of (B) mTOR, (C) P70/S6 kinase and (D) 4EBP1 were quantified (n=6-8). Data presented as the mean ± standard error of the mean. &P<0.05, &&P<0.01 and &&&P<0.001 vs. Sham+GFP group; *P<0.05 and ***P<0.001 vs. MI+GFP group. Redd1, regulated in development and DNA damage response-1; mTOR, mammalian target of rapamycin; MI, myocardial infarction; GFP, green fluorescent protein.

Discussion

MI is a major cause of morbidity and mortality worldwide (1,2). Although significant progress has been made in minimizing myocardial loss after MI, large numbers of patients still develop heart failure due to myocardial remodeling (41). The present study demonstrated a critical role for Redd1 in post-MI cardiac dysfunction. The Redd1 expression level decreased in different regions (border area and infarct area) of the infarcted myocardium at 4 weeks. Cardiac-specific overexpression of Redd1 improved cardiac function and decreased cardiac dilatation. This protective effect was produced via inhibiting apoptosis and enhancing autophagy. This pattern indicates that Redd1 plays a protective role in myocardial ischemia injury. Redd1 has been identified as a critical stress-regulated protein whose expression is transcriptionally induced in various types of cells by DNA damage involved in a variety of physiological and pathological processes (18). Most studies indicate that Redd1 serves an important role in inflammation and autophagy (20-22). In addition, Liu et al (27) explored whether Redd1 attenuated cardiac hypertrophy induced by phenylephrine via enhancing autophagy. Consistent with these results, the present study also demonstrated the protective effect of Redd1 in post-MI cardiac dysfunction. Paradoxically, previous studies have illustrated that inhibition of Redd1 could protect cardiac against I/R injury (42,43). Recently, Gao et al (44) demonstrated that increased Redd1 expression contributed to I/R injury by exaggerating excessive autophagy during reperfusion. The present study supposed that the contradictory conclusion was due to the different models, as Hashmi and Al-Salam (45) has declared that the processes of cardiomyocyte injury in MI and I/R were indeed distinct. In addition, the local microenvironment of the myocardium determined the particular roles of molecules and enzymes that were part of their pathogenesis. Actually, the pathological changes, such as inflammation, apoptosis and autophagy in MI vary along with time (46). It makes more sense for further experiments to explore the functions of Redd1 in different periods of MI. To inspect the underlying mechanism that Redd1 protects against cardiac remodeling and dysfunction, the present study investigated the effect of Redd1 on cardiac fibrosis and apoptosis. The occurrence of cardiac fibrosis has been identified as a definitive characteristic of pathological remodeling and results in cardiac dysfunction post MI (47). Previous research has demonstrated that cardiac fibrosis not only causes systolic dysfunction, but also interrupts the coordination of myocardial excitation-contraction coupling (48). The results of the present study showed that overexpression of Redd1 alleviated heart failure and cardiac fibrosis induced by MI in vivo, as indicated by increased cardiac function and decreased collagen content. Apoptosis, a process of programmed cell death, has been identified in the pathogenesis of myocardial ischemia injury (7,49) and could determine the fate of the heart (50). In the present study, Redd1 overexpression could inhibit myocardial apoptosis in post-MI hearts in vivo. The results indicate that Redd1 can inhibit apoptosis by upregulating the expression of anti-apoptotic molecules Bcl-2 and the ratio of Bcl-2/Bax. However, the exact mechanism underlying Redd1-mediated apoptosis inhibition post MI is not well understood. Autophagy is a crucial intracellular process which can increase protein turnover and may be involved in preventing the accumulation of aberrant proteins or impaired organelles (51). Autophagy deficiency may be responsible for polyubiquitinated protein accumulation and endoplasmic reticulum stress elevation (52). Autophagy seems to regulate cardiac homeostasis in response to various stresses and has a protective role in the cardiac response to ischemia by removing damaged mitochondria (8,53). A previous study demonstrated that impaired autophagy contributes to adverse cardiac remodeling post MI (54). It has been reported that enhancing autophagy could decrease infarction size and alleviate adverse cardiac remodeling (55), while suppressing autophagy led to adverse cardiac remodeling following MI. The results revealed that autophagy plays a dynamic role in the determination of infarct size and cardiac function. In line with the previous studies, the present study observed that the cardiac cells of MI mice exhibited a lower rate of autophagy (46,56). This was indicated by 2 well-defined markers of Beclin1 (an indicator of autophagy induction) and conversion of LC3-I to lipidated LC3-II (an index of autophagosome abundance), which suggested that impaired autophagy was related to the pathological mechanism of cardiac remodeling in response to MI. However, Redd1 over-expression improved cardiac cell autophagy, accompanied by elevated heart function and reduced cardiac expansion. Based on these results, it can be concluded that Redd1 serves a protective role in enhancing autophagy, therefore ameliorating cardiac remodeling post MI. mTOR is recognized as a highly conserved serine/threonine kinase that controls cellular metabolism and growth in response to diverse stimuli (11,57,58). Studies have demonstrated that mTOR is necessary for embryonic cardiovascular development (59,60). However, selective pharmacological and genetic inhibition of mTOR was shown to reduce myocardial damage after acute and chronic MI (17). Previous studies have demonstrated that mTOR and its downstream signaling pathways can concurrently regulate apoptosis and autophagy (13-15). Furthermore, inhibiting mTOR induced apoptosis and autophagy may exert a protective influence against MI injury (16,17). Consistent with a previous study, the current results revealed that the phosphorylation of mTOR and its downstream signaling pathways were induced in response to MI, along with increased apoptosis and decreased autophagy. Additionally, Redd1 overexpression could inhibit apoptosis and enhance autophagy, as well as suppress the phosphorylation of mTOR. Accordingly, the results of the present study suggest that the inhibition of mTOR signaling pathway contributes to the protective effects of Redd1 on reducing apoptosis and improving autophagy in the myocardium in response to MI surgery. Therefore, the authors speculated that Redd1 protected against cardiac dysfunction and remodeling through inhibiting the mTOR pathway. In conclusion, the results of the present study have provided the new insight that Redd1 exerts a beneficial influence in improving cardiac dysfunction post-infarction. The cardiac protective effects of Redd1 post MI are associated with the inhibition of apoptosis and the improvement of autophagy. Redd1 exerts its effect, at least in part, by suppressing the mTOR signaling pathway. However, the precise mechanism by which Redd1 regulates apoptosis and autophagy remains to be elucidated, and further investigations are underway. From the clinical point of view, Redd1 could potentially be a therapeutic candidate for the prevention and treatment of MI-induced irreversible myocardial remodeling and heart failure, reducing the risk of mortality. From a clinical point of view, Redd1 could potentially be a promising therapeutic candidate for patients with MI and other cardiovascular diseases.
  60 in total

