Literature DB >> 31600332

Vancomycin-resistance gene cluster, vanC, in the gut microbiome of acute leukemia patients undergoing intensive chemotherapy.

Armin Rashidi1, Zhigang Zhu2,3, Thomas Kaiser2,3, Dawn A Manias4, Shernan G Holtan1, Tauseef Ur Rehman5, Daniel J Weisdorf1, Alexander Khoruts3,5, Gary M Dunny4, Christopher Staley2,3.   

Abstract

Two recent reports suggested that the less common, less virulent enterococcal species, Enterococcus gallinarum and E. casseliflavus, with low-level vancomycin resistance due to chromosomally encoded vanC1 and vanC2/3, may influence host immunity. We reported that peri-transplant gut colonization with E. gallinarum and E. casseliflavus is associated with lower mortality after allogeneic hematopoietic cell transplantation (HCT). Because most acute leukemia patients undergoing HCT have received intensive chemotherapy (usually requiring prolonged hospitalization) for their underlying disease before HCT, we hypothesized that some may have acquired vanC-positive enterococci during chemotherapy. Therefore, we evaluated the presence of the vanC gene cluster using vanC1 and vanC2/3 qPCR in thrice-weekly collected stool samples from 20 acute leukemia patients undergoing intensive chemotherapy. We found that an unexpectedly large proportion of patients have detectable vanC1 and vanC2/3 (15% and 35%, respectively) in at least one stool sample. Comparing qPCR results with 16S rRNA gene sequencing results suggested that E. gallinarum may reach high abundances, potentially persisting into HCT and influencing transplant outcomes.

Entities:  

Year:  2019        PMID: 31600332      PMCID: PMC6786763          DOI: 10.1371/journal.pone.0223890

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Hematopoietic cell transplantation (HCT) is a potentially curative approach for many patients with high-risk hematologic malignancies. After their initial anti-neoplastic treatment, often including intensive chemotherapy, such patients are referred for HCT. Gut colonization with antibiotic-resistant organisms is common during HCT [1-3]. The genus Enterococcus, frequently harboring antibiotic resistance genes (ARGs), is one of the most common gut colonizers in HCT patients [4,5]. The plasmid-encoded vanA gene is the most common enterococcal ARG conferring high-level vancomycin resistance to E. faecium and E. faecalis (VRE), with high transmissibility and propensity to cause major clinical infections [6,7]. In contrast, the vanC gene cluster is chromosomally encoded and confers low-level, intrinsic vancomycin resistance to the less commonly encountered E. casseliflavus (vanC2/3 gene) and E. gallinarum (vanC1 gene) [8,9]. We recently reported that colonization with E. casseliflavus or E. gallinarum is associated with lower transplant-related mortality and better survival [10]. The mechanisms underlying this association are unknown, but alterations in host immunity have been reported [11]. In addition, it is not known whether patients acquire E. casseliflavus and E. gallinarum during HCT or before HCT during the treatment of their underlying hematologic disorder. To determine when these species are acquired, we investigated the presence of vanC genes in the stool of acute leukemia patients undergoing intensive chemotherapy.

Methods

Patients and samples

We collected thrice-weekly stool samples between hospital admission and day 28 of chemotherapy (or discharge) from 20 acute leukemia patients receiving intensive chemotherapy. Day 0 was defined as the first day of chemotherapy. Our Institutional Review Board at the University of Minnesota approved the protocol (ID #2017NTLS052) and all patients provided written informed consent. Details of the protocol have been reported elsewhere [12]. Patients remained in private rooms for their entire hospitalization. Contact isolation was implemented if colonization or clinical infection with any vancomycin-resistant enterococci (including E. gallinarum or E. casseliflavus) was identified. We defined intensive chemotherapy as any regimen requiring a planned hospitalization of approximately 4 weeks. Patients did not enroll to the same study upon relapse. At our institution, we use levofloxacin for antibacterial, acyclovir for antiviral, and an azole for antifungal prophylaxis starting with chemotherapy until neutrophil recovery, and cefepime as the initial empiric antibiotic for neutropenic fever. Variations to this recommendation were allowed.

DNA extraction

Samples were stored at -80°C prior to DNA extraction. DNA was extracted from thawed fecal samples using the DNeasy® PowerSoil® kit (Qiagen, Hilden, Germany). Approximately 0.25 g fecal sample were added to the PowerBead tube and processed according to the manufacturer’s instructions using the automated QIAcube platform with the inhibitor removal technology protocol. A final volume of 100 μl DNA solution was obtained and the concentration of extracted DNA was quantified with a QubitTM 4 fluorometer and dsDNA HS Assay kit (Thermo Fisher Scientific, Waltham, MA, USA).

16S rRNA amplicon sequencing

The V4 hypervariable region of the 16S rRNA gene was sequenced on the Illumina MiSeq platform (Illumina Inc., San Diego, CA, USA). Raw sequence data are available under NCBI BioProject #SRP141394. Sequence data were processed as previously described [13]. Briefly, sequences were paired-end joined, trimmed for quality, and aligned against the SILVA database version 132 [14]. Sequences were subjected to a 2% pre-cluster step to remove likely errors [15], and chimeras were identified and removed using UCHIME ver. 4.2.40 [16]. Operational taxonomic units were classified at 97% sequence similarity using the furthest-neighbor algorithm, and taxonomic classifications were made against the version 16 release from the Ribosomal Database Project [17].

Quantitative PCR (qPCR)

qPCR assays targeting the vancomycin resistance genes vanC1 and vanC2/3 were used as described previously () [18]. The primers were synthesized by Integrated DNA Technologies (IDT; Coralville, IA, USA) and diluted to 10 μM working stocks. Primer targets were cloned into a gBlocks plasmid standard (IDT), using previously published accession numbers [18]. Standard curves ranging from 106 to 101 gene copies were prepared from 10-fold serial dilutions of the plasmid standard. Each standard concentration was run in triplicate on each plate. Two negative (sterile water) controls were included on each plate. PCR reactions included 10 μl QuantiTect SYBR Green MasterMix (Qiagen), 1 μl of each primer (1.5 μl for vanC1), 6 μl nuclease-free water, and 2 μl DNA template. PCR was carried out using the LightCycler 480 II thermocycler (Roche, Basel, Switzerland) with the following two-step thermocycling conditions for vancomycin resistance genes: an initial denaturation at 95°C for 15 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. DNA from all samples was run in duplicate. Gene copies were extrapolated from the standard curve using the absolute quantification/2nd derivative max method with the LightCycler 480 software, for which the manufacturer recommends that error should be <0.2 for accurate quantitation. Data were reported as gene copies per ng DNA if both replicates showed quantifiable amplification. If only one replicate was quantifiable, results were reported as positive, but not quantifiable. *Melting temperature (Tm), shown as mean ± standard error based on standard curves generated in this study.

Statistical analysis

Alpha diversity was measured by Shannon index, incorporating both richness and evenness of the abundances of bacterial community members [19]. We determined the correlation between Enterococcus relative abundance and vanC abundance by a Spearman’s correlation test.

Results

Detailed patient characteristics are shown in . We collected and analyzed 207 stool samples. There was a negative correlation between Shannon diversity and Enterococcus relative abundance (Spearman’s ρ = -0.50, P < 0.001; ). shows the heatmap of the 15 most common genera among all samples. Enterococcus was the second most common genus, with an aggregate mean (range) relative abundance of 10 (0–99)%, following Bacteroides, with an aggregate mean (range) relative abundance of 25 (0–92)%. shows changes in Enterococcus relative abundance and vanC gene copies per ng DNA over time for each patient. vanC1 was detectable in 11 (5%) samples from 3 (15%) patients, with a median of 30,147 (range: 2–1,873,333) copies per ng DNA. vanC1 was quantifiable in all positive samples. vanC2/3 was detectable in 19 (9%) samples from 7 (35%) patients, with a median of 13 (range: 1–232) copies per ng DNA in quantifiable cases (13 samples). All three patients with vanC1 also had detectable vanC2/3.

Microbiota diversity and composition.

There is a negative correlation between Shannon diversity and Enterococcus relative abundance. Each point represents a sample. (B) Heatmap of microbiota relative abundances from 16S rRNA amplicon sequencing. Each column shows a genus and each row represents a sample. Only the 15 most abundant genera are shown.

Changes in Enterococcus relative abundance and vanC1 copies per ng DNA over time.

Each line represents samples from the same patient. Patients with detectable vanC1 (patients #10, 12, and 13) are shown in color while all other patients (labeled as #0) are grayed out for improved visibility. vanC1-positive samples are indicated with a circle, with a diameter proportional to the square root of vanC1 gene copies per ng DNA. Day 0 is the first day of chemotherapy. 7+3: Idarubicin + Cytarabine; ALL: Acute lymphoblastic leukemia; AML: Acute myeloid leukemia; Clo/Ara-C: Clofarabine + Cytarabine; F: Female; M: Male; MEC: Mitoxantrone + Etoposide + Cytarabine We classified patients into 3 groups (). Group A (3 patients) had at least one vanC1-positive sample; group B (4 patients) had at least one vanC2/3-positive sample, but no vanC1-positive sample; group C (13 patients) had no vanC1- or vanC2/3-positive samples. No relationship was found between antibiotic exposure and the vanC group, though this observation was limited by the small sample size and high variability of antibiotic exposures. Thirteen patients received induction and seven received re-induction/salvage chemotherapy. Treatment phase was not associated with the vanC group (P = 0.80, Fisher’s exact test). 1Groups: (i) group A, ≥1 vanC1-positive sample, (ii) group B, ≥1 vanC2/3-positive but no vanC1-positive sample, and (iii) group C, no vanC1- or vanC2/3-positive samples. 2For patients with at least one vanC-positive sample (groups A and B), pre and post antibiotics refer to those initiated before and after the first positive sample. For patients without any vanC-positive samples (group C), antibiotics during chemotherapy are shown. BSI: Bloodstream infection; CDI: Clostridium difficile infection; FQN: Fluoroquinolone; m: months; MRSA: Methicillin-resistant Staphylococcus aureus; NF: Neutropenic fever; Pip-Tazo: Piperacillin-tazobactam; Pt: Patient; Vanc: Vancomycin; VRE: Vancomycin-resistant E. faecium We next evaluated whether vanC gene abundance correlates with Enterococcus relative abundance as determined by 16S rRNA gene amplicon sequencing. For vanC1, this correlation was strong (Spearman’s ρ = 0.78, P = 0.004) but there was no correlation between vanC2/3 and Enterococcus relative abundance (ρ = 0.31, P = 0.30). Similarly, vanC1 correlated negatively with Shannon diversity (ρ = -0.64, P = 0.04), but vanC2/3 did not (ρ = 0.23, P = 0.41). The primary species known to harbor vanC2/3 is E. casseliflavus; therefore, these results suggested that E. casseliflavus comprised only a minor proportion of enterococci in vanC2/3-positive samples, hence its relative abundance (expected to positively correlate with vanC2/3 gene abundance) did not substantially influence the relative abundance of all enterococci combined. Variations in Enterococcus relative abundance in these samples were likely largely driven by E. faecium and E. faecalis. In contrast, the strong correlation between vanC1 gene abundance, primarily present in E. gallinarum, and Enterococcus relative abundance suggested that E. gallinarum was an abundant species in vanC1-positive samples. We next focused on the three patients whose stools had detectable vanC1. The first stool sample with detectable vanC1 was collected on day 11 (sample 6) in patient #10, day 6 (sample 4) in patient #12, and day 1 (sample 2) in patient #13. These findings suggested that patients #10 and #12 and possibly patient #13 did not have vanC1 in their stool at baseline but acquired it during hospitalization. Patient #10 continued to have detectable vanC1 in all stool samples following the first positive sample. Interestingly, vanC1 was detectable in stool samples collected from this patient during subsequent HCT. Two other patients in our cohort underwent HCT after completing chemotherapy. Patient #1 (with detectable vanC2/3 during chemotherapy) had detectable vanC2/3 in stool samples collected during HCT. Patient #14 did not have detectable vanC1 or vanC2/3 during chemotherapy or HCT. No patient developed a clinical infection with a vanC-positive Enterococcus sp. Within the limits of a small sample size, we found no obvious differences in clinical outcomes ().

Discussion

Gut colonization with E. casseliflavus and E. gallinarum is uncommon, occurring in only about 5% of individuals (hospitalized or non-hospitalized) [22,23]. Because of this rarity, expected non-transmissibility of chromosomally encoded vanC genes, and overall low pathogenicity, E. casseliflavus and E. gallinarum have received little attention in the medical literature. However, two recent studies provided evidence that E. casseliflavus and E. gallinarum may influence host immunity. In one study, E. gallinarum translocated from the gut into the organs and drove autoimmunity in genetically predisposed mice [11]. In the second study, we reported improved survival due to lower transplant-related mortality in allogeneic HCT recipients who had peri-transplant gut colonization with E. casseliflavus or E. gallinarum [10]. Because the source of these bacteria in the gut is unknown, we conducted the present study to determine whether patients with acute leukemia (the most common indication for allogeneic HCT) acquire E. casseliflavus and E. gallinarum during their ~4-week hospitalization for intensive chemotherapy. We used vanC1 and vanC2/3 as surrogates for E. gallinarum and E. casseliflavus, respectively, because with rare exceptions [24,25], these genes are species-specific. Our results suggest a higher than expected incidence of colonization with E. gallinarum (15% of patients) and E. casseliflavus (35% of patients) in intensively treated patients with acute leukemia. vanC1 was detectable at much higher copy numbers than vanC2/3. Although we do not know the source of E. gallinarum and E. casseliflavus, vanC genes were not present in baseline stool samples collected from patients, suggesting that prolonged hospitalization, extensive healthcare contact, major dietary changes during intensive chemotherapy, and microbiota alterations contributed to the acquisition and expansion of E. gallinarum and E. casseliflavus to detectable levels. For example, disruptions of gut microbial communities due to antibiotics may have suppressed putative natural competitors of E. gallinarum and E. casseliflavus. The negative correlation we found between vanC1 copy number and Shannon diversity supports this hypothesis. Approximately one third of all vanC-positive rectal swabs in a previous study of intensively treated cancer patients tested positive after the first week of hospitalization, supporting the possibility of nosocomial acquisition [26]. Although still controversial [27,28], some previous studies have suggested that antibiotic-induced changes in the gut resistome are transient, with a rapid reversion of ARGs to baseline after discontinuation of antibiotics [29]. Since exposure to antibiotics is nearly universal during chemotherapy, patients receiving re-induction/salvage chemotherapy have prior exposure to antibiotics. This is in contrast to patients receiving induction therapy, who may not have a significant prior history of antibiotic exposure. Our observation of no association between treatment phase and vanC detectability argues against permanent changes in the gut resistome due to induction chemotherapy and its associated antibiotics. However, vanC genes were detectable during subsequent HCT in stool samples collected from both patients who underwent HCT and had detectable vanC during chemotherapy. One possibility is that antibiotic selective pressure is necessary to maintain vanC, which was lost after completion of chemotherapy (and discontinuation of antibiotics) but recurred during HCT due to repeated exposure to antibiotics. Another possibility is that vanC persisted between completion of chemotherapy and HCT. In the absence of samples between different phases of treatment, we cannot distinguish between these possibilities. Because chemotherapy-induced gut barrier damage facilitates bacterial translocation, even a transient gut colonization with vanC-positive enterococci during chemotherapy could lead to systemic spread of these bacteria, their structural components, or metabolites. This could potentially influence host immunity and transplant outcomes in vanC-positive acute leukemia patients who proceed to allogeneic HCT. More research is needed to determine the incidence of persistent low-level bacteremia with vanC-positive bacteremia and whether it is mechanistically linked with immune and non-immune effects after HCT.
Table 1

Primers and performance characteristics for qPCR assays.

Target genePrimerSequence (5’-3’)Size (bp)Tm* (°C)Efficiency (%)Error
vanC1VanC1-FTGCTTGTGATGCGATTTCTC20483.57 ± 0.0791.44 ± 1.410.05 ± 0.03
VanC1-RATCGCTCCTTGATGGTGAC
vanC2/3VanC23-FGGGAAGATGGCAGTATCCAA10280.34 ± 0.0994.81 ± 3.090.04 ± 0.03
VanC23-RGCAGCAGCCATTTGTTCATA

*Melting temperature (Tm), shown as mean ± standard error based on standard curves generated in this study.

Table 2

Patient, disease, and treatment characteristics.

PatientAge (y), SexDisease, PhasePrior intensive chemotherapyInterval from last intensive chemotherapyChemotherapy during study
122, MAML, Induction--7+3
260, MAML, Re-inductionYes0.5 monthsMEC
368, FAML, Re-inductionYes7 monthsClo/Ara-C
436, FALL, Induction--GRAAL [20]
552, FALL, Induction--PETHEMA [21]
635, MAML, Re-inductionYes7 monthsClo/Ara-C
767, FAML, Induction--7+3
874, FAML, Induction--7+3
958, FAML, Induction--7+3
1050, FAML, Re-inductionYes6 monthsMEC
1165, MAML, Re-inductionYes4 monthsMEC
1273, MAML, Induction--7+3
1351, FAML, Induction--7+3
1453, MALL, Induction--GRAAL
1523, MALL, Induction--PETHEMA
1652, FAML, Induction--7+3
1752, FAML, Re-inductionYes10 monthsMEC
1868, MAML, Induction--7+3
1922, MAML, Re-inductionYes4 monthsMEC
2061, FAML, Induction--7+3

7+3: Idarubicin + Cytarabine; ALL: Acute lymphoblastic leukemia; AML: Acute myeloid leukemia; Clo/Ara-C: Clofarabine + Cytarabine; F: Female; M: Male; MEC: Mitoxantrone + Etoposide + Cytarabine

Table 3

vanC group, antibiotics, and clinical outcomes.

PtGroup1Pre-and post-vanC antibacterial antibiotics2NFBSICDIRelapse/ProgressionSurvival
1BPre: Cefepime, Pip-TazoPost: Cefepime, Pip-Tazo, VancD14-D9-Alive, 22m
2BPre: Cefepime, FQN, Pip-Tazo, VancPost: Cefepime, DaptomycinD8D14 (VRE)-13mAlive, 22m
3CFQN, Pip-TazoD7--0.5mDead, 0.5m
4CCephalexin, FQN----Dead, 22m
5CCefepime, Ceftriaxone, VancD26D26 (Strep. mitis)--Alive, 19m
6BPre: FQN, MeropenemPost: Aztreonam, Daptomycin, FQN, Linezolid, Metronidazole, VancomycinD13D14 (Strep. sanguinis)-7mDead, 12m
7CFQN, Cefepime, MetronidazoleD8-D79mDead, 20m
8CFQN, Cefepime, VancD13D13 (MRSA)-8mDead, 11m
9BPre: FQN, Cefepime, Meropenem, Pip-TazoPost: FQN, Meropenem, MetronidazoleD5--8mDead, 9m
10APre: FQN, CefepimePost: Azithromycin, Cefepime, FQN, Metronidazole, VancD10--13mDead, 20m
11CFQN, Cefepime, Ertapenem, Metronidazole, Pip-TazoD7--1mDead, 2m
12APre: CefdinirPost: Azithromycin, Cefdinir, Cefepime, FQN, Metronidazole, Pip-Tazo, VancD10-D105mDead, 13m
13APre: Cefdinir, Cefepime, FQN, Metronidazole, VancPost: Cefdinir, Cefepime, Doxycycline, VancD7--8mDead, 11m
14CFQN----Alive, 19m
15CFQN, Cefepime, Pip-Tazo, VancD-1D-1 (Strep. mitis)--Alive, 19m
16CFQN, Cefepime, Meropenem, VancD-3--1mDead, 4m
17CFQN, Cefepime, Pip-Tazo, VancD9--5mDead, 12m
18CFQN, CefepimeD15--8mDead, 15m
19CFQN, Pip-Tazo, VancD9D9 (Strep. mitis)-1mDead, 6m
20CCefepime, Clindamycin, FQN, Metronidazole, Nitrofurantoin, VancomycinD5-D125mDead, 5m

1Groups: (i) group A, ≥1 vanC1-positive sample, (ii) group B, ≥1 vanC2/3-positive but no vanC1-positive sample, and (iii) group C, no vanC1- or vanC2/3-positive samples.

2For patients with at least one vanC-positive sample (groups A and B), pre and post antibiotics refer to those initiated before and after the first positive sample. For patients without any vanC-positive samples (group C), antibiotics during chemotherapy are shown. BSI: Bloodstream infection; CDI: Clostridium difficile infection; FQN: Fluoroquinolone; m: months; MRSA: Methicillin-resistant Staphylococcus aureus; NF: Neutropenic fever; Pip-Tazo: Piperacillin-tazobactam; Pt: Patient; Vanc: Vancomycin; VRE: Vancomycin-resistant E. faecium

  28 in total

Review 1.  Persistence of antibiotic resistant bacteria.

Authors:  Dan I Andersson
Journal:  Curr Opin Microbiol       Date:  2003-10       Impact factor: 7.934

2.  Multihospital surveillance of nosocomial methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterococcus, and Clostridium difficile: analysis of a 4-year data-sharing project, 1999-2002.

Authors:  Terry Burger; Deborah Fry; Renee Fusco; Maureen Luschini; Joan Bradley Mayo; Vivien Ng; Kathleen Roye-Horn; Nancy Wagner
Journal:  Am J Infect Control       Date:  2006-09       Impact factor: 2.918

3.  Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans.

Authors:  Carles Ubeda; Ying Taur; Robert R Jenq; Michele J Equinda; Tammy Son; Miriam Samstein; Agnes Viale; Nicholas D Socci; Marcel R M van den Brink; Mini Kamboj; Eric G Pamer
Journal:  J Clin Invest       Date:  2010-11-22       Impact factor: 14.808

4.  Treatment of high-risk Philadelphia chromosome-negative acute lymphoblastic leukemia in adolescents and adults according to early cytologic response and minimal residual disease after consolidation assessed by flow cytometry: final results of the PETHEMA ALL-AR-03 trial.

Authors:  Josep-Maria Ribera; Albert Oriol; Mireia Morgades; Pau Montesinos; Josep Sarrà; José González-Campos; Salut Brunet; Mar Tormo; Pascual Fernández-Abellán; Ramon Guàrdia; María-Teresa Bernal; Jordi Esteve; Pere Barba; María-José Moreno; Arancha Bermúdez; Antonia Cladera; Lourdes Escoda; Raimundo García-Boyero; Eloy Del Potro; Juan Bergua; María-Luz Amigo; Carlos Grande; María-José Rabuñal; Jesús-María Hernández-Rivas; Evarist Feliu
Journal:  J Clin Oncol       Date:  2014-04-21       Impact factor: 44.544

5.  Translocation of a gut pathobiont drives autoimmunity in mice and humans.

Authors:  S Manfredo Vieira; M Hiltensperger; V Kumar; D Zegarra-Ruiz; C Dehner; N Khan; F R C Costa; E Tiniakou; T Greiling; W Ruff; A Barbieri; C Kriegel; S S Mehta; J R Knight; D Jain; A L Goodman; M A Kriegel
Journal:  Science       Date:  2018-03-09       Impact factor: 47.728

6.  Clinical Impact of Colonization with Multidrug-Resistant Organisms on Outcome after Autologous Stem Cell Transplantation: A Retrospective Single-Center Study.

Authors:  Sebastian Scheich; Claudia Reinheimer; Christian Brandt; Thomas A Wichelhaus; Michael Hogardt; Volkhard A J Kempf; Uta Brunnberg; Christian Brandts; Olivier Ballo; Ivana von Metzler; Johanna Kessel; Hubert Serve; Björn Steffen
Journal:  Biol Blood Marrow Transplant       Date:  2017-05-18       Impact factor: 5.742

7.  Ironing out the wrinkles in the rare biosphere through improved OTU clustering.

Authors:  Susan M Huse; David Mark Welch; Hilary G Morrison; Mitchell L Sogin
Journal:  Environ Microbiol       Date:  2010-03-11       Impact factor: 5.491

Review 8.  Resistance Mechanisms, Epidemiology, and Approaches to Screening for Vancomycin-Resistant Enterococcus in the Health Care Setting.

Authors:  Matthew L Faron; Nathan A Ledeboer; Blake W Buchan
Journal:  J Clin Microbiol       Date:  2016-05-04       Impact factor: 5.948

9.  SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB.

Authors:  Elmar Pruesse; Christian Quast; Katrin Knittel; Bernhard M Fuchs; Wolfgang Ludwig; Jörg Peplies; Frank Oliver Glöckner
Journal:  Nucleic Acids Res       Date:  2007-10-18       Impact factor: 16.971

10.  Gut Bacterial Microbiota and its Resistome Rapidly Recover to Basal State Levels after Short-term Amoxicillin-Clavulanic Acid Treatment in Healthy Adults.

Authors:  Chad W MacPherson; Olivier Mathieu; Julien Tremblay; Julie Champagne; André Nantel; Stéphanie-Anne Girard; Thomas A Tompkins
Journal:  Sci Rep       Date:  2018-07-25       Impact factor: 4.379

View more
  3 in total

1.  Loss of microbiota-derived protective metabolites after neutropenic fever.

Authors:  Armin Rashidi; Maryam Ebadi; Tauseef Ur Rehman; Heba Elhusseini; Hossam Halaweish; Shernan G Holtan; Sivapriya Ramamoorthy; Daniel J Weisdorf; Alexander Khoruts; Christopher Staley
Journal:  Sci Rep       Date:  2022-04-15       Impact factor: 4.996

2.  Fatal infection with enterocolitis from methicillin-resistant Staphylococcus aureus and the continued value of culture in the era of molecular diagnostics.

Authors:  Pooja Bhattacharyya; Andrew Bryan; Vidya Atluri; Jimmy Ma; Lindsey Durowoju; Anshu Bandhlish; Jim Boonyaratanakornkit
Journal:  Leuk Res Rep       Date:  2021-05-24

3.  New Insights into the Virulence Traits and Antibiotic Resistance of Enterococci Isolated from Diverse Probiotic Products.

Authors:  Fengru Deng; Yunsheng Chen; Xiaoyu Zhou; Huiying Xiao; Tianyu Sun; Yiqun Deng; Jikai Wen
Journal:  Microorganisms       Date:  2021-03-31
  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.