Literature DB >> 31592768

Stereotyped transcriptomic transformation of somatosensory neurons in response to injury.

Minh Q Nguyen1, Claire E Le Pichon2, Nicholas Ryba1.   

Abstract

In mice, spared nerve injury replicates symptoms of human neuropathic pain and induces upregulation of many genes in somatosensory neurons. Here we used single cell transcriptomics to probe the effects of partial infraorbital transection of the trigeminal nerve at the cellular level. Uninjured neurons were unaffected by transection of major nerve branches, segregating into many different classes. In marked contrast, axotomy rapidly transformed damaged neurons into just two new and closely-related classes where almost all original identity was lost. Remarkably, sensory neurons also adopted this transcriptomic state following various minor peripheral injuries. By genetically marking injured neurons, we showed that the injury-induced transformation was reversible, with damaged cells slowly reacquiring normal gene expression profiles. Thus, our data expose transcriptomic plasticity, previously thought of as a driver of chronic pain, as a programed response to many types of injury and a potential mechanism for regulating sensation during wound healing.

Entities:  

Keywords:  mouse; neuroscience; peripheral injury; somatosensation; spared nerve injury; transcriptomic analysis; transcriptomic plasticity; trigeminal neurons

Mesh:

Year:  2019        PMID: 31592768      PMCID: PMC6783272          DOI: 10.7554/eLife.49679

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

The somatosensory system is responsible for providing vertebrates with important information about thermal, chemical and mechanical cues by eliciting a very wide range of distinct sensations that allow animals to respond appropriately (Abraira and Ginty, 2013; Basbaum et al., 2009; Le Pichon and Chesler, 2014). For example, noxious stimuli activate nociceptors triggering spatially localized pain that serves to inform both immediate responses and future avoidance of risky behavior (Basbaum et al., 2009; Julius, 2013). However, maladaptive transformation of somatosensation can lead to chronic pain. For example, in human subjects, various types of nerve damage result in neuropathic pain, which rather than providing essential information about the external environment greatly impacts quality of life (Basbaum et al., 2009; Colloca et al., 2017; Costigan et al., 2009). This type of pain is often modeled in animals by spared nerve injury (SNI) where major branches of a peripheral nerve are crushed or cut (Cobos et al., 2018; Costigan et al., 2009; Guan et al., 2016). Many studies have demonstrated that such lesion of the sciatic nerve and partial infraorbital trigeminal nerve transection (IOT) result in the development of mechanical allodynia (where gentle touch elicits pain behavior) and cold sensitivity (Basbaum et al., 2009; Choi et al., 2016; Cobos et al., 2018; Guan et al., 2016; Hardt et al., 2019; Ito et al., 2013; Xu et al., 2008). Just as in human neuropathic pain symptoms typically develop slowly, over a period of days, and then persist long-term. One well-characterized effect of SNI is the upregulation of genes in response to injury (Cobos et al., 2018; Guan et al., 2016; Shin et al., 2019; Wlaschin et al., 2018). These genes encode neuropeptides such as galanin (Gal), neuropeptide Y (Npy) and neurotensin (Nts), transcription control factors including activating transcription factor 3 (Atf3), SRY-Box11 (Sox11) and cytokines like colony stimulating factor 1 (Csf1) that are all expressed in injured neurons. It is generally thought that these transcriptional changes are important for triggering neuropathic pain with recent work showing that upstream inhibition of this gene expression program attenuated pain (Wlaschin et al., 2018). More specifically, upregulation of Csf1 expression after nerve injury has been genetically linked to development of chronic pain (Guan et al., 2016). However, the significance for most of the SNI induced gene expression changes remains to be determined. Somatosensory neurons are diverse with wide-ranging conduction velocities, cell soma diameters, expression profiles of receptors, ion-channels and neuropeptides; they have select peripheral and central targets and also exhibit varied functional response profiles (Julius, 2013; Le Pichon and Chesler, 2014; Nguyen et al., 2017; Zimmerman et al., 2014). Does the identity of a damaged neuron affect its transcriptional response to SNI? And are uninjured neurons affected at a transcriptional level? We reasoned that answering these questions would help address the etiology of neuropathic pain and used single nucleus (sn)-based RNA sequencing (Lacar et al., 2016) to examine the transcriptomic response to IOT at the level of the individual neurons. Our results revealed a dramatic change of gene expression in damaged neurons that transformed diverse classes of trigeminal neurons into a uniform and distinct injury-related state. Quite unexpectedly, we discovered that various types of minor peripheral injury induce very similar transcriptomic changes to IOT. Unlike SNI, injuries of this type do not trigger chronic pain. Thus, although some of the genes that are over-expressed following nerve damage may trigger neuropathic pain in extreme cases (Guan et al., 2016; Wlaschin et al., 2018), the physiological role for this transcriptional transformation of damaged neurons appears to be much more general and provides a mechanism for controlling somatosensory and painful input from sites of injury.