1.  Burden of disease--implications for future research.

Authors:  C M Michaud; C J Murray; B R Bloom
Journal:  JAMA       Date:  2001-02-07       Impact factor: 56.272

2.  The key to unraveling the mystery of mortality in heart failure: an integrated approach.

Authors:  Prakash C Deedwania
Journal:  Circulation       Date:  2003-04-08       Impact factor: 29.690

Review 3.  Mechanisms of cell death in heart disease.

Authors:  Klitos Konstantinidis; Russell S Whelan; Richard N Kitsis
Journal:  Arterioscler Thromb Vasc Biol       Date:  2012-05-17       Impact factor: 8.311

4.  Allogeneic mesenchymal stem cell transplantation in postinfarcted rat myocardium: short- and long-term effects.

Authors:  Wangde Dai; Sharon L Hale; Bradley J Martin; Jin-Qiang Kuang; Joan S Dow; Loren E Wold; Robert A Kloner
Journal:  Circulation       Date:  2005-07-05       Impact factor: 29.690

5.  Distinct roles of autophagy in the heart during ischemia and reperfusion: roles of AMP-activated protein kinase and Beclin 1 in mediating autophagy.

Authors:  Yutaka Matsui; Hiromitsu Takagi; Xueping Qu; Maha Abdellatif; Hideyuki Sakoda; Tomoichiro Asano; Beth Levine; Junichi Sadoshima
Journal:  Circ Res       Date:  2007-03-01       Impact factor: 17.367

6.  Left ventricular end-systolic volume as the major determinant of survival after recovery from myocardial infarction.

Authors:  H D White; R M Norris; M A Brown; P W Brandt; R M Whitlock; C J Wild
Journal:  Circulation       Date:  1987-07       Impact factor: 29.690

7.  The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress.

Authors:  Atsuko Nakai; Osamu Yamaguchi; Toshihiro Takeda; Yoshiharu Higuchi; Shungo Hikoso; Masayuki Taniike; Shigemiki Omiya; Isamu Mizote; Yasushi Matsumura; Michio Asahi; Kazuhiko Nishida; Masatsugu Hori; Noboru Mizushima; Kinya Otsu
Journal:  Nat Med       Date:  2007-04-22       Impact factor: 53.440

8.  Regulation of mTOR function in response to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex.

Authors:  James Brugarolas; Kui Lei; Rebecca L Hurley; Brendan D Manning; Jan H Reiling; Ernst Hafen; Lee A Witters; Leif W Ellisen; William G Kaelin
Journal:  Genes Dev       Date:  2004-11-15       Impact factor: 11.361

Review 9.  DNA Damage Inducible Transcript 4 Gene: The Switch of the Metabolism as Potential Target in Cancer.

Authors:  Indira Tirado-Hurtado; Williams Fajardo; Joseph A Pinto
Journal:  Front Oncol       Date:  2018-04-12       Impact factor: 6.244

10.  Inflammation, Autophagy, and Apoptosis After Myocardial Infarction.

Authors:  Xianwei Wang; Zhikun Guo; Zufeng Ding; Jawahar L Mehta
Journal:  J Am Heart Assoc       Date:  2018-04-21       Impact factor: 5.501

View more
  1 in total

1.  Blocking REDD1/TXNIP Complex Ameliorates HG-Induced Renal Tubular Epithelial Cell Apoptosis and EMT through Repressing Oxidative Stress.

Authors:  Lin Mu; Nan Chen; Yakun Chen; Zhifen Yang; Huandi Zhou; Shan Song; Yonghong Shi
Journal:  Int J Endocrinol       Date:  2022-09-21       Impact factor: 2.803

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.