| Literature DB >> 31611859 |
Constanze Pinske1, Claudia Thomas1, Kerstin Nutschan1, R Gary Sawers1.
Abstract
The active site of all [NiFe]-Entities:
Keywords: Hyp proteins; hydrogenase; large-subunit precursor; maturation; protease; protein interaction
Year: 2019 PMID: 31611859 PMCID: PMC6769069 DOI: 10.3389/fmicb.2019.02223
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Figure 1Schematic representation of the HybC large subunit variants. (A) The amino acid sequences in single-letter code of the C-terminal 30 residues of the large subunit pro-HybC and pro-HyaB precursors are shown. Identical amino acids are shown in green, the + indicates similar amino acids and the residues depicted in red signify those exchanged in this study. The vertical arrow indicates the site of endoproteolytic cleavage and the red asterisks signify the conserved Cys-3 and Cys-4 residues involved in coordinating the Ni-Fe-cofactor. (B) The HybC variants used in this study (not drawn to scale) are shown, as is the location of the sequence represented in part (A). N and C represent N- and C-terminus of the polypeptides, respectively. The thin red bar indicates that A and V were changed to S and T, and the blue rectangle signifies that the 15-amino acid extension (after the cleavage site) from pro-HyaB replaced the native oligopeptide. The red asterisks depict the approximate locations of the four conserved Cys residues (1–4) that coordinate the NiFe-cofactor. (C) The structural organization of the Cys-1 through Cys-4 and how they coordinate the NiFe(CN)2CO group in HybC (Beaton et al., 2018) is shown for the reduced enzyme (6EHS). The representation was generated using PyMOL. The green sphere represents the nickel and the large brown sphere the iron ion, where the cyanyl (black and blue spheres) and carbonyl (black and red spheres) ligands are coordinated.
Strains and plasmids used in this study.
| Strain or plasmid | Relevant genotype or characteristic(s) | Reference or source |
|---|---|---|
| BTH101 | F−, |
|
| MC4100 | F−
|
|
| FTD150 | As MC4100, but Δ |
|
| CB16 | As FTD150, but |
|
| CB17 | As FTD150, but | This study |
| CB18 | As FTD150, but | This study |
| CB19 | As FTD150, but | This study |
| pASK-hybC |
| |
| pASK-hybCproc | pASK-hybC, V553 Stop (codon 553 converted to TAA), AmpR |
|
| pASK-hybChyaB |
| |
| pASK-hybCST | This study | |
| pASK-hybChyaBST | This study | |
| pASK-hybG |
| |
| pCB-hybC | pCAN-hybC ( | This study |
| pCB-hybCproc | pCAN-hybC with a TAA at codon 553 (GTA → TAA) in | This study |
| pUT18 | Bacterial two hybrid plasmid expressing the T18 fragment and a MCS at the 5′ end of T18, AmpR |
|
| pKT25 | Bacterial two hybrid plasmid expressing the T25 fragment and a MCS at the 3′ end of T25, CmR |
|
| pT18-zip | pUT18, Leucine zipper fused to T18 fragment (225-399 amino acids of CyaA) |
|
| pT25-zip | pKT25, Leucine zipper fused to T25 fragment (1-224 amino acids of CyaA) |
|
| pT18-hybD | pUT18, | This study |
| pT25-hybC | pKT25, | This study |
| pT25-hybC§ | pKT25, | This study |
| pT25-hybCST | pKT25, | This study |
| pT25-hybC§ST | pKT25, | This study |
| pT25-hyaB | pKT25, | This study |
| pT25-hyaB§ | pKT25, | This study |
| pT-hypC | pT7–7 |
|
Oligonucleotides used in this study.
| Oligonucleotide | Sequence 5′ → 3′ |
|---|---|
| wtHybC_AV>ST_FW | CATGGCCTGTTCAACACACGTAGTGGATG |
| HybC/HyaB_AV>ST_FW | CATGGCCTGTTCAACACACGTGCTGG |
| HybC_AV>ST_RW | CACGGGTCAAAGGAGTGA |
| HyaB_FW_PstI | GCGCTGCAGGGAGCACTCAGTACGAAACTC |
| HyaB_RW_BamHI | GCGGGATCCTTAACGCACCTGCACGGAGATC |
| HybC_FW_PstI | GCGCTGCAGGGAGCCAGAGAATTACTATTG |
| HybC_RW_BamHI | GCGGGATCCTTACAGAACCTTCACTGAAAC |
| HybD_FW_HindIII | GCGAAGCTTATGCGTATTTTAGTCTTAGG |
| HybD_RW_EcoRI | GCGGAATTCGAGTCATGAATCGCCTCCCGTG |
Figure 2Hyd-2 enzyme activity profiles of the different HybC variants. Activity-stained native polyacrylamide gels are shown after anaerobic growth of the indicated strains in minimal-glucose medium (see Section “Materials and Methods” for details). The locations of the respective H2-oxidizing enzyme complexes are indicated on the left of each panel. Each panel has a positive control (wild type = MC4100) and a negative control (FTD150 ΔhyaB, hybC, hycE, and ΔhyfB-R). The four lanes on the right of each panel represent the gene products encoded by the corresponding plasmids introduced into FTD150 (panel A), CB18 (ΔhybG; panel B), CB19 (ΔhypC; panel C), CB17 (ΔhybD; panel D), or CB16 (ΔhyaD; panel E). All other genes necessary for synthesis of an active Hyd-2 enzyme are present in each strain, except in strains CB17 and CB18. Note that in panel (A), the extract derived from MC4100 was run on a separate gel, as was the final lane in panel (E). These experiments were repeated on minimally three separate occasions.
Figure 3All four HybC variants interact with the endoprotease HybD. The histograms show the β-galactosidase enzyme activities of strain BTH101 carrying plasmids encoding T25 fusions of the indicated hydrogenase variants as well as T18 fused with HybD (see Section “Materials and Methods” for details). “Vector” shows the activity of the strain carrying empty vectors pUT18 and pKT25, while “Zip” shows the activity of the strain carrying the positive controls pT25-zip and pT18-zip (Karimova et al., 1998). Each histogram shows the mean plus standard deviation of the biological replicates, each performed in triplicate.
Figure 4Different conformations of immature pro-HybC and mature HybCproc revealed by limited proteolysis. Aliquots (100 μg protein) of purified His-tagged pro-HybC or HybCproc were incubated at 37°C with 1 μg of trypsin (A) or chymotrypsin (B) and samples were removed at the indicated time points and separated in 10% (w/v) SDS-PAGE for (A), or 12.5% (w/v) SDS-PAGE for (B). After electrophoresis, the gels were stained with Coomassie Brilliant Blue. U, untreated, purified polypeptide. Molecular mass standards are shown in kDa. Limited proteolysis experiments were performed three times for each protease.
Figure 5HybG protects pro-HybC against proteolytic attack by trypsin. The experiment shown in part (A) of Figure 4 was repeated under the same conditions but pro-HybC was incubated with 50 μg of either HypC (A) or HybG (B) prior to addition of trypsin. The migration positions of pro-HybC, HypC, and HybG are indicated on the right of the figure. Limited proteolysis experiments were performed three times.