Results and discussion

sn-RNA sequencing provides an unbiased classification of trigeminal neurons

Single cell sequencing of neurons from the dorsal root and trigeminal ganglia has identified about a dozen cell-types and great similarity between the ganglia (Chiu et al., 2014; Gatto et al., 2019; Li et al., 2016; Nguyen et al., 2017; Usoskin et al., 2015). However, large diameter neurons expressing genes such as the mechanosensory channel Piezo2, neurofilament heavy polypeptide (Nefh), and protein S100β (S100b) were poorly represented in Dropseq sequencing of trigeminal neurons (Nguyen et al., 2017) probably because of selective loss of larger neurons during the dissociation and capture of single cells. We reasoned that transcriptomic analysis of nuclei (Lacar et al., 2016), which does not require cell purification (Figure 1a), might provide a less biased description of the neural complement of the trigeminal ganglion and used a targeted nuclear sequencing approach (Figure 1a) to selectively analyze sn-transcriptomes from more than 7500 neurons (Figure 1b). Major divisions between trigeminal neural-types that had been characterized by single cell sequencing (Nguyen et al., 2017) were segregated in the sn-analysis as distinct clusters expressing diagnostic markers (Figure 1c). Data from the nuclei much more closely matched the neural composition of the trigeminal ganglion (Nguyen et al., 2017) and were dominated by S100b-expressing large diameter neurons that now could be divided into several new sub-classes (Figure 1c). For simplicity, we have designated these new sub-classes of large diameter neurons by their relationship to the classes identified in the earlier analysis.
Figure 1.

sn-RNA sequence analysis of trigeminal neurons from uninjured control mice.

(a) Schematic representation of strategy used for selective sn-sequencing of trigeminal neurons. (b) UMap representation of cluster analysis for sn-data from 7546 trigeminal neurons; each cluster is assigned a distinct color. The designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). Several prominent genes that help distinguish the classes are listed. (c) Expression profiles of select genes in the UMap representation with relative cellular expression colored as indicated by the scale-bar. The expression profiles highlight the segregation of gene expression between clusters.

(a) Relative expression (see scale-bar) of immediate early genes Fos and Egr1 as well as injury response genes Atf3 and Gal in a tSNE representation of single cell sequencing data (Nguyen et al., 2017) shows that these transcripts were present in many cells. (b) Representative images of ISH for Fos and Egr1 (green) in the trigeminal ganglion demonstrate little or no expression in vivo; gray image: expression of the pan-neuronal probe Tubb3, detected by double labeling; scale-bar = 100 μm. (c) Expression of the four genes in the sn-data is almost undetectable. (d) Double label ISH showing that expression of Atf3 and Gal (green) versus Tubb3 (gray) match predictions from sn-data rather than the earlier single cell analysis (Nguyen et al., 2017).

sn-RNA sequence analysis of trigeminal neurons from uninjured control mice.

(a) Schematic representation of strategy used for selective sn-sequencing of trigeminal neurons. (b) UMap representation of cluster analysis for sn-data from 7546 trigeminal neurons; each cluster is assigned a distinct color. The designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). Several prominent genes that help distinguish the classes are listed. (c) Expression profiles of select genes in the UMap representation with relative cellular expression colored as indicated by the scale-bar. The expression profiles highlight the segregation of gene expression between clusters.

Isolation of trigeminal neurons modifies cellular expression of genes.

(a) Relative expression (see scale-bar) of immediate early genes Fos and Egr1 as well as injury response genes Atf3 and Gal in a tSNE representation of single cell sequencing data (Nguyen et al., 2017) shows that these transcripts were present in many cells. (b) Representative images of ISH for Fos and Egr1 (green) in the trigeminal ganglion demonstrate little or no expression in vivo; gray image: expression of the pan-neuronal probe Tubb3, detected by double labeling; scale-bar = 100 μm. (c) Expression of the four genes in the sn-data is almost undetectable. (d) Double label ISH showing that expression of Atf3 and Gal (green) versus Tubb3 (gray) match predictions from sn-data rather than the earlier single cell analysis (Nguyen et al., 2017). Since cells do not need to be dissociated and isolated for sn-transcriptome analysis there is little processing time during which gene-expression can change because of neuronal damage or stress. The benefit of using nuclear rather than cellular RNA sequencing and reduced handling was demonstrated by the accurate representation of immediate early genes like the proto-oncogene c-Fos (Fos) and early growth response protein 1 (Egr1) in the sn-data. Both genes were prominent in the earlier single cell analysis (Figure 1—figure supplement 1a; Nguyen et al., 2017). By contrast, in situ hybridization (ISH) did not detect at high level or a significant number of cells expressing these genes (Figure 1—figure supplement 1b), which instead matched data from sn-sequencing. Importantly, genes that are thought to be markers of neural damage such as Atf3 and Gal also corresponded to in situ hybridization results in the nuclei-based dataset but were much more frequently detected in sequencing of isolated cells (Figure 1—figure supplement 1). Thus sn-sequencing provides a valuable platform for studying changes in gene expression induced in response to cellular stress and damage as, for example, following SNI.
Figure 1—figure supplement 1.

