Chronic heart failure is a complex disease caused by structural abnormalities, functional disorders, metabolic disturbance and/or drug stimulation (1–4). Chronic heart failure is the ultimate clinical manifestation of various cardiovascular and inflammatory diseases (5–7). Reports have indicated that chronic heart failure is one of the leading causes of disability and mortality in patients with heart disease worldwide (8–13). Chronic heart failure impairs myocardial energy metabolism, which leads to cardiac dysfunction and damages the circulation (14–16). Despite great advances in prevention and treatment of cardiovascular diseases in current medicine, chronic heart failure remains a therapeutic challenge as no effective treatments are available yet, with the exception of orthotopic heart transplantation (17–19).Puerarin, which is extracted from P. montana var. lobata, which exhibits therapeutic efficacy for a range of human diseases (20–22). Duan et al (23) demonstrated that puerarin may improve heart function and increase left ventricular ejection fraction. He et al (24) reported that puerarin promotes angiogenic signaling, improved myocardial microcirculation and downregulated the endothelin system, which results in a reversal of aberrant SERCA2a and phospholamban expression. In addition, puerarin has multiple therapeutic effects for neurological dysfunction and inflammation (25). A previous study has provided compelling evidence that puerarin serves a role in inhibiting myocyte loss during heart failure partly through ferroptosis mitigation, which suggests a new mechanism for puerarin as a potential therapeutic agent for heart failure (26). However, the antiapoptotic and anti-inflammatory effects of puerarin on myocardial cells in patients with chronic heart failure are not well understood.A previous study demonstrated that peroxisome proliferator-activated receptor a (PPARα) may be involved in the apoptosis of myocardial tissue in chronic heart failure (27). In addition, puerarin may improve the clinical heart function, increase the left ventricular ejection and decrease the level of oxidized low-density lipoprotein (23). In the present study, the antiapoptotic and anti-inflammatory efficacy of puerarin was investigated in rats with chronic heart failure. The potential mechanism of puerarin activity in myocardial cells from rats with chronic heart failure was also explored.
Materials and methods
Animals
A total of 30 male Sprague Dawley rats (age, 8–10 weeks; weight, 180–210 g) were purchased from the Experimental Animal Center of Tianjin University. The rats were housed at 24–26°C, 50% humidity with a 12-h light/dark cycle and ad libitum access to food and water. The experiments performed in this study were approved by the Animal Ethics Committee of Tianjin Chest Hospital (Tianjin, China). Rats were anaesthetized by intraperitoneal injection of pentobarbital (35 mg/kg), and chronic heart failure model was established as previously described (28). Following a 1-week adaptation period, the rats were randomly divided into three groups: PBS, puerarin and sham group (subjected to surgery without traverse aortic constriction) (n=10 rats/group). Rats with chronic heart failure received an intraperitoneal injection of puerarin (60 mg/kg; 99.0% purity; Beijing Saisheng Pharmaceutical Co., Ltd.) (29) or an equal volume of PBS (Sigma-Aldrich; Merck KGaA) once a day for 4 weeks. During the same 4-week period, rats in the sham group did not receive any treatments. Humane end points of experimental rats were set according to the OECD Guidance Document on the Recognition, Assessment, and Use of Clinical Signs as Humane End points for Experimental Animals Used in Safety Evaluation (30). Body weight was recorded for each rat on day 30 after treatment. Animals exhibiting signs of humane endpoints were sacrificed.
Cell culture
Myocardial cells were isolated from the rats in each group as described previously (31). Briefly, rats were decapitated after anesthesia (thiopental, 30 mg/kg IV) on day 30. The hearts were removed and placed into a plate using sterile scissors. Myocardial tissues were isolated and settled in Hank's Balanced Salt Solution (Gibco; Thermo Fisher Scientific, Inc.). Myocardial tissues were mechanically stirred and trypsinized with 0.5% trypsin at 37°C for 10 min, followed by centrifugation (6,000 × g for 15 min at 4°C) and suspension with DMEM (Gibco, Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco, Thermo Fisher Scientific, Inc.). Following cell attachment, the medium was replaced with DMEM supplemented with 0.5 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (all from Gibco; Thermo Fisher Scientific, Inc.). Myocardial cells were cultured for three days at 37°C in a 5% CO2 incubator. Following culture, the cells were treated with puerarin (2 mmol/l) or PBS for 12 h at 37°C prior to further analysis.
Knockdown of PPARα
Transient knockdown of PPARα was performed using the TranslT-X2 Dynamic Delivery System (Mirus Bio, LLC). In brief, myocardial cells (1×105 cells/well) were plated in six-well plates and cultured for 12 h at 37°C. Following incubation, 25 mM PPARα siRNA (si-PPARα) or siRNA-negative control (si-NC; both supplied by Shanghai GenePharma Co., Ltd.) were transfected into myocardial cells using TranslT-X2 reagent (25 µl) according to the manufacturer's instructions. The sequences of siRNAs were as follow: si-PPARα sense, 5′-AGAGCUACUUUUGUCCGATT-3′ and antisense, 5′-UCCGACAAAAGUUUCCACUCG-3′; si-NC sense, 5′-UUCUCGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′. Following incubation for 72 h, the expression of PPARα in myocardial cells was analyzed using western blotting. Subsequently, PPARα-knockdown myocardial cells were treated with puerarin (2 mmol/l) for 12 h at 37°C for further analysis.
Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay
Apoptotic rates of myocardial tissue or myocardial cells were analyzed using TUNEL assay (DeadEnd™ Colorimetric Tunel System; Promega Corporation) according to the manufacturer's instructions. For myocardial tissues, tissues were fixed with 5% paraformaldehyde for 12 h at room temperature. 5-µm-thick sections were fixed with 4% paraformaldehyde for 30 min at 37°C and dehydrated in gradient concentrations of ethanol. Tissue sections or myocardial cells (1×104 cells/well) were incubated with TUNEL reagent for 30 min at 37°C. Cells were washed with PBS three times for 5 min at 37°C, followed by incubation with 5% DAPI (Sigma-Aldrich; Merck KGaA) for 15 min at 37°C. Images were captured using a ZEISS LSM 510 confocal microscope using 488 nm excitation fixed in Antifade Mounting Medium. The apoptotic rate was calculated using the Developer XD 1.2 software (Definiens AG).
ELISA
A total of 2 ml peripheral venous blood was obtained from experimental rats after 4 weeks of treatment. Serum was obtained following centrifugation (6,000 × g; 15 min at 4°C). C reactive protein (CRP; cat. no. MCRP00; Bio-Rad Laboratories, Inc.), TNF-α (cat. no. RTA00; Bio-Rad Laboratories, Inc.), IL-6 (cat. no. R6000B; Bio-Rad Laboratories, Inc.), IL-1β (cat. no. DY501; Bio-Rad Laboratories, Inc.), brain natriuretic peptide (BNP; cat. no. MA134237; Thermo Fisher Scientific, Inc.), creatinine (cat. no. KGE005; R&D Systems, Inc.) and troponin T (cat. no. MAB1874; R&D Systems, Inc.) levels were analyzed using ELISA kits according to the manufacturers' instructions.
Determination of cardiac function
Following 4 weeks of treatment, the rats were anesthetized by intraperitoneal injection of pentobarbital (35 mg/kg). Ejection fraction (EF), heart rate (HR), fractional shortening (FS) and cardiac output (CO) in experimental rats were measured using a Vivid I ultrasound (GE Healthcare) equipped with a 12-MHz linear transducer.
Determination of lactate dehydrogenase (LDH) and succinate dehydrogenase (SDH) in serum
Serum was separated from peripheral venous blood as described above. LDH (cat. no. 10127230001; Roche Applied Science) and SDH (cat. no. 10109339001; Roche Applied Science) levels were measured using ELISA kits according to the manufacturer's instructions as previously described (32).
Immunohistochemistry
Myocardial tissues from the experimental rats were fixed with 10% formaldehyde for 1 h at room temperature, embedded in paraffin and cut into 4-µm-thick sections. Antigen retrieval was performed using eBioscience™ IHC Antigen Retrieval Solution (cat no. 00-4955-58; Invitrogen; Thermo Fisher Scientific, Inc.). Sections were washed with PBS with Tween-20 (PBST; Sigma-Aldrich; Merck KGaA), blocked with 5% bovineserum albumin (Sigma-Aldrich; Merck KGaA) for 2 h at room temperature and incubated with rabbit anti-ratglucose transporter type 4 (GLUT4; 1:1,000; cat. no. ab33780; Abcam), CD36 (1:1,000; cat. no. ab64014; Abcam), tumor necrosis factor a (TNF-α; 1:1,000; cat. no. ab6671; Abcam), interleukin (IL)-1β (1:1,000; cat. no. ab200478; Abcam) and IL-6 (1:1,000; cat. no. ab7737; Abcam) for 2 h at 37°C. Following incubation, sections were washed with PBST three times and incubated with Alexa Fluor 488-labeled goat anti-rabbit secondary antibody (1:2,000; cat. no. ab150077; Abcam) for 2 h at 37°C. A diaminobenzidine staining system (3,3′-diaminobenzidine; Sigma-Aldrich; Merck KGaA) was used to detect target protein expression using a LSM-780 confocal microscope (Zeiss AG) according to manufacturer's protocol. Cell counting was performed in six randomly selected fields using Image Pro Analyzer software (version 7.0.0.951; MediaCybernetics) and analyzed using LASAF software (version 2.0; Leica Microsystems, Inc.).
Reverse transcription-quantitative PCR (RT-qPCR)
Myocardial cells were lysed and total RNA was extracted using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Total RNA was quantified with NanoDrop™ (NanoDrop Technologies; Thermo Fisher Scientific, Inc.). RNA (1 µg) was reverse-transcribed using the cDNA Reverse Transcription kit (Takara Bio, Inc.) according to the manufacturer's protocol. qPCR was performed using an Applied Biosystems 7900HT Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and Premix Ex Taq™ (Probe qPCR, Takara Biotechnology Co., Ltd.). Forward and reverse primers were synthesized by Thermo Fisher Scientific, Inc. and are listed in Table I. The following thermocycling conditions were used: Initial denaturation at 94°C for 2 min; followed by 45 cycles of 95°C for 30 sec, 57.5°C for 30 sec and 72°C for 60 sec; and final extension at 72°C for 10 min. Relative mRNA expression levels were calculated using the 2−ΔΔCq method (25). The results were normalized to β-actin.
Table I.
Primers used for reverse transcription-quantitative PCR.
Primer sequence (5′→3′)
Gene name
Forward
Reverse
Nrf1
ATGGCCCAAACCATCACCGGCAGCA
ATGTGCCAGGATCCAGTTTAG
Fos
TTGCTGCATAAAGTTTGTGATACAG
AGGAAAAGGCATCAGAGAAGTAGC
Yy1
GAAGCCCTTTCAGTGCACGTT
ACATAGGGCCTGTCTCCGGTAT
ACC1
CCCAATATTTATCATGAGACTTGCA
CAACATTTGAATGAACTCCACG
FAS
ATTGCTCAACAACCATGCTG
CCAATCCCTTGGAGTTGATG
L-PK
GGAAGAAGACCCACAGGAAGCAATA
GAGAAGCCTCAAGGTTATGGATG
MCAD
TTGGTGACGGAGCTGGTTTCA
CATTGCCATTTCAGCCAGCA
β-actin
CGGAGTCAACGGATTTGGTC
AGCCTTCTCCATGGTCGTGA
Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; ACC1, acetyl-coenzyme A carboxylase α; FAS, Fas cell surface death receptor; L-PK, L-type pyruvate kinase; MCAD, acetyl-coenzyme A dehydrogenase medium chain.
Western blotting
The treated myocardial cells (1×108 cells/well) were lysed using RIPA lysis buffer (Thermo Fisher Scientific, Inc.). Protein concentration was measured using a BCA protein assay kit (Thermo Fisher Scientific, Inc.), and 10 µg of proteins were separated using SDS-PAGE (12% gel). Protein was transferred onto a polyvinylidene fluoride membrane (EMD Millipore). Following blocking with 5% bovineserum albumin (BSA; Sigma-Aldrich; Merck KGaA) for 2 h at 37°C, the membranes were incubated with the following primary antibodies: TNF-α (1:1,000; cat. no. ab6671; Abcam), IL-1β (1:1,000; cat. no. ab200478; Abcam), IL-6 (1:1,000; cat. no. ab7737; Abcam), nuclear respiratory factor 1 (Nrf1; 1:1,000; cat. no. ab175932; Abcam), FOS proto-oncogene (Fos; 1:1,000; cat. no. ab208942; Abcam), YY1 transcription factor (Yy1; 1:1,000; cat. no. ab109237; Abcam), acetyl-coenzyme A carboxylase a (ACC1; 1:1,000; cat. no. ab45174; Abcam), Fas cell surface death receptor (FAS; 1:1,000; cat. no. ab15285; Abcam), L-type pyruvate kinase (L-PK; 1:1,000; cat. no. ab202468; Abcam), acetyl-coenzyme A dehydrogenase medium chain (MCAD; 1:1,000; cat. no. ab92461; Abcam) and β-actin (1:2,000; cat. no. ab8226; Abcam) for 12 h at 4°C. Following three washes with PBS, the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit immunoglobulin G antibody (1:2,000; cat. no. PV-6001; OriGene Technologies, Inc.) for 24 h at 4°C. The membranes were washed with PBS and visualized with ECL Western blotting detection reagents (GE Healthcare). The band intensities were analyzed using ImageJ software 2.0 (National Institutes of Health).
Statistical analysis
Data are presented as the mean ± SD. SPSS 19.0 software (IBM Corp.) was used for statistical analysis. The experiments were performed at least three times. Student's t-test was used for comparisons between two groups and one-way analysis of variance followed by Tukey post hoc test was used to evaluate the differences for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.
Results
Puerarin improves cardiac function and increases survival rates in rats with chronic heart failure
The effects of puerarin on body weight, cardiac function and survival rate were analyzed in rat models of chronic heart failure. Body weight was significantly increased in the puerarin treatment group compared with the PBS group 30 days after treatment (P<0.05; Fig. 1A). Puerarin treatment significantly improved cardiac function, as indicated by increased FS, LVEF, CO and HR compared with the PBS group (all P<0.01; Fig. 1B-E, P<0.01). Puerarin treatment significantly increased the survival rate of rats compared with the PBS group (Fig. 1F, P<0.01). These results indicated that puerarin may improve cardiac function and survival rate of rats with chronic heart failure.
Figure 1.
Puerarin improves body weight and cardiac function and increases survival rate of rats with chronic heart failure. (A) Effects of puerarin on body weight of rats. Effects of puerarin on (B) FS, (C) LVEF, (D) CO and (E) HR. (F) Effects of puerarin on the survival rate of rats with chronic heart failure. *P<0.05 and **P<0.01 vs. PBS. FS, fractional shortening; LVEF, left ventricular ejection fraction; CO, cardiac output; HR, heart rate; ns, not significant.
Puerarin decreases LDH and SDH levels in rats with chronic heart failure
The effects of puerarin on LDH and SDH levels were analyzed in serum of a ratchronic heart failure models. The results demonstrated that serum LDH (P<0.05) and SDH (P<0.01) levels were significantly lower in the puerarin-treated group compared with the PBS group (Fig. 2). These results indicated that puerarin may ameliorate chronic heart failure by decreasing LDH and SDH levels.
Figure 2.
Puerarin decreases LDH and SDH levels in rats with chronic heart failure. *P<0.05 and **P<0.01 vs. PBS. LDH, lactate dehydrogenase; SDH, succinate dehydrogenase; ns, not significant.
Puerarin inhibits myocardial apoptosis and inflammation in rats with chronic heart failure
The antiapoptotic and anti-inflammatory effects of puerarin in myocardial tissues were analyzed in a ratchronic heart failure model. The administration of puerarin decreased the number of TUNEL-positive cells in myocardial tissue compared with the PBS group (Fig. 3A, P<0.01). In addition, puerarin treatment increased the expression of GLUT4 and decreased the expression of CD36 compared with the PBS group (Fig. 3B, P<0.01). Of note, compared with the PBS group, the puerarin-treated group exhibited decreased serum levels of BNP, CRP, troponin T and creatinine (Fig. 3C-E, P<0.05 and P<0.01). These results indicated that puerarin may have antiapoptotic and anti-inflammatory efficacy in rats with chronic heart failure.
Figure 3.
Puerarin inhibits myocardial apoptosis and inflammation in rats with chronic heart failure. (A) The percentage of TUNEL-positive cells in myocardial tissue was reduced in the puerarin group compared with the PBS group. (B) Expression of GLUT4 and CD36 in myocardial tissues. Serum levels of (C) BNP and troponin T, (D) CRP and (E) creatinine were reduced in rats with chronic heart failure treated with puerarin compared with the PBS group. *P<0.05 and **P<0.01 vs. PBS. GLUT4, glucose transporter type 4; ns, not significant; CRP, c reactive protein.
Puerarin decreases expression levels of inflammatory markers in a rat chronic heart failure model
Effects of puerarin on inflammatory markers were analyzed in rats with chronic heart failure. Compared with the PBS group, puerarin treatment decreased serum levels of TNF-α, IL-1β and IL-6 in rats with chronic heart failure (Fig. 4A, P<0.01). No significant differences were observed between the puerarin and sham groups following 4-week treatment. Immunohistochemistry demonstrated that puerarin decreased TNF-α, IL-1β and IL-6 expression levels in myocardial tissue in rats with chronic heart failure compared with the PBS group (Fig. 4B, P<0.01). The results indicated that puerarin may effectively inhibit inflammatory markers in rats with chronic heart failure.
Figure 4.
Puerarin inhibits inflammation in a rat chronic heart failure model. Puerarin treatment reduced (A) serum and (B) myocardial tissue levels of TNF-α, IL-1β and IL-6 compared with the PBS group. **P<0.01. TNFα, tumor necrosis factor α; IL, interleukin; ns, not significant.
Puerarin upregulates PPARα and its downstream target genes in myocardial cells in a rat chronic heart failure model
PPARα and its downstream target gene expression levels were analyzed in rat myocardial cells. Puerarin increased PPARα and its downstream target Nrf1, Fos and Yy1 gene and protein expression levels in myocardial cells from rats with chronic heart failure compared with control (Fig. 5A and B, P<0.01). Puerarin also upregulated the expression of PPARα downstream target genes ACC1, FAS, L-PK and MCAD compared with the control group (Fig. 5C and D, P<0.01). These results indicated that puerarin may upregulate PPARα and its downstream target genes in myocardial cells from rats with chronic heart failure.
Figure 5.
Puerarin increases the expression levels of PPARα and its downstream target genes in cardiac cells from rat models of chronic heart failure. Effects of puerarin on PPARα, Nrf1, Fos and Yy1 (A) mRNA and (B) protein expression in myocardial cells. Effects of puerarin on (C) gene and (D) protein expression levels of ACC1, FAS, L-PK and MCAD. **P<0.01 vs. control. PPARα, peroxisome proliferator-activated receptor α; Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; ACC1, acetyl-coenzyme A carboxylase α; FAS, Fas cell surface death receptor; L-PK, L-type pyruvate kinase; MCAD, acetyl-coenzyme A dehydrogenase medium chain.
Puerarin suppresses apoptosis and inflammation in myocardial cells
The anti-inflammatory and antiapoptotic efficacy of puerarin was further analyzed in myocardial cells in vitro. Puerarin significantly decreased TNF-α, IL-1β and IL-6 expression in myocardial cells compared with control group (Fig. 6A, P<0.01). In addition, puerarin attenuated apoptosis of myocardial cells compared with the control group (Fig. 6B, P<0.01). These results indicated that puerarin may have anti-inflammatory and antiapoptotic efficacy in myocardial cells.
Figure 6.
Puerarin inhibits apoptosis and inflammation in myocardial cells. (A) Puerarin treatment downregulated the expression of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells. (B) Puerarin attenuated apoptosis in myocardial cells. **P<0.01 vs. control. TNFα, tumor necrosis factor α; IL, interleukin.
Puerarin inhibits apoptosis and inflammation in myocardial cells via the PPARα pathway
The potential mechanism of puerarin activity was analyzed in myocardial cells. The results demonstrated that transfection with si-PPARα decreased the expression level of PPARα and its downstream targets, including Nrf1, Fos and Yy1 compared with the si-mimic group (Fig. 7A; P<0.01). Western blotting results revealed that knockdown of PPARα increased the protein expression of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells compared with the si-mimic group; this effect was reversed in myocardial cells treated with puerarin (Fig. 7B; P<0.01). TUNEL assay demonstrated that treatment with puerarin reversed the effect of PPARα knockdown on apoptosis of myocardial cells isolated form experimental rats (Fig. 7C; P<0.05). These results suggested that puerarin may inhibit apoptosis and inflammation in myocardial cells via the PPARα pathway in rats with chronic heart failure.
Figure 7.
Puerarin reverses the pro-apoptotic and pro-inflammatory effects of PPARα knockdown. (A) Effects of PPARα knockdown on the expression levels of PPARα and its downstream target proteins Nrf1, Fos and Yy1 in myocardial cells. (B) Effects of PPARα knockdown on the expression levels of inflammatory factors TNF-α, IL-1β and IL-6 in myocardial cells in the presence or absence of puerarin. (C) Effects of PPARα knockdown and puerarin treatment on apoptosis of myocardial cells. *P<0.05 and **P<0.01 as indicated. PPARα, peroxisome proliferator-activated receptor a; Nrf 1, nuclear respiratory factor 1; Fos, FOS proto-oncogene; Yy1, YY1 transcription factor; si-PPARα, small interfering RNA targeting PPARα; si-mimic, control small interfering RNA; TNFα, tumor necrosis factor α; IL, interleukin; ns, not significant.
Discussion
Previous reports have indicated that the mortality rate of patients with chronic heart failure is increasing and suggested that improving the treatment of chronic heart failure may contribute the survival of patients (33–35). The present study aimed to determine whether puerarin treatment exhibits therapeutic efficacy in rats with chronic heart failure. The results of the present study demonstrated that puerarin treatment significantly improved cardiac function and increased body weight during a 4-week treatment following chronic heart failure model induction. In addition, the levels of inflammatory markers TNF-α, IL-1β and IL-6 were reduced by puerarin compared with PBS treatment in rats. Puerarin increased the expression of PPARα and its downstream target genes GLUT4 and CD36 compared with PBS treatment, which are involved in the cardiac metabolism (36). The results of the present study also demonstrated that puerarin decreased LDH and SDH levels in rats with chronic heart failure compared with PBS.Increases in TNF-α levels may contribute to the progression of cardiac remodeling and decompensated heart failure (37). TNF-α, IL-1β and IL-6 are the major pro-inflammatory markers identified as contributors to chronic heart failure (38). The results of the present study demonstrated that puerarin decreased serum levels of TNF-α, IL-1β and IL-6 in a ratchronic heart failure model. However, the prognostic value of inflammatory markers TNF-α, IL-1β and IL-6 requires further analysis in patients with chronic heart failure.Changes in the myocardial activities of LDH and SDH in the experimental models of diabetic and post-infarction damage are parameters used in evaluating abnormal processes of glycolysis and oxidative phosphorylation in rat cardiac mitochondria (39). A previous study has indicated that decreasing the creatine kinase-MB and LDH levels protected the heart against ischemia-reperfusion injury (40). The results of the present study revealed that puerarin attenuated serum LDH and SDH levels in rats with chronic heart failure, which may be one of mechanisms by which puerarin significantly increased the survival rate and improved cardiac function of experimental rats. Additionally, a previous study has reported that puerarin improved cardiac function through regulation of energy metabolism in streptozotocin-nicotinamide induced diabeticmice following myocardial infarction (41). The present study demonstrated that puerarin significantly improved FS, EF, CO and HR compared with PBS-treated in rats with chronic heart failure.Acute myocardial infarction increases cardiac GLUT4 levels and partially preserves heart function in spontaneously hypertensiverats (42). CD36 mediates the cardiovascular action of growth hormone-releasing peptides in the heart, and the coronary vasoconstrictive response correlates with CD36 expression levels (43). The present study demonstrated that puerarin treatment increased the expression levels of GLUT4 and decreased the expression levels of CD36. PPARs are nuclear hormone receptors that regulate genes involved in energy metabolism and inflammation (44). The results of the present study revealed that puerarin increased the expression of downstream target genes of PPARα involved in a range of metabolic pathways, including Nrf1, Fos, Yy1, ACC1, FAS, L-PK and MCAD, which enhance metabolic plasticity of skeletal muscles (45). In addition, puerarin increased the body weight of rats with chronic heart failure, which indicated that puerarin may regulate energy metabolism in myocardial cells; however, this requires further investigation. The results of the present study demonstrated that puerarin reversed the pro-apoptotic and pro-inflammatory effects of PPARα knockdown in myocardial cells, which suggested that puerarin inhibited apoptosis and inflammation in myocardial cells via the PPARα pathway.In conclusion, the results of the present study indicated that puerarin exhibited ameliorative properties on myocardial function in a ratchronic heart failure model through the regulation of myocardial cell apoptosis. The results revealed that decreased LDH and SDH levels, as well as decreased expression levels of inflammatory markers, including TNF-α, IL-1β and IL-6, were identified in puerarin-treated rats with chronic heart failure. These data suggest that puerarin may be a promising agent for therapeutic intervention in treating chronic heart failure.
Authors: V Bodart; M Febbraio; A Demers; N McNicoll; P Pohankova; A Perreault; T Sejlitz; E Escher; R L Silverstein; D Lamontagne; H Ong Journal: Circ Res Date: 2002-05-03 Impact factor: 17.367
Authors: P M Kane; F E M Murtagh; K Ryan; N G Mahon; B McAdam; R McQuillan; C Ellis-Smith; C Tracey; C Howley; C Raleigh; G O'Gara; I J Higginson; B A Daveson Journal: Heart Fail Rev Date: 2015-11 Impact factor: 4.214