| Literature DB >> 31614626 |
Md Zohaib Ahmed1,2, Nitin Bhardwaj3,4, Supriya Sharma5, Veena Pande6, Anupkumar R Anvikar7.
Abstract
Complications due to malaria are caused mostly by host immunological responses. Plasmodium falciparum subverts host immunity by various strategies, including modulation in the host immune responses by regulating cytokines. The transcriptional alterations of major cytokines and immunoregulators were analyzed in this study through gene expression profiling in clinically defined subgroups of P. falciparum patients. Malaria patients were included from Dhalai district hospital of Tripura with uncomplicated malaria (UC) and severe malaria (SM) and healthy controls from endemic and non-endemic areas of India. qPCR gene expression analysis was performed for all factors and they were grouped into three clusters based on their altered expressions. The first cluster was downregulated with an increased parasitic burden which included T-BET, GATA3, EOMES, TGF-β, STAT4, STAT6 and cytokines IFN-γ, IL-12, IL-4, IL-5, and IL-13. RANTES, IL-8, CCR8, and CXCR3 were decreased in the SM group. The second cluster was upregulated with severity and included TNF-α, IL-10, IL-1β and IL-7. PD-1 and BCL6 were increased in the SM group. The third cluster comprised of NF-κB and was not altered. The level of perforin was suppressed while GrB expression was elevated in SM. P. falciparum malaria burden is characterized by the modulation of host immunity via compromization of T cell-mediated responses and suppression of innate immune-regulators.Entities:
Keywords: cell-mediated immunity; cytokines; innate immunity; malaria; north-east India; transcriptional factors
Year: 2019 PMID: 31614626 PMCID: PMC6843480 DOI: 10.3390/biom9100600
Source DB: PubMed Journal: Biomolecules ISSN: 2218-273X
Age, gender distribution, parasitemia level and other demographic details among different malaria clinical groups.
| UC1 ( | UC2 ( | SM ( | EC ( | NEC ( | |
|---|---|---|---|---|---|
|
| 16.8 ± 4.96 * | 26.58 ± 10.70 | 22.8 ± 11.78 | 30 ± 8.32 * | 34 ± 5.29 |
|
| 4 (80) | 2 (16.7) | 1(20) | 3 (50) | 1(33.3) |
|
| 17.92 ± 1.44 * | 18.54 ± 2.53 ** | 19.18 ± 2.24 & | 22.80 ± 3.60 *, **, & | 24.96 ± 2.38 |
|
| 9104 ± 3242.42 | 90184.75 ± 28871.36 | 289859.6 ± 98092.5 | NA | NA |
|
| 116.2 ± 10.92 | 108.16 ± 18.38 ** | 100.6 ± 14.10 & | 133.33 ± 8.62 **, & | 116 ± 8.89 |
|
| 79.4 ± 9.42 # | 70.33 ± 9.54 ** | 68.2 ± 4.87 #, & | 86.66 ± 4.13 **, & | 76.33 ± 5.69 |
|
| 110 ± 16.19 * | 92.41 ± 18.48 | 97 ± 18.17 | 82.5 ± 11.15 * | 84 ± 2.0 |
|
| 22.6 ± 1.52 #, $ | 25.83 ± 2.48 **, ##, $ | 36.4 ± 1.14 #, ##, & | 20.83 ± 1.83 **, & | 19 ± 1.0 |
|
| 12.34 ± 1.05 | 13.09 ± 0.86 ## | 11.2 ± 3.17 ## | 12.60 ± 1.69 | 14.53 ± 0.32 |
|
| 37.6 ± 3.21 | 39.08 ± 3.45 | 34.8 ± 10.99 | 39.83 ± 5.34 | 43.33 ± 1.53 |
p-values were calculated using ANOVA post-hoc (LSD) analysis. Parameters were represented as mean and standard deviation (±). Note: Endemic control (EC), non-endemic control (NEC), uncomplicated malaria1 (UC1 = parasitemia < 25,000/μL), uncomplicated malaria2 (UC2 = parasitemia > 25,000/μL) and severe malaria (SM).* = UC1 vs. EC, p-value < 0.05; **= UC2 vs. EC, p-value < 0.05; # = UC1 vs. SM, p-value < 0.05; ## = UC2 vs. SM, p-value < 0.05; $ = UC1 vs. UC2, p-value < 0.05; & = SM vs. EC, p-value < 0.05.
List of primer sequences designed for SYBR green-based quantitative real-time polymerase chain reaction.
| S.N | Genes ( | HGNC Gene ID | Forward Primer | Reverse Primer | Product Size (bp) | Tm | DDBJ Accession Numbers | NCBI Chromosome Location |
|---|---|---|---|---|---|---|---|---|
| 1 | IFN-γ (IFNG) | HGNC:5438 | GCAGCCAACCTAAGCAAGAT | CAAACCGGCAGTAACTGGAT | 103 | 60 | LC461674 | 12q15 |
| 2 | TNF-α (TNF-alpha) | HGNC:11892 | GCCCGACTATCTCGACTTTG | GGTTGAGGGTGTCTGAAGGA | 141 | 60 | LC461675 | 6p21.33 |
| 3 | TGF-β1 (TGFB1) | HGNC:11766 | CCCTGGACACCAACTATTGC | CAGAAGTTGGCATGGTAGCC | 130 | 60 | LC461676 | 19q13.2 |
| 4 | β-ACTIN (ACTB) | HGNC:132 | TCGTGCGTGACATTAAGGAG | GTCAGGCAGCTCGTAGCTCT | 110 | 60 | LC461677 | 7p22.1 |
| 5 | IL-1β (IL1B) | HGNC:5992 | GGCGGCCAGGATATAACT | CCCTAGGGATTGAGTCCACA | 100 | 60 | LC461678 | 2q14.1 |
| 6 | IL-4 | HGNC:6014 | GGCTTGAATTCCTGTCCTGT | ATGATCGTCTTTAGCCTTTC | 77 | 60 | LC461679 | 5q31.1 |
| 7 | IL-5 | HGNC:6016 | AGGGCCAAGAAAGAGTCAGG | TGCCTGGAGGAAAATACTTC | 153 | 60 | LC461680 | 5q31.1 |
| 8 | IL-7 | HGNC:6023 | TTCCTCTGGTCCTCATCCAG | ATCCGCCAGCAGTGTACTTT | 140 | 60 | LC461681 | 8q21.13 |
| 9 | IL-8 (CXCL8) | HGNC:6025 | CTAGGACAAGAGCCAGGAAGAA | AACTGCACCTTCACACAGAGC | 128 | 60 | LC461682 | 4q13.3 |
| 10 | IL-10 | HGNC:5962 | TTGGGGCTTCCTAACTGCTAC | AGTGGTTGGGGAATGAGGTTAG | 118 | 62 | LC461683 | 1q32.1 |
| 11 | IL-12B | HGNC:5970 | ATTGTGCCACTGCATACCAG | AGGACTGCCATGGAAGCTAA | 101 | 62 | LC461684 | 5q33.3 |
| 12 | IL-12Rβ2 | HGNC:5972 | ACTGGAGCCTCAGCACATCT | AGCCTCACCACTCAGAGCAT | 138 | 60 | LC461685 | 1p31.3 |
| 13 | IL-13 | HGNC:5973 | GCCAAGGGTTCAGAGACTCA | GACCCCAGTGAGGTAGCAGA | 102 | 60 | LC461686 | 5q31.1 |
| 14 | RUNX1 | HGNC:10471 | GGGAACTGTCAAGCTGGTGT | CTGTGTACCGTGGACTGTGGA | 126 | 58 | LC461687 | 21q22.12 |
| 15 | RUNX3 | HGNC:10473 | TGAGAGGTGGGGAGTACTGG | GGCAAGACTTCACCTCGGAA | 102 | 60 | LC461688 | 1p36.11 |
| 16 | IRF1 | HGNC:6116 | GAAGAACATGGATGCCACCT | TCTCTGCACCATATCCACCA | 156 | 60 | LC461689 | 5q31.1 |
| 17 | T-BET (TBX21) | HGNC:11599 | GGAAACGGATGAAGGACTGA | ATCCTTCTTGAGCCCCACTT | 89 | 58 | LC461690 | 17q21.32 |
| 18 | GATA3 | HGNC:4172 | GAGGGTAGCAGTGTATGAGCT | CACTAACACAGAACACGACAGG | 112 | 58 | LC461691 | 10p14 |
| 19 | STAT1 | HGNC:11362 | ACAAAGTCATGGCTGCTGAG | AAGTTCCATTGGCTCTGGTG | 128 | 60 | LC461692 | 2q32.2 |
| 20 | STAT4 | HGNC:11365 | CAACCAACGATTCCCAGAAC | TCTGCCAGCATATGGAGTTG | 142 | 58 | LC461693 | 2q32.2-q32.3 |
| 21 | STAT6 | HGNC:11368 | AACATCCAGCCATTCTCTGC | TTGGGCTTCTTGGGATAGAG | 101 | 58 | LC461694 | 12q13.3 |
| 22 | NF-KB1 (NFKB1) | HGNC:7794 | CTGGAAGCACGAATGACAGA | TGAGGTCCATCTCCTTGGTC | 172 | 60 | LC461695 | 4q24 |
| 23 | EOMES | HGNC:3372 | CCACTGCCCACTACAATGTG | CTCATCCAGTGGGAACCAGT | 166 | 60 | LC461696 | 3p24.1 |
| 24 | GrB (GZMB) | HGNC:4709 | CCAGGGCATTGTCTCCTATG | ATTACAGCGGGGGCTTAGTT | 138 | 60 | LC461697 | 14q12 |
| 25 | PERFORIN (PRF1) | HGNC:9360 | CATGTAACCAGGGCCAAAGT | GGCTTAGGAGTCACGTCCAG | 104 | 60 | LC461698 | 10q22.1 |
| 26 | CSF1 | HGNC:2432 | TAAGAGACCCTGCCCTACCTG | CAAGTTCACTGCCCTTCCCTA | 127 | 58 | LC461699 | 1p13.3 |
| 27 | LT-ALPHA (LTA) | HGNC:6709 | CCTGATGTCTGTCTGGCTGA | TGCTCTTCCTCTGTGTGTGG | 113 | 60 | LC461700 | 6p21.33 |
| 28 | CXCR3 | HGNC:4540 | AGCTTTGACCGCTACCTGAA | GCCGACAGGAAGATGAAGTC | 140 | 60 | LC461701 | Xq13.1 |
| 29 | CCR8 | HGNC:1609 | CCCTGTGATGCGGAACTTAT | CAGACCACAAGGACCAGGAT | 119 | 60 | LC461702 | 3p22.1 |
| 30 | cMAF | HGNC:6776 | CTTTGCTCTCTGCCTCGTCT | CGCTCTCTACCTCTGTGCAA | 141 | 60 | LC461703 | 16q23.2 |
| 31 | NFAT1 (NFATC2) | HGNC:7776 | CTGGAGGTGGGTTTCTACCA | AGGGGCAGAAGGGATCTTTA | 134 | 60 | LC461704 | 20q13.2 |
| 32 | cJUN(AP1) | HGNC:6204 | CACGTGAAGTGACGGACTGT | CAGGGTCATGCTCTGTTTCA | 143 | 60 | LC461705 | 1p32.1 |
| 33 | p38 MAPK (MAPK14) | HGNC:6876 | TGCACATGCCTACTTTGCTC | AGGTCAGGCTTTTCCACTCA | 116 | 60 | LC461706 | 6p21.31 |
| 34 | SOCS1 | HGNC:19383 | AGACCCCTTCTCACCTCTTGA | TAGGAGGTGCGAGTTCAGGT | 117 | 60 | LC461707 | 16p13.13 |
| 35 | SOCS3 | HGNC:19391 | GAGACGGGACATCTTTCACCT | CAGGCTGAGTATGTGGCTTTC | 152 | 60 | LC461708 | 17q25.3 |
| 36 | BATF | HGNC:958 | GGAGTGAACACGGGAACTGT | CCATGGGACTTGAGCATCTT | 148 | 60 | LC461709 | 14q24.3 |
| 37 | BCL6 | HGNC:1001 | CAGCCACAAGACCGTCCATAC | CGAGTGTGGGTTTTCAGGTTG | 96 | 60 | LC461710 | 3q27.3 |
| 38 | ETS1 | HGNC:3488 | TGGTCTAGCTGGGTGAAACC | CCAGAATGGAGAAGGGAACA | 102 | 60 | LC461711 | 11q24.3 |
| 39 | PD-1 (PDCD1) | HGNC:8760 | CCTGCAGGCCTAGAGAAGTTT | GGGCATGTGTAAAGGTGGAG | 91 | 60 | LC461712 | 2q37.3 |
| 40 | RANTES (CCL5) | HGNC:10632 | TCTGTGACCAGGAAGGAAGTC | GTTTGCCAGTAAGCTCCTGTG | 108 | 60 | LC461713 | 17q12 |
Differential clustering of TF’s and cytokines based on their similar expression order.
| Cluster 1 | Cluster 2 | Cluster 3 | ||
|---|---|---|---|---|
| IFNγ | Runx3 | TNFα | p38 | NFκB |
| TGF-β | Stat4 | IL10 | BATF | |
| IL12 | Stat6 | IL1β | BCL6 | |
| GATA3 | IL12Rβ2 | Granzyme B | IRF1 | |
| Tbet | CXCR3 | Stat1 | PD-1 | |
| Eomes | CCR8 | IL7 | ||
| IL4 | LTα | cMAF | ||
| IL5 | NFAT | cJUN | ||
| IL13 | ETS1 | Socs1 | ||
| CSF1 | IL8 | Socs3 | ||
| Perforin | Rantes | |||
| Runx1 | ||||
Note. Cluster 1= Factors with decreased expression following the disease severity, Cluster 2 = Factors with increased expression following the disease severity, Cluster 3 = Factors with moderate or unchanged expression following the disease severity.
Figure 1Relative mRNA expression profiling of cytokines and other regulatory factors showing differential disease burden among malaria subgroups are presented as Ct values. Expressions of these signaling molecules were found decreased with the P. falciparum malaria burden and were grouped as cluster 1. Major TH1, TH2 factors, and players of innate immunity were found depressed (A) IFNG displayed gene upregulation during early malaria progressions. Master transcription factor of TH1 (T-BET), TH2 (GATA3) as well as CD8+ Tc (EOMES) cells got depressed as malaria progress. Expressions of PERFORIN and macrophage cells specific transcription factor CSF1 were found downregulated. (B) Grouped as innate immunity regulatory molecules, RUNX1 and RUNX3 were found depressed. However, RUNX1 displayed gene upregulation during early malaria progressions compared to healthy endemic control subjects. Chemokines and chemokines receptors, including STAT4, STAT6, and ETS1 levels were found altered. Uncomplicated malaria1 (UC1 = parasitemia < 25,000/μL), uncomplicated malaria2 (UC2 = parasitemia > 25,000/μL), severe malaria (SM), endemic control (EC), non-endemic control (NEC). β-actin was used as an endogenous control. Mean and standard error bars were calculated at a 95% confidence interval (CI). Gene expression decreases as Ct value increases and vice versa.
Figure 2Expressions of these signaling molecules got upregulated following malaria progression and were grouped as Cluster 2. (A) Cytokines like TNF-α, IL10, and IL1β levels were upregulated with an increase in malaria burden. STAT1 expression was moderately upregulated during early infections. Despite downregulated perforin expression, GrB mRNA expression was elevated in severe malaria. Expression levels of IL7 and cJUN were low during the early stages (UC1 and UC2) but were considerably upregulated in severe malaria (SM). (B) p38MAPK mRNA expressions were upregulated. Negative regulators of cytokine signaling like SOCS1 and SOCS3 found elevated following malaria burden. T cell exhaustion indicator, PD1 was also got upregulated following malaria burden. Uncomplicated malaria1 (UC1 = parasitemia < 25,000/μL), uncomplicated malaria2 (UC2 = parasitemia > 25,000/μL), severe malaria (SM), endemic control (EC), non-endemic control (NEC). β-actin was used as an endogenous control. Mean and standard error bars were calculated at a 95% confidence interval (CI). Gene expression decreases as Ct value increases and vice versa.
Figure 3NF-κB expression was not much influenced following malaria burden in any of the clinical subgroups and was grouped in Cluster 3 separately. Uncomplicated malaria1 (UC1 = parasitemia < 25,000/μL), uncomplicated malaria2 (UC2 = parasitemia > 25,000/μL), severe malaria (SM), endemic control (EC), non-endemic control (NEC). β-actin was used as an endogenous control. Mean and standard error bars were calculated at 95% confidence interval (CI). Gene expression decreases as Ct value increases and vice versa.
Figure 4Canonical discriminant function (CDF) illustrates the characteristics of the different clinical subgroups considering regulatory factors/cytokine expression profiles in Plasmodium falciparum-infected patients and healthy control subjects. Function 1 and 2 resulting from CDF, discriminating the EC and NEC from uncomplicated malaria1 (UC1), uncomplicated malaria2 (UC2) and severe malaria (SM) groups according to their relative mRNA expressions (Ct values). Annotation indicates the factors (cytokines and TF’s) that turned out to be relevant for each type of discrimination. CDF discrimination of the clinical subgroups was analyzed using all 39 factors considered for the study. 1 = UC1 (parasitemia < 25,000/μL), 2 = UC2 (parasitemia > 25,000/μL), 3 = SM, 4 = EC and 5 = NEC.
Figure 5Heat-map illustrates comparative fold change of each group per gene expression profile. Each cell of the 2D plot denotes log2 fold value of a single factor in one group with standardized levels represented by color as per color scale on the right. Fold change was calculated by 2−ΔΔCt method considering β-actin as an endogenous control. Top horizontal and left vertical dendrogram indicates average Euclidean clustering of genes taken into panel and malaria clinical subgroups, respectively. UC1 was marked and sub-grouped from the UC2 and SM group. The figure shows a consequence of higher parasitic burden displayed by the latter two groups despite other reasonable associated causes. UC1-EC, uncomplicated malaria group (parasitemia < 25,000/μL) fold change compared to endemic control; UC1-NEC, uncomplicated malaria group (parasitemia < 25,000/μL) fold change compared to non-endemic control; UC2-EC, uncomplicated malaria group (parasitemia > 25,000/μL) fold change compared to endemic control; UC2-NEC, uncomplicated malaria group (parasitemia > 25,000/μL) fold change compared to non-endemic control; SM-EC, severe malaria group fold change compared to endemic control; SM-NEC, severe malaria group fold change compared to non-endemic control.
Figure 6Pearson correlation statistical tests were performed to assess the correlation between cytokines, transcription factors, parasitemia and hemoglobin in all malaria sub-groups (UC1+ UC2+ SM). (A) r = 0.512, 0.656, 0.831, 0.658, 0.561, p = 0.015, 0.001, 0.000, 0.001, 0.007 (B) r = 0.519, −0.509, −0.454, −0.551, 0.571, 0.542, p = 0.013, 0.016, 0.034, 0.008, 0.005, 0.009 (C) r =0.669, 0.504, 0.442, −0.455, 0.617, p = 0.001, 0.017, 0.039, 0.033, 0.002 (D) r = 0.442, 0.438, −0.443, 0.471, 0.539, p = 0.039, 0.041, 0.039, 0.027, 0.010 (E) r = −0.561, −0.619, 0.651, −0.571, −0.521, 0.905, p = 0.007, 0.002, 0.001, 0.006, 0.013, 0.000 (F) r =0.454, 0.588, −0.619, 0.632, 0.482, 0.581, p = 0.034, 0.004, 0.002, 0.002, 0.023, 0.005 (G) r = 0.804, 0.651, 0.856, 0.843, 0.853, 0.559, p = 0.000, 0.001, 0.000, 0.000, 0.000, 0.007 (H) r = 0.768, 0.840, 0.804, 0.896, 0.676, −0.622, p = 0.000, 0.000, 0.000, 0.000, 0.001, 0.002 (I) r = −0.487, 0.869, 0.696, 0.850, −0.484, −0.756, p = 0.022, 0.000, 0.000, 0.000, 0.023, 0.000 (J) r = −0.662, 0.646, −0.555, 0.777, 0.699, 0.694, p = 0.001, 0.001, 0.007, 0.000, 0.000, 0.000.
Linear regression predictive analysis of immunoregulatory factors.
| Factors (All Malaria Cases) | TBET ** | Factors (All Malaria Cases) | GATA3 *** | ||
|---|---|---|---|---|---|
| Standardized Coefficient (Beta) | Standardized Coefficient (Beta) | ||||
| IL-1β | −0.645 | 0.001 | IL-1β | −0.619 | 0.002 |
| EOMES | 0.909 | 0.000 | PERFORIN | 0.639 | 0.001 |
| PERFORIN | 0.882 | 0.000 | GRANZY-B | 0.418 | 0.053 |
| GRANZ-B | 0.639 | 0.001 | LT alpha | 0.740 | 0.000 |
| LT alpha | 0.610 | 0.003 | CXCR3 | 0.769 | 0.000 |
| CXCR3 | 0.864 | 0.000 | CCR8 | 0.474 | 0.026 |
| CCR8 | 0.435 | 0.043 | ETS1 | 0.859 | 0.000 |
| ETS1 | 0.810 | 0.000 | IRF1 | −0.503 | 0.017 |
| IRF1 | −0.555 | 0.007 | RANTES | 0.747 | 0.000 |
| RANTES | 0.868 | 0.000 | BCL6 | −0.549 | 0.008 |
| BCL6 | −0.738 | 0.000 | PD-1 | 0.696 | 0.000 |
| PD-1 | 0.869 | 0.000 | |||
* p-values were calculated using a linear regression model analysis. ** Dependent variable: T-BET, *** dependent variable: GATA3.