Isolation of trigeminal neurons modifies cellular expression of genes.

(a) Relative expression (see scale-bar) of immediate early genes Fos and Egr1 as well as injury response genes Atf3 and Gal in a tSNE representation of single cell sequencing data (Nguyen et al., 2017) shows that these transcripts were present in many cells. (b) Representative images of ISH for Fos and Egr1 (green) in the trigeminal ganglion demonstrate little or no expression in vivo; gray image: expression of the pan-neuronal probe Tubb3, detected by double labeling; scale-bar = 100 μm. (c) Expression of the four genes in the sn-data is almost undetectable. (d) Double label ISH showing that expression of Atf3 and Gal (green) versus Tubb3 (gray) match predictions from sn-data rather than the earlier single cell analysis (Nguyen et al., 2017).

Rapid induction of a shared injured-neuron transcriptional state after peripheral axotomy

SNI causes changes in gene expression that are thought to play an important role in injury-related tactile allodynia and neuropathic pain (Basbaum et al., 2009; Costigan et al., 2009; Guan et al., 2016; Wlaschin et al., 2018). To study these changes at the level of individual neurons after nerve damage, mice were subjected to IOT and the ipsilateral trigeminal ganglion was isolated for sn-transcriptomics (Lacar et al., 2016). We began by examining transcriptional changes two days after nerve transection (Figure 2). In most SNI models, this time-point precedes maximal injury-related changes in mechanical allodynia (Cobos et al., 2018; Hardt et al., 2019; Wlaschin et al., 2018) but already induces expression of injury-related markers. Since IOT cuts just a subset of trigeminal fibers we expected that only a fraction of sn-transcriptomes would express injury induced genes. Indeed, most trigeminal neurons displayed a normal array of diverse gene expression profiles, clustering into classes (Figure 2a) corresponding to those seen in the uninjured control (Figure 1). By contrast, very few damaged neurons expressing Atf3 were associated with these standard trigeminal neural classes and, instead, clustered together in two new related groups, I1 and I2 that were well separated from uninjured neurons in the UMap projection (Figure 2a,b). In combination, I1 and I2 accounted for 635 of 4611 sequenced neurons (approx. 13.8%). Transcriptome analysis revealed that the injured neurons over-expressed a series of genes (Figure 2b and Figure 2—figure supplement 1a) including many that have been previously linked to nerve damage (Table 1a). We also confirmed this at a cellular level using ISH to co-localize several different injury-related markers (Figure 2—figure supplement 1b). However, since injury-related changes reflect the upregulation of a common transcriptional program (Wlaschin et al., 2018), it is possible that expression of this shared set of genes masks underlying differences between the injured neurons and hides residual similarity to their original identities. To investigate if this was the case, we re-clustered the sn-data excluding genes that were identified as up- or down-regulated in the Atf3-positive neural class from the clustering (see Materials and methods for detail). Remarkably, even without these injury-related transcripts playing a role, Atf3-expressing neurons still grouped together as two related classes and remained segregated from the uninjured trigeminal neural classes (Figure 2c, Figure 2—figure supplement 1c).
Figure 2.

Analysis of trigeminal neurons two days after IOT.

(a) UMap representation of sn-cluster analysis from 4611 trigeminal neurons isolated 2 days after IOT. Each cluster is assigned a distinct color and new injury-related clusters I1 and I2 are circled. The designations of uninjured neurons (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). (b) Expression profiles of select injury-related genes (relative cellular expression colored as indicated by the scale-bar) highlight strong upregulation of these genes in the I1 and I2 clusters (circled). (c) Re-clustered data: excluding genes that were prominently up- or down-regulated in injured neurons from analysis. I1 and I2 class cells (circled) still segregate from uninjured cell classes. (d–g) Representative images of double label ISH for Atf3 (red) and select genes (green) in trigeminal ganglia from control mice (upper panels) and animals 2 days after IOT (lower panels), illustrate (d, e) down-regulation of expression of several key genes (green) in injured neurons labeled by Atf3 (red). (f) There was less effect on expression of Piezo2 (green) in Atf3-positive cells (red); (g) Gal (green) was detected in a subset of injured neurons expressing Atf3 (red). (e) Lower magnification image showing that Scn10a (green) is almost totally excluded from regions of the ganglion where many neurons express Atf3 (red); scale bars = 100 μm for both magnifications; see Supplementary file 1 for quantitation and statistical analysis of ISH data.

(a) Heatmap showing expression of marker genes in classes of trigeminal neuron identified 2 days after injury. The five markers best identifying each class were determined from the sn-data; any marker is only plotted once; each column represents one cell. Increasing relative expression level is indicated: purple (low) to black (average) to yellow (high). Bars above the heatmap are colored and named to match Figure 2a. The injury-related classes I1 and I2 are highlighted by red boxes, and injury markers are indicated by green boxes. Note the low expression of most trigeminal neuron markers in I1 and I2. (b) Representative images of double label ISH demonstrating extensive co-expression of Atf3 (red) and other injury-related transcripts (green); scale-bar = 100 μm. (c) Expression of injury-related transcripts in the clustering of sn-data shown in Figure 1c. Note that injured cells and injury-related transcripts still segregate from other trigeminal neural classes in injured cells (circled).

Selected genes highlight expression differences between the two injured neurons classes I1 and I2 (labeled and circled in red). Most of these genes are also expressed in uninjured neurons; in each case classes expressing higher levels of the transcript are also identified (see Figure 1 for details). Genes selectively detected in I1 generally are expressed in large diameter neurons (classes C4-C6) whereas genes that mark I2 are mainly detected in other classes. This suggests that traces of original neural class are preserved in the injured neurons, with I1 derived from large diameter neurons and I2 from smaller cells. Note that Ntng1, which marks a subset of C4 and C5 neurons only labels a subset of the I1 cluster further supporting these conclusions. Also shown are Gfra1 and Gal expression: these genes are selectively upregulated in I1 and I2 cells (respectively). See Supplementary file 2 for additional details of gene expression differences between the I1 and I2 classes.

GO-analysis was carried out for genes that were identified as upregulated in one injured class relative to the other; all significantly enriched terms are shown. Both sets of genes identified several GO-terms that were significantly over-represented by I1 (red), I2 (blue) or both sets of markers (purple). Note that the term sensory perception of pain (GO:0019233) is over-represented by I2-enriched genes in keeping with predictions from sn-analysis that it is likely to be composed of injured small diameter neurons.

Figure 2—figure supplement 1.

Characterization of trigeminal neurons two days after spared nerve injury.

(a) Heatmap showing expression of marker genes in classes of trigeminal neuron identified 2 days after injury. The five markers best identifying each class were determined from the sn-data; any marker is only plotted once; each column represents one cell. Increasing relative expression level is indicated: purple (low) to black (average) to yellow (high). Bars above the heatmap are colored and named to match Figure 2a. The injury-related classes I1 and I2 are highlighted by red boxes, and injury markers are indicated by green boxes. Note the low expression of most trigeminal neuron markers in I1 and I2. (b) Representative images of double label ISH demonstrating extensive co-expression of Atf3 (red) and other injury-related transcripts (green); scale-bar = 100 μm. (c) Expression of injury-related transcripts in the clustering of sn-data shown in Figure 1c. Note that injured cells and injury-related transcripts still segregate from other trigeminal neural classes in injured cells (circled).

Table 1.

Genes up- and down-regulated in injured trigeminal neurons.

Genes that are affected by IOT were identified by comparing expression in the two injured neuron classes relative to other classes. (a) Selected up-regulated genes, their proposed functional role and previous assignment as injury-related transcripts (Cobos et al., 2018; Guan et al., 2016; Shin et al., 2019; Wlaschin et al., 2018) and/or as genes involved in neural regeneration (Mahar and Cavalli, 2018). (b) Selected down-regulated genes, their functional classification and previous assignment as injury-related transcripts (Shin et al., 2019). See Supplementary file 2; Supplementary file 3; Supplementary file 4 for more information about genes expression changes in injured neurons including magnitude of changes and probability that expression is altered and Figure 2—figure supplement 3 for GO-analysis.

Table 1a
GeneReported functional rolesReported previously1, 2
Atf3Transcriptional regulation: (up and downregulation) ATF/CREB family of transcription factorsa, b, c, D
Sema6aSemaphorin: receptor for Plxna2 role in cell-cell signaling and appropriate neural projectiona, b, c
Sox11Transcription factor: regulates survival and axonal growth in embryonic sensory neuronsa, b, D
GalNeuropeptide: modulation and inhibition of action potentialsa, b, c
NpyNeuropeptide: neuropeptide with multiple roles including reducing pain perceptiona, b, c
NtsNeuropeptide: multiple roles in neurotransmission/modulationa, b, c
Mmp16Metallopeptidase: extracellular matrix degradationa, b, c
Itgb6Integrin subunit: cell-cell interactions
Itga7Integrin subunit: cell-cell interactionsa, c
Myo10Headless myosin: roles in development and cell migrationa, c
Gfra1Receptor for GDNF: promotes neural survival and differentiation of neuronsa
Lmo7Signaling: negative feedback regulator of transforming growth factora, b
Pou2f1Transcription factor: prominent in developmenta, c

1Upregulated after SNI (a) Shin et al. (2019), (b) Wlaschin et al. (2018), (c) Cobos et al. (2018).

2Role in neural regeneration (D) Mahar and Cavalli (2018).

3Downregulated after SNI (a) Shin et al. (2019).

Analysis of trigeminal neurons two days after IOT.

(a) UMap representation of sn-cluster analysis from 4611 trigeminal neurons isolated 2 days after IOT. Each cluster is assigned a distinct color and new injury-related clusters I1 and I2 are circled. The designations of uninjured neurons (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). (b) Expression profiles of select injury-related genes (relative cellular expression colored as indicated by the scale-bar) highlight strong upregulation of these genes in the I1 and I2 clusters (circled). (c) Re-clustered data: excluding genes that were prominently up- or down-regulated in injured neurons from analysis. I1 and I2 class cells (circled) still segregate from uninjured cell classes. (d–g) Representative images of double label ISH for Atf3 (red) and select genes (green) in trigeminal ganglia from control mice (upper panels) and animals 2 days after IOT (lower panels), illustrate (d, e) down-regulation of expression of several key genes (green) in injured neurons labeled by Atf3 (red). (f) There was less effect on expression of Piezo2 (green) in Atf3-positive cells (red); (g) Gal (green) was detected in a subset of injured neurons expressing Atf3 (red). (e) Lower magnification image showing that Scn10a (green) is almost totally excluded from regions of the ganglion where many neurons express Atf3 (red); scale bars = 100 μm for both magnifications; see Supplementary file 1 for quantitation and statistical analysis of ISH data.

Characterization of trigeminal neurons two days after spared nerve injury.

(a) Heatmap showing expression of marker genes in classes of trigeminal neuron identified 2 days after injury. The five markers best identifying each class were determined from the sn-data; any marker is only plotted once; each column represents one cell. Increasing relative expression level is indicated: purple (low) to black (average) to yellow (high). Bars above the heatmap are colored and named to match Figure 2a. The injury-related classes I1 and I2 are highlighted by red boxes, and injury markers are indicated by green boxes. Note the low expression of most trigeminal neuron markers in I1 and I2. (b) Representative images of double label ISH demonstrating extensive co-expression of Atf3 (red) and other injury-related transcripts (green); scale-bar = 100 μm. (c) Expression of injury-related transcripts in the clustering of sn-data shown in Figure 1c. Note that injured cells and injury-related transcripts still segregate from other trigeminal neural classes in injured cells (circled).

Differences between I1 and I2 classes of injured neurons and relationship to uninjured neurons Gene expression in the sn-analysis shown in Figure 2 (relative expression indicated by scale-bar).

Selected genes highlight expression differences between the two injured neurons classes I1 and I2 (labeled and circled in red). Most of these genes are also expressed in uninjured neurons; in each case classes expressing higher levels of the transcript are also identified (see Figure 1 for details). Genes selectively detected in I1 generally are expressed in large diameter neurons (classes C4-C6) whereas genes that mark I2 are mainly detected in other classes. This suggests that traces of original neural class are preserved in the injured neurons, with I1 derived from large diameter neurons and I2 from smaller cells. Note that Ntng1, which marks a subset of C4 and C5 neurons only labels a subset of the I1 cluster further supporting these conclusions. Also shown are Gfra1 and Gal expression: these genes are selectively upregulated in I1 and I2 cells (respectively). See Supplementary file 2 for additional details of gene expression differences between the I1 and I2 classes.

GO-analysis of genes that are differentially expressed in I1 and I2.

GO-analysis was carried out for genes that were identified as upregulated in one injured class relative to the other; all significantly enriched terms are shown. Both sets of genes identified several GO-terms that were significantly over-represented by I1 (red), I2 (blue) or both sets of markers (purple). Note that the term sensory perception of pain (GO:0019233) is over-represented by I2-enriched genes in keeping with predictions from sn-analysis that it is likely to be composed of injured small diameter neurons.

Genes up- and down-regulated in injured trigeminal neurons.

Genes that are affected by IOT were identified by comparing expression in the two injured neuron classes relative to other classes. (a) Selected up-regulated genes, their proposed functional role and previous assignment as injury-related transcripts (Cobos et al., 2018; Guan et al., 2016; Shin et al., 2019; Wlaschin et al., 2018) and/or as genes involved in neural regeneration (Mahar and Cavalli, 2018). (b) Selected down-regulated genes, their functional classification and previous assignment as injury-related transcripts (Shin et al., 2019). See Supplementary file 2; Supplementary file 3; Supplementary file 4 for more information about genes expression changes in injured neurons including magnitude of changes and probability that expression is altered and Figure 2—figure supplement 3 for GO-analysis.
Figure 2—figure supplement 3.

GO-analysis of genes that are differentially expressed in I1 and I2.

GO-analysis was carried out for genes that were identified as upregulated in one injured class relative to the other; all significantly enriched terms are shown. Both sets of genes identified several GO-terms that were significantly over-represented by I1 (red), I2 (blue) or both sets of markers (purple). Note that the term sensory perception of pain (GO:0019233) is over-represented by I2-enriched genes in keeping with predictions from sn-analysis that it is likely to be composed of injured small diameter neurons.

1Upregulated after SNI (a) Shin et al. (2019), (b) Wlaschin et al. (2018), (c) Cobos et al. (2018). 2Role in neural regeneration (D) Mahar and Cavalli (2018). 3Downregulated after SNI (a) Shin et al. (2019). Given that injured neurons segregate from standard trigeminal neural classes even when the most diagnostic markers are ignored, we reasoned that many transcripts that normally define somatosensory neural classes must be dramatically down-regulated in the damaged cells. The expression heatmap of trigeminal markers (Figure 2—figure supplement 1a) confirmed this was generally the case. We next used ISH to independently examine down-regulation of key genes at a cellular level after nerve injury. The chosen genes, Trpv1, protachykinin 1 (Tac1), calcitonin gene-related peptide 1 (Calca), kainate one receptor (Grik1) and Scn10a are normally expressed at high levels in significant numbers of trigeminal neurons (Figure 2d,e upper panels). These genes were far less often present in Atf3-positive cells (Figure 2d,e, lower panels, see Supplementary file 1 for quantitation and statistical analysis). In addition, the few Atf3-positive cells expressing these transcripts typically exhibited reduced signal intensity when compared to the surrounding uninjured neurons (Figure 2d,e). Notably, for Scn10a, which is expressed in nearly half of the trigeminal neurons (Figure 1b, Figure 2e), this led to distinctive holes in its expression pattern across the regions of the ganglion where Atf3-positive neurons were strongly clustered (Figure 2e). Thus, in combination our data demonstrate that within 2 days of injury there is upregulation of a shared set of injury markers and strong downregulation of many genes that are normally prominent markers of the different trigeminal neural classes. Somatosensory neurons exhibit a diverse array of functions, conduction velocities, myelination states and central projections (Basbaum et al., 2009; Le Pichon and Chesler, 2014; Zimmerman et al., 2014), therefore the rapid collapse of all transcriptomic classes to a much less complex injured state was by far the most remarkable feature of our data. However, cluster analysis indicated that some differences between injured neurons divided them into two distinct but related classes: I1 and I2 (Figure 2a). Several genes that broadly distinguish groups of uninjured trigeminal neurons were also differentially represented in I1 and I2 (see Figure 2—figure supplement 2 for examples and their expression profiles in the injured and uninjured neural classes). I1 neurons typically expressed markers including protocadherin 7 (Pcdh7), Piezo2, netrin G1 (Ntng1), microtubule associated protein 2 (Map2) and FAT atypical cadherin 2 (Fat3) that normally are prominent in larger diameter neurons involved in more discriminative types of sensation. ISH confirmed that a large subset of injured neurons still expressed Piezo2 (Figure 2f). I2 neurons had an expression profile more related to nociceptors and instead expressed genes like tee-shirt homology domain 2 (Tshz2), regulator of G protein signaling 4 (Rgs4) and calcium voltage gated channel subunit alpha 1 c (Cacna1c) that are normally markers of smaller diameter neurons (Figure 2—figure supplement 2). Finally, by comparing the expression profiles of I1 and I2 neurons, we identified a few genes that were differentially upregulated after injury. For example, GDNF-family receptor 1 (Gfra1) was primarily expressed in I1 neurons (Figure 2—figure supplement 2). By contrast the neuropeptide Gal was largely restricted to I2 (Figure 2—figure supplement 2) and selectively labeled just a subset of injured neurons in double label ISH (Figure 2g). Genes that best distinguish I1 and I2 were subjected to gene enrichment ontology analysis (GO analysis, Figure 2—figure supplement 3). Although I2 markers were enriched in genes related to pain in line with our predictions, most pathways identified by this analysis were very general. Thus, taken together our data show that axon-transection induces a remarkably consistent transcriptional transformation in the diverse types of trigeminal neurons to produce an injured neural state retaining just vestiges of the gene expression patterns that distinguish classes of uninjured neurons.
Figure 2—figure supplement 2.

Differences between I1 and I2 classes of injured neurons and relationship to uninjured neurons Gene expression in the sn-analysis shown in Figure 2 (relative expression indicated by scale-bar).

Selected genes highlight expression differences between the two injured neurons classes I1 and I2 (labeled and circled in red). Most of these genes are also expressed in uninjured neurons; in each case classes expressing higher levels of the transcript are also identified (see Figure 1 for details). Genes selectively detected in I1 generally are expressed in large diameter neurons (classes C4-C6) whereas genes that mark I2 are mainly detected in other classes. This suggests that traces of original neural class are preserved in the injured neurons, with I1 derived from large diameter neurons and I2 from smaller cells. Note that Ntng1, which marks a subset of C4 and C5 neurons only labels a subset of the I1 cluster further supporting these conclusions. Also shown are Gfra1 and Gal expression: these genes are selectively upregulated in I1 and I2 cells (respectively). See Supplementary file 2 for additional details of gene expression differences between the I1 and I2 classes.

Long-term survival and transcriptional stability of injured trigeminal neurons

To assess how gene expression evolved after SNI, we carried out sn-transcriptomic analysis using ganglia isolated 7-, 21- and 75 days post injury and used a unified method (Butler et al., 2018) to co-cluster the sequencing data from the uninjured control and the four IOT time-points (Figure 3). As expected, uninjured classes of trigeminal neuron were all distinguished in this analysis and segregated from the injured neural classes (Figure 3a,b). However, the most striking feature revealed by our analysis was the stability of the clustering, including all the uninjured clusters and the two classes of injured neurons (I1, I2) across the time-course (Figure 3c). Indeed, the most salient difference between timepoints was the number of injured neurons. At 7 days after injury, 539 from 4033 of total neurons (approx. 13.4%) grouped into I1 and I2, similar to the 13.8% observed at day 2. However, by 21 days post injury only 288 of 4046 neurons (7.1%) segregated into the injury-related clusters and 75 days after surgery this ratio had fallen further to 104 of 3634 neurons (approx 2.9%). Therefore, although the injury-related states are very long-lived, there is a progressive loss of cells with these transcriptomic features at longer times after injury.
Figure 3.

Stability of the IOT induced injured neural state.

(a) UMap representation of sn-data: co-clustering of 20,692 trigeminal neurons from control uninjured mice and from mice at day 2, day 7, day 21, day 75 after IOT; injury-related classes I1 and I2 are circled; colors distinguish clusters identified in this analysis. (b) Expression of select genes (relative cellular expression indicated by the scale-bar) shows down-regulation of several key somatosensory genes in the injured neurons (circled) and upregulation of injury-related transcripts. (c) Cells from each of the four time-points after injury (green) are shown separately in UMap representations. For comparison the uninjured control data (red) are included in each plot. Throughout the time-course, both the injured neurons (circled) and uninjured neural classes remained stable in this representation of multidimensional space. Notably, however, the number of injured neurons decreased at 21 and 75 days. (d) UMap representation showing expression of three injury induced genes (gray, no expression; red, expression; injured cell-classes circled). Note that Lmo7 shows decreased expression after Day 2, whereas expression of Nts and Npy increases at these later time-points. (e) Representative images of triple label ISH using probes for the injury induced neuropeptides Gal (blue), Nts (red) and Npy (green) expose the complex co-expression patterns of these genes after IOT and upregulation of Nts and Npy at later time-points; scale-bar = 100 μm.

Stability of the IOT induced injured neural state.

(a) UMap representation of sn-data: co-clustering of 20,692 trigeminal neurons from control uninjured mice and from mice at day 2, day 7, day 21, day 75 after IOT; injury-related classes I1 and I2 are circled; colors distinguish clusters identified in this analysis. (b) Expression of select genes (relative cellular expression indicated by the scale-bar) shows down-regulation of several key somatosensory genes in the injured neurons (circled) and upregulation of injury-related transcripts. (c) Cells from each of the four time-points after injury (green) are shown separately in UMap representations. For comparison the uninjured control data (red) are included in each plot. Throughout the time-course, both the injured neurons (circled) and uninjured neural classes remained stable in this representation of multidimensional space. Notably, however, the number of injured neurons decreased at 21 and 75 days. (d) UMap representation showing expression of three injury induced genes (gray, no expression; red, expression; injured cell-classes circled). Note that Lmo7 shows decreased expression after Day 2, whereas expression of Nts and Npy increases at these later time-points. (e) Representative images of triple label ISH using probes for the injury induced neuropeptides Gal (blue), Nts (red) and Npy (green) expose the complex co-expression patterns of these genes after IOT and upregulation of Nts and Npy at later time-points; scale-bar = 100 μm. The consistent clustering patterns of the individual timepoints in the UMap projection (Figure 3c) from 2 to 75 days after injury rule out the possibility that either injured or uninjured neurons slowly transition into new states during this timeframe. Moreover, analyzing gene expression in the injured state neurons clusters more thoroughly (see Supplementary file 3), revealed just a small number of upregulated genes changed expression level after day 2. Examples include the Lim only domain protein 7 (Lmo7), which was rapidly upregulated but downregulated at later time-points and two injury-related neuropeptides Nts and Npy that were more slowly upregulated (Figure 3d). Multicolor ISH graphically demonstrated these temporal differences in neuropeptide expression at a cellular level (Figure 3e) and revealed the complex pattern of their expression in injured trigeminal neurons providing a clear example of variation amongst the injured cells. However, the most significant conclusion from the time-course of transcriptomic changes following injury was that within 2 days of IOT, damaged neurons adopted a very stable injured state that was quite distinct from any undamaged class of trigeminal neurons. In contrast, mechanical sensitization and tactile allodynia usually take a week or more to fully develop after nerve injury (Cobos et al., 2018; Hardt et al., 2019; Wlaschin et al., 2018). Therefore, our results are consistent with recent data suggesting that central processing of somatosensory input plays a major role in this type of neuropathic pain (Guan et al., 2016; Szczot et al., 2018).

Induction of the Atf3-transcriptional state is a physiological response to peripheral nerve damage

Nociception has an important role in guarding against immediate dangers and in teaching us to avoid risk (Basbaum et al., 2009; Julius, 2013). Similarly, trauma-induced pain probably plays a vital role in protecting animals from exacerbating injury (Cox et al., 2006; Goldberg et al., 2007). However, neuropathic pain does not serve such an evolutionarily significant purpose. Moreover, our results suggest that even if injury-related gene expression changes are required for nerve injur- related tactile allodynia (Guan et al., 2016; Wlaschin et al., 2018), the injury-related transcriptomic state develops long before pain symptoms are maximal. Therefore, we reasoned that the stereotyped transcriptional response that defines I1 and I2 likely has another and completely distinct role in somatosensation. Indeed, the presence of a small number of neurons in uninjured control animals that exhibited these gene expression profiles (Figure 3c) suggested that the injured state might be induced without axotomy and led us to investigate if modest nerve damage could trigger the transformation. Initial support for the idea that peripheral injury induces the same transcriptomic transformation as SNI came from studying sham IOT surgery controls that we had used for ISH analysis. This surgery involves a cut to the facial skin and blunt dissection of muscle to expose but not injure the nerve and thus results in a localized but significant peripheral injury. In mice subjected to this surgery, ISH consistently revealed a small number of Atf3 positive cells that were clustered together in the trigeminal ganglion (Figure 4a). These cells expressed several genes that are normally upregulated after nerve injury including Sox11, Sema6a, Csf1 and Gal (Figure 4a). We next investigated whether other types of mild peripheral injury also induced Atf3 expression. To do this, we used a minor facial injury model (a series of extensive skin incisions to the facial area that just cut through the dermis) and examined mice that exhibited a chronic itch-like phenotype where scratching had produced obvious shallow skin lesions in the head and neck area (scratch lesions). In both cases, Atf3-positive neurons were detected by ISH and just as in the case of sham surgery these cells also expressed other markers of nerve injury (Figure 4a). Thus, it appears that the same transcriptomic program (Wlaschin et al., 2018) is upregulated following various types of relatively minor peripheral injury as well as after transection of major branches of the trigeminal nerve. The three types of minor peripheral injury also downregulated functionally significant genes. Just as we showed after IOT (Figure 2), