Literature DB >> 31611932

Mechanism of H2S-mediated ROCK inhibition of total flavones of Rhododendra against myocardial ischemia injury.

Yi Jiao1, Ya-Nan Li2, Zhi-Wu Chen2, Yan Guo2.   

Abstract

Our previous studies have indicated that pretreatment with total flavones of Rhododendra flower (TFR) may protect against myocardial ischemic injuries in rats and mice. The cystathionine γ-lyase/hydrogen sulfide (CSE/H2S) pathway have been associated with several cardiovascular diseases, but the effect of TFR on the Rho-associated protein kinase (ROCK) and CSE/H2S signaling pathways remains unknown. In the present study, the protective effects of TFR as a ROCK inhibitor in a mice model of myocardial infarction induced by isoproterenol (ISO) were investigated, and the hearts from the wild type and CSE knockout (KO) mice were examined. It was identified that the CSE KO mice exhibited decreased levels of ST segment elevation following anoxia/reoxygenation damage, increased LDH and CK-MB levels, aggravated pathological damage, and increased ROCK1, ROCK2 and MLC1 protein levels. In the CSE KO mice, there were no marked changes of the above experimental results between the TFR group and the model group. These results suggested that TFR-based inhibition of the RhoA/ROCK signal pathway may be mediated by the CSE-H2S signalling pathway and may be a novel therapeutic target for myocardial ischemia injury. Copyright: © Jiao et al.

Entities:  

Keywords:  Rho-associated protein kinase; anoxia/reoxygenation; hydrogen sulfide; total flavones of Rhododendra flower

Year:  2019        PMID: 31611932      PMCID: PMC6781799          DOI: 10.3892/etm.2019.8004

Source DB:  PubMed          Journal:  Exp Ther Med        ISSN: 1792-0981            Impact factor:   2.447


Introduction

Hydrogen sulfide (H2S) is a highly dispersive gasotransmitter that affects cells and organs function through different mechanisms (1). H2S is increasingly being considered as an important signaling molecule in the cardiovascular systems (2,3). Endogenous production of H2S is primarily catalyzed by cystathionine β-synthase, cystathionine-γ-lyase (CSE) and 3-mercaptosulphurtransferase (4). Among them, CSE is the primary H2S-producing enzyme in cardiovascular tissues. The disordered metabolism and functions of the CSE/H2S pathway have been associated with several cardiovascular diseases, including A/R injury, hypertension, atherosclerosis and oxidative stress (5–9). Rho-associated protein kinase (ROCK), the best-characterized effector of the small G protein Rho, has been proposed to be potential targets in the therapy of cardiovascular diseases (10,11). Various studies have indicated that ROCK inhibitors prevent the progress of myocardial infarction by hemodilution, vascular dilation and inhibition of neutrophil accumulation (11–13). The useful effects of ROCK inhibition against A/R damage using the ROCK inhibitors fasudil and Y-27632 have been established (14,15). This suggests that ROCK serves a vital role in myocardial infarction. Total flavones of Rhododendra flower (TFR), an effective compound extracted from the Rhododendra flower, is comprised of flavones including quercetin, hyperin, rutin and other flavonoids (16,17). Our previous studies have indicated that TFR has significant protective effects against myocardial ischemic injuries in rat and mice models (18,19), and that the protective mechanism may be engaged with the inhibition of ROCK1 and ROCK2 and activation of the potassium channel (20). Certain previous studies have suggested that flavonoid compounds may prevent the RhoA/ROCK signal pathway by decreasing the contractility of vascular smooth muscle cells (21–23). In light of these data, the present study aimed to evaluate the cardiovascular protective effects of TFR as a ROCK inhibitor in a mice model of myocardial infarction induced by isoproterenol. The hearts from wild-type (WT) and CSE knockout (KO) mice were examined. During the process of myocardial ischemia-reperfusion injury, the effect of endogenous H2S on ROCK signaling pathways was explored, and the effect of TFR on the ROCK and CSE/H2S signaling pathways was investigated.

Materials and methods

Drugs and reagents

TFR (content of flavones >85%) was provided by Hefei Heyuan Medical Company Technology Co., Ltd. Isoprenaline (ISO) was produced by Shanghai Hefeng Pharmaceutical Co. Ltd. Lactate dehydrogenase (LDH, cat. no. A020-1-2) and creatinine kinase isoenzyme (CK-MB; cat. no. H197) assay kits were purchased from Nanjing Jiancheng Bioengineering Institute. Rabbit polyclonal primary antibodies against ROCK1 and ROCK2 were provided by EnoGene Biotech Co., Ltd. Membrane protein MLC1 (MLC1) was purchased from Santa Cruz Biotechnology, Inc.

Animal model

The present study was approved by the Ethics Committee for Animal Experiments of Anhui Medical University (no. 20160315). The CSE KO and wild-type mice (C57 strain) were produced by Shanghai Model Organisms Center. Wild-type and CSE KO mice (n=60; age, 10–16 weeks; weight, 18–24 g; half male and female) were used for the experiment (Fig. 1).
Figure 1.

Polymerase chain reaction identification of CSE gene expression in mice. Lanes 14, 17, 22 and 23, CSE knockout mice (309 bp). Lanes 16, 20 and 21, wild type mice (167 bp). Lanes 13, 15, 18, 19 and 24, heterozygous mice (two bands). CSE, cystathionine γ-lyase.

The present study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (NIH Publication, 8th edition, 2011) (24). WT and CSE KO mice (6 per group) were divided to 5 groups. ISO (0.002 mg/kg) was injected in mice. Group I served as control, with equal dose of normal saline. Myocardial infarction was induced in groups II–V by subcutaneous administration of ISO on the first, second and third days respectively. Group III–V received TFR orally (30, 60 or 120 mg/kg, respectively) once a day 5 min prior to the ISO for 3 days; group II received the equal dose of normal saline. The mice were anaesthetized by intraperitoneal injection of chloral hydrate (350 mg/kg). The mice were confirmed to be fully anaesthetized when the breathing rate decreased and breathing depth increased, and the righting reflex, and eyelid and tail-pinch reflexes were lost. At the end of protocol, mice were sacrificed by anesthesia using 2% isoflurane, which was then increased to 5%. Then, cardiac puncture was performed by a qualified technician. Following cardiac puncture, the mice were observed for respiratory and cardiac arrest, pupil dilation and disappearance of the pupillary light reflex. Following these observations, the mice were confirmed to be dead within 6–10 min.

PCR

Tail tissue was used. DNA polymerase was used (2× Premix Tag; Takara Bio; cat. no. RR902Q). RNA extraction buffer and supplier used was TRIzol Reagent from Thermo Fisher Scientific, Inc. (cat. no. 15596). The RT kit used was iScript gDNA Clear cDNA Synthesis kit from Bio-rad Laboratories, Inc. (cat. no. 1725035). DNA polymerase used and supplier sequences of the forward and reverse primers: P1: CCTGGATATAAGCGCCAAAG, P2: AGGAACCAGGGCGTATCTCT, P3: CGAGAATTCCATTGCTCAGG. Reverse transcription protocol was as follows: 94°C for 3 min, 94°C for 30 sec, 57°C for 30 sec, 72°C for 40 sec, 72°C for 10 min then 12°C. The length of the wild product was 167 bp and the length of the mutant product was 309 bp.

Determination of ST-segment elevation

Electrocardiograms (ECGs) recorded ST-segment elevation at 5, 10, 15, 20 and 60 min following the final injection of ISO or normal saline. ECGs were recorded under 30 mg/kg pentobarbital sodium anesthetization administered by intraperitoneal injection.using needle electrodes and a Biological Function Experiment System (Chengdu Thaimeng Technology Co. Ltd). The recorded original data were estimated by the commercial software included in the acquisition system (AqDAnalysis 7; Lynx Tecnologia Ltda.).

Measurement of LDH and CK-MB levels

The supernatant was centrifuged at 3,000 × g for 10 min at 4°C, the LDH and CK-MB levels were detected at 550 and 440 nm, respectively, by spectrophotometry according to the manufacturer's protocols of the assay kits. The experiment was repeated 3 times.

Histology

Left ventricular tissues were surgically removed, fixed in 10% buffered formalin at room temperature for 24 h, embedded in paraffin and sliced into 5-µm thick sections. The slides were stained with hematoxylin and eosin (H&E) for 5 min at room temperature and examined using a confocal microscope (magnification, ×400; Olympus BX51; Olympus Corporation). The Rona classification standard (25) was used to evaluate the degree of myocardial tissue damage.

Western blot analysis

The left ventricular tissues from the mice were removed and placed in ice-cold RIPA lysis buffer (Beyotime Institute of Biotechnology). Protein concentrations were determined using a BCA protein assay kit (Thermo Fisher Scientific, Inc.). Equal amounts of protein (50 µg) were separated on 10% polyacrylamide-Tris gels (Beyotime Institute of Biotechnology), transferred onto polyvinylidene difluoride membranes and blocked with 5% skim milk in TBST for 1 h at room temperature. Then, the membranes were incubated at 4°C overnight with rabbit polyclonal antibodies against ROCK1 (1:1,000; cat. no. E1A7016), ROCK2 (1:1,000; cat. no. E1A6028) or MLC1 (1:1,000; cat. no. SC-86740) or monoclonal antibody against ß-actin (Bioworld Technology, Inc.). Following incubation with an anti-rabbit second antibody (OriGene Technologies, Inc.; 1:10,000 dilution in 5% skim milk) for 1 h at room temperature, the immunocomplexes were visualized using an enhanced chemiluminescence detection kit (Thermo Fisher Scientific, Inc.). The intensity of the immunoreactive bands were quantified by using the ImageJ analysis software (v.1.8.0; National Institutes of Health).

Measurement of RhoA activity

To detect the activity of RhoA, left ventricular tissues from the mice were lysed with radioimmunoprecipitation assay lysis buffer and incubated with 50 µg of the Rhotekin-RBD beads, containing a Rho-GTPase binding domain, at 4°C for 1 h. The samples were then centrifuged at 5,000 × g at 4°C for 1 min and the supernatant was removed. The beads were removed following washing with wash buffer. The remaining bead pellets were boiled with 200 µl 2X Laemmli sample buffer (Bio-Rad Laboratories, Inc.) at 85°C for 5 min. Then, RhoA activity levels were determined using commercially available absorbance-based G-LISA RhoA activation assay kits (cat. no. BK 036-S; Cytoskeleton, Inc.). The left ventricular tissues were homogenized in lysis buffer (Beyotime Institute of Biotechnology, Haimen, China) and the protein concentrated according to the manufacturer's protocol. following indirect immunodetection, RhoA activities were detected by measuring absorbance at 490 nm using a microplate spectrophotometer.

Statistical analysis

Data are expressed as means ± standard deviation, and differences between groups were analyzed by SPSS v15.0 (SPSS, Inc.). Statistical analyses were performed with one-way analysis of variance followed by the Duncan post-hoc test to determine the differences between groups. P<0.05 was considered to indicate a statistically significant difference. The statistical analysis of pathology ranking data was performed using a Kruskal-Wallis H test. To determine the differences between 5 groups, the Bonferroni method was used. The difference between the WT and KO groups was analyzed using a Student's t-test for paired design analysis. P<0.005 was considered to indicate a statistically significant difference.

Results

Effect of TFR on ST-segment elevation

The ST segment of ECG in the model group of the wild type (WT) mice increased significantly at 5, 10, 15, 20 and 60 min after the final injection of ISO compared with the sham group (P<0.01; Figs. 2 and 3). Administration of 60 mg/kg TFR markedly decreased ST-segment elevation compared with the WT model group (P<0.05; Table I) and 120 mg/kg TFR markedly decreased ST-segment elevation compared with the WT model group (P<0.01; Table I).
Figure 2.

Effect of total flavones of Rhododendra flower on ST-segment elevation following ISO injection. Standard lead II of the ECG was recorded at 5, 10, 15, 20 and 60 min following the final injection of ISO. All values are presented the mean ± standard deviation. ISO, isoproterenol; WT, wild type; KO, knockout.

Figure 3.

Effect of TFR on the changes of ST segment (mV) of ECG following subcutaneous isoproterenol injury in CSE WT and knockout mice. Data are presented as mean ± standard deviation (n=6). **P<0.01 vs. sham group. ##P<0.01 vs. model group. &P<0.05 vs. WT TFR group. TFR, total flavones of Rhododendra flower; CSE, cystathionine γ-lyase; WT, wild type; KO, knockout.

Table I.

Effect of TFR on the changes of ST segment (mV) of ECG in the CSE WT and KO mice.

A, WT group

Time intervals, min

Treatment groups510152060
Control (n=6)0.01±0.010.01±0.010.01±0.010.01±0.010.01±0.01
Model (n=6)0.25±0.12[a]0.25±0.14[a]0.24±0.14[a]0.25±0.15[a]0.24±0.14[a]
TFR, mg/kg (n=6)
  300.19±0.140.19±0.120.19±0.140.20±0.140.21±0.13
  600.12±0.11[b]0.13±0.11[b]0.13±0.12[b]0.16±0.12[b]0.16±0.13[b]
  1200.09±0.04[c]0.10±0.05[c]0.10±0.05[c]0.11±0.06[c]0.11±0.08[c]

B, KO group

Time intervals, min

Treatment groups510152060

Control (n=6)0.01±0.010.01±0.010.01±0.010.01±0.010.01±0.01
Model (n=6)0.32±0.18[a]0.33±0.19[a]0.34±0.20[a]0.34±0.18[a]0.33±0.19[a]
TFR, mg/kg (n=6)
  300.28±0.190.30±0.190.27±0.180.28±0.200.27±0.18
  600.26±0.170.26±0.160.27±0.180.26±0.150.26±0.15
  1200.22±0.10[d]0.23±0.11[d]0.23±0.10[d]0.22±0.09[d]0.21±0.10[d]

Data are presented as the mean ± standard deviation.

P<0.01 vs. sham

P<0.05 vs. model

P<0.01 vs. model

P<0.05 vs. WT TFR.

The ST segment of ECG in the KO mice model group rose significantly at 5, 10, 15, 20 and 60 min following the final injection of ISO compared with the sham group (P<0.01; Figs. 2 and 3). However, no significant differences in the ST-segment elevation were observed following the administration of 30 and 60 mg/kg TFR compared with the model group in the KO mice (P>0.05), but the group of 120 mg/kg TFR was significant decreased compared with WT TFR group (P<0.05; Figs. 2 and 3; Table I). In order to compare the elevations of the ST segments between the WT and KO mice more clearly, ST segment elevation was recorded at 5 min after the injection of ISO. The decrease in ST segment elevation in the TFR group in comparison with the model group was observed to be greater in the WT mice compared with the KO mice (P<0.05; Fig. 3).

Effect of TFR on the LDH and CK-MB level

Levels of LDH and CK-MB in the plasma supernatant are major indicators of myocardial anoxia/reoxygenation (A/R) injury. A few increases of LDH and CK-MB level were detected in A/R group of the WT mice (P<0.01). Treatment with 60 mg/kg TFR markedly inhibited the A/R-induced increases of LDH and CK-MB level in the plasma supernatant of the WT mice (P<0.01; Figs. 4 and 5).
Figure 4.

Effects of TFR treatment on increases in serum LDH levels in anoxia/reoxygenation-injured CSE KO mice. Data are presented as mean ± standard deviation (n=6). **P<0.01 vs. sham group. ##P<0.01 vs. model group. $$P<0.01 vs. WT model. &&P<0.01 vs. WT TFR group. TFR, total flavones of Rhododendra flower; LDH, lactate dehydrogenase; CSE, cystathionine γ-lyase; WT, wild type; KO, knockout.

Figure 5.

Effects of TFR on increases in serum CK-MB levels in anoxia/reoxygenation-injured CSE KO mice. Data are presented as mean ± standard deviation (n=6). **P<0.01 vs. sham group. ##P<0.01 vs. model group. $$P<0.01 vs. WT model. &&P<0.01 vs. WT TFR group. TFR, total flavones of Rhododendra flower; CK-MB, creatinine kinase isoenzyme; CSE, cystathionine γ-lyase; WT, wild type; KO, knockout.

Significant increases in LDH and CK-MB levels were detected in the A/R model group of the KO mice (P<0.01), and the LDH and CK-MB levels were increased significantly in A/R model group of the WT mice compared with the KO mice (P<0.01). Treatment with 60 mg/kg TFR had no effect of the A/R-induced increases in LDH and CK-MB level in the plasma supernatant of the KO mice (P>0.05). However, the LDH and CK-MB levels of the TFR group of the KO mice were significantly increased compared with those in the TFR group of the WT mice (Figs. 4 and 5).

Pathological observations

Analysis of the myocardium in the sham group in the WT mice population revealed a normal myofibrillar structure with stripes, branched appearance, and connections with adjacent myofibrils. In the mice treated with A/R, disorganized myocardium structure and loss of attachment between cardiomyocytes was observed. Tissues from the A/R mice exhibited obvious myocardial cell hypertrophy, cytopathy, loss of transverse striations and occasional cytoplasmic vacuolization. The TFR groups exhibited less severe histological damage, normal myocardial arrangement, clear transverse striations and fewer inflammatory cells. The architecture of the myocardium was intact with erratic myofiber array in the sham group of the KO mice. Tissue from the A/R group of the KO mice revealed severely focal necrosis, myocardial cytopathy, loss of striations, severe infiltration of inflammatory cells and cytoplasmic vacuolization. Compared with this group, tissues from the A/R group of the WT mice population revealed less severe histological damage. In addition, the tissue sections from the TFR group of the KO mice demonstrated myocardial cell swelling, indistinct transverse striations and inflammatory cell infiltration. There were no marked differences in the pathological changes of 120 mg/kg TFR group of the KO mice compared with the A/R group of the same KO mice population (Fig. 6).
Figure 6.

Histopathological observation of myocardium from WT and KO mice in an anoxia/reoxygenation model using hematoxylin and eosin staining. Magnification, ×400. CSE, cystathionine γ-lyase; WT, wild type; KO, knockout; TFR, total flavones of Rhododendra flower.

The pathological grades of myocardium from each group are presented in Table II. The level of significance was corrected as P-value of comparisons between different groups, when several comparisons were performed between groups. Analysis of the data demonstrated that there were significantly improvements in the pathological grades between the TFR and sham groups in the WT mice population (P<0.001). In addition, there were no significant changes between the TFR and sham groups in the KO mice population. Using a Z-test, it was demonstrated that there were significant improvements in the pathological changes of the 60 or 120 mg/kg TFR groups of the WT mice than the 60 or 120 mg/kg TFR groups of the KO mice (P<0.005). The results of Kruskal-Wallis H test in the WT and KO groups were χ2=24.310 (P<0.001) and χ2=21.858 (P<0.001), respectively (Table II).
Table II.

Pathological grades of cardiomyocytes in CSE WT and KO mice.

A, (WT group), CSE (+/+)

Pathological grades, n

Treatment group0IIIIIIIVP-value
Sham60000
Model00033<0.005[a]
TFR, mg/kg
  3000231<0.005[a]
  6003210<0.005[a],<0.005[b]
  12004200<0.005[a],<0.005[b]

B, (KO group), CSE (−/-)

Pathological grades

Treatment group0IIIIIIIVP-value

Sham60000
Model00024<0.005[a]
TFR, mg/kg
  3000132<0.005[a]
  6001230<0.005[a]
  12002220<0.005[a]

n=6.

P<0.005 vs. Sham group.

P<0.005 vs. Model group. Kruskal-Wallis H test showed that the difference of pathological grades among the 5 groups of WT mice were statistical significance (χ2=24.310, P<0.001), the difference of Pathological grades among the 5 groups of KO mice were statistical significance (χ2=21.858, P<0.001).

Effect of TFR on ROCKs protein expression

The expression levels of ROCK1 and ROCK2 proteins were examined in each group (Fig. 7A), and were quantified by using densitometric analysis (Fig. 7B and C). Exposure to A/R markedly increased both ROCK1 and ROCK2 protein levels in the WT mice (P<0.01). The increases of ROCK1 and ROCK2 were markedly inhibited by treatment with 60 mg/kg TFR (P<0.01). Exposure to A/R significantly increased ROCK1 and ROCK2 protein levels in the KO mice (P<0.01). The increases of ROCK1 and ROCK2 were not markedly altered by treatment with 60 mg/kg TFR group of the KO mice compared with the A/R group of the KO mice. The results indicated that TFR treatment inhibited the expression of the ROCK proteins associated with the CSE/H2S pathway.
Figure 7.

(A-C) Effect of TFR on the expression of ROCK1 and ROCK2 protein in isoproterenol-treated mice myocardium. **P<0.01 vs. sham group. ##P<0.05 vs. model group. TFR, total flavones of Rhododendra flower; CSE, cystathionine γ-lyase; ROCK, Rho-associated protein kinase.

The expression levels of MLC1 proteins were determined in each group (Fig. 8A), and levels of MLC1 proteins were quantified using densitometry (Fig. 8B). Exposure to A/R markedly increased MLC1 protein levels compared with the sham group in the WT mice (P<0.01). In addition, the increases of MLC1 were markedly inhibited by 60 mg/kg TFR compared with the A/R group of the WT mice (P<0.01). Exposure to A/R apparently increased MLC1 protein levels compared with the sham group of the KO mice (P<0.01). In the KO mice population, the inhibitory effect of TFR on the increased expression of MLC1 protein was significantly decreased compared with the TFR group of the WT mice population. These data demonstrated the TFR inhibited the expression of the MLC1 protein associated with the CSE/H2S pathway.
Figure 8.

(A and B) Effect of TFR on the expression of MLC1 protein in isoproterenol-treated mice myocardium. **P<0.01 vs. sham group. ##P<0.05 vs. model group. TFR, total flavones of Rhododendra flower; CSE, cystathionine γ-lyase; MLC1, membrane protein MCL1.

Effect of TFR on RhoA activity

RhoA activity in the left ventricular tissues was detected using an absorbance-based G-LISA RhoA activation assay. As demonstrated in Fig. 9, RhoA activity in the model group (0.41±0.11) was significantly increased compared with that in the sham group (0.18±0.05) (P<0.01). In comparison with the model group, treatment with 60 mg/kg TFR markedly inhibited the increase in RhoA activity, which was decreased to 0.25±0.08 (P<0.01; Fig. 9).
Figure 9.

Effect of TFR on RhoA activity following A/R injury. **P<0.01 vs. sham. ##P<0.01 vs. model. &&P<0.01 vs. wild type TFR. TFR, total flavones of Rhododendra flower; CSE, cystathionine γ-lyase.

Significant increases of RhoA activity were detected in the model group of KO mice (0.8±0.09) compared with the sham group (0.34±0.09) (P<0.01). In addition, the RhoA activity was increased significantly in the model group of KO mice compared with that in the WT mice (P<0.01). Compared with the model group, treatment with 60 mg/kg TFR had no effect on A/R-induced increases in RhoA activity of the KO mice (0.71±0.11) (P>0.05). However, in the KO mice, the RhoA activity of the TFR group was significantly increased compared with the TFR group of the WT mice (P<0.01; Fig. 9).

Discussion

ISO is a synthetic β-adrenergic agonist that may cause serious stress in the cardiac muscle and necrosis of myocardium. Therefore, in the present study, ISO was used to induce acute myocardial ischemia. The acute myocardial ischemia caused by ISO was confirmed by loss of integrity of myocardial membranes on histological changes, increased ST segment elevation, and increased serum levels of LDH and CK-MB. In the present study, TFR treatment decreased the ST-segment elevation induced by ISO; TFR also decreased LDH and CK-MB levels in the serum. TFR treatment resulted in significant improvements in the pathological changes caused by hypoxia injury. The increases in expression levels of ROCK1, ROCK2 and MLC1 induced by the ISO were markedly inhibited by TFR treatment. These results suggested that TFR had cardioprotective effects in myocardial ischemia that may be attributed to the inhibition of the RhoA/ROCK signal pathway. In the CSE KO mice, the ST-segment elevation induced by ISO was significantly increased compared with the WT mice. CSE KO mice also demonstrated increased LDH and CK-MB levels in the serum compared with the WT mice. CSE KO mice exhibited more severe pathological changes as a result of hypoxia injury compared with the WT mice, suggesting that H2S was involved in the pathological process of myocardial ischemic injury. It was also observed that the expression levels of ROCK1, ROCK2 and MLC1 induced by ISO in the KO mice were markedly increased compared with the WT mice. These results suggested that CSE KO led to the decrease in H2S expression and activation of the RhoA/ROCK signal pathway, which may have aggravated the myocardial ischemic injury. H2S has protective effects against A/R injury in mice heart tissues by preventing the RhoA/ROCK signal pathway (20,26). TFR inhibition of the RhoA/ROCK signal pathway may be mediated by the CSE-H2S pathway. The study by Zhang et al (20) indicated that the cardioprotection afforded by TFR treatment involved the stimulation of nitric oxide release and the inhibition of lipid peroxidation. Increasing evidence has suggested that the RhoA/ROCK pathway serves an important role in the A/R damage, vascular smooth muscle cell proliferation, cardiac hypertrophy, heart failure and ventricular remodeling (27,28). Development of hypertension and myocardial infarction (MI); the two primary drivers of cardiovascular disease are associated with cardiac ROCK activation and phosphorylation of ROCK target proteins (29). ROCK inhibitors have a beneficial effect in attenuating hypertension and MI associated with ROCK activation (30). In addition, inhibition of the ROCK pathway may have a protective effect on cardiovascular function; the inhibitory agents Y27632 or fasudil were demonstrated to limit infarct size, alleviate the A/R damage, decrease the release of the MDA and LDH and promote the recovery of myocardial function following ischemia (31,32). During agonist-induced vascular smooth muscle cell (VSMC) contraction, MLC phosphorylation is a crucial step for force development. ROCK, when activated by the small GTPase RhoA, inhibits MLC phosphatase (MLCP) activity by phosphorylating its myosin-binding subunit, thereby serving a key role in agonist-induced Ca2+ sensitization and VSMC hypercontraction (33). The major regulatory mechanism of smooth muscle contraction is the phosphorylation/dephosphorylation of MLC (34). MLC is phosphorylated by the Ca2+-calmodulin-activated MLC kinase (MLCK) and dephosphorylated by the Ca2+-independent MLCP. Therefore, a rise in cytosolic Ca2+ concentration produces smooth muscle contraction via the activation of MLCK and consequent phosphorylation of MLC (10). Hyperin is the primary active ingredient of TFR; it inhibits the contraction of the rabbit cardiac papillary muscle (35). In the present study, the increases of ROCK1, ROCK2 and MLC1 induced by ISO were markedly inhibited by TFR treatment. These results suggested that TFR had cardioprotective effects in myocardial ischemia that may be attributed to the inhibition of the RhoA/ROCK signal pathway. Endogenous H2S has been suggested as a novel signal transmitter and neuromodulator (36). In recent years, growing evidence has demonstrated that H2S is a critical mediator of heart functions and serves a protective function in the pathogenesis and progress of heart diseases. Geng et al (37) identified that the CSE/H2S pathway exists in the heart and has physiological effects such as negative inotropy and reduced central venous pressure. NaHS significantly decreased the infarct size of the left ventricle and mortality after acute MI in rats (38). In an additional study, sulfur dioxide (SO2) preconditioning significantly decreased A/R induced myocardial injury in vivo, which is associated with increased myocardial antioxidative capacity and upregulated H2S/CSE pathway (39). It also has been revealed to protect against hyperglycemia-induced ROS-mediated apoptosis by upregulating the PI3K/AKT/nuclear factor erythroid 2-related factor 2 (Nrf2) pathway, which subsequently activates Nrf2-regulated antioxidant enzymes in cardiomyocytes exposed to high glucose (40). However, the association between H2S and the RhoA/ROCK signaling pathway remains unknown. In the present study, it was identified that TFR-mediated inhibition of the RhoA/ROCK signal pathway may have been mediated by the CSE-H2S axis. These results suggested that TFR exhibited cardioprotective effects in myocardial ischemia that may be attributed to an inhibition of the RhoA/ROCK signal pathway. The expression levels of ROCK1, ROCK2 and MLC1 induced by ISO in the KO mice were markedly increased compared with the WT mice. These results suggested that CSE KO led to decreased H2S expression and activation of the RhoA/ROCK signal pathway and that H2S had protective effects against A/R injury in mice hearts by inhibiting the RhoA/ROCK signal pathway. In the present study, accompanying the pathophysiological process of ISO-induced myocardial injury was the impaired endogenous CSE/H2S pathway. Administering exogenous H2S resulted in effective protection of the myocytes and contractile activity by directly scavenging oxygen free radicals and decreasing the accumulation of lipid peroxidations. These results suggest that H2S not only alleviated the pathological process of ischemic heart disease but may also serve as a cardiovascular protective regulator, and as a novel target in the prevention or treatment of cardiovascular diseases. TFR exhibited protective effects against A/R injury in mice hearts by inhibiting the RhoA/ROCK signal pathway and may have been mediated by the CSE-H2S.
  38 in total

1.  Rho kinase activation plays a major role as a mediator of irreversible injury in reperfused myocardium.

Authors:  Shabaz A Hamid; Hugo S Bower; Gary F Baxter
Journal:  Am J Physiol Heart Circ Physiol       Date:  2007-01-12       Impact factor: 4.733

2.  Effects of fasudil, a Rho-kinase inhibitor, on myocardial preconditioning in anesthetized rats.

Authors:  Seniz Demiryürek; Ali F Kara; Ahmet Celik; Aydan Babül; Mehmet Tarakçioglu; Abdullah T Demiryürek
Journal:  Eur J Pharmacol       Date:  2005-11-22       Impact factor: 4.432

Review 3.  2015 ATVB Plenary Lecture: translational research on rho-kinase in cardiovascular medicine.

Authors:  Hiroaki Shimokawa; Kimio Satoh
Journal:  Arterioscler Thromb Vasc Biol       Date:  2015-06-11       Impact factor: 8.311

Review 4.  Jak/STAT/SOCS signaling circuits and associated cytokine-mediated inflammation and hypertrophy in the heart.

Authors:  Andrew M Terrell; Paul R Crisostomo; George M Wairiuko; Meijing Wang; Eric D Morrell; Daniel R Meldrum
Journal:  Shock       Date:  2006-09       Impact factor: 3.454

5.  Increased neointimal formation in cystathionine gamma-lyase deficient mice: role of hydrogen sulfide in α5β1-integrin and matrix metalloproteinase-2 expression in smooth muscle cells.

Authors:  Guangdong Yang; Hongzhu Li; Guanghua Tang; Lingyun Wu; Kexin Zhao; Qiuhui Cao; Changqing Xu; Rui Wang
Journal:  J Mol Cell Cardiol       Date:  2011-12-19       Impact factor: 5.000

6.  Hydrogen sulfide and its possible roles in myocardial ischemia in experimental rats.

Authors:  Yi Zhun Zhu; Zhong Jing Wang; Peiying Ho; Yoke Yun Loke; Yi Chun Zhu; Shan Hong Huang; Chee Sin Tan; Matt Whiteman; Jia Lu; Philip K Moore
Journal:  J Appl Physiol (1985)       Date:  2006-10-12

7.  H2S generated by heart in rat and its effects on cardiac function.

Authors:  Bin Geng; Jinghui Yang; Yongfen Qi; Jing Zhao; Yongzheng Pang; Junbao Du; Chaoshu Tang
Journal:  Biochem Biophys Res Commun       Date:  2004-01-09       Impact factor: 3.575

8.  Inhibition of the activity of Rho-kinase reduces cardiomyocyte apoptosis in heart ischemia/reperfusion via suppressing JNK-mediated AIF translocation.

Authors:  Juan Zhang; Xiao-Xing Li; Hong-Jun Bian; Xiao-Bo Liu; Xiao-Ping Ji; Yun Zhang
Journal:  Clin Chim Acta       Date:  2008-11-24       Impact factor: 3.786

9.  Protective Effect and Mechanism of Total Flavones from Rhododendron simsii Planch Flower on Cultured Rat Cardiomyocytes with Anoxia and Reoxygenation.

Authors:  Yi Jiao; Yi-Fei Fan; Yu-Ling Wang; Jun-Yan Zhang; Shuo Chen; Zhi-Wu Chen
Journal:  Evid Based Complement Alternat Med       Date:  2015-03-10       Impact factor: 2.629

10.  Fasudil protects the heart against ischemia-reperfusion injury by attenuating endoplasmic reticulum stress and modulating SERCA activity: the differential role for PI3K/Akt and JAK2/STAT3 signaling pathways.

Authors:  Yapeng Li; Wei Zhu; Jianping Tao; Ping Xin; Mingya Liu; Jingbo Li; Meng Wei
Journal:  PLoS One       Date:  2012-10-31       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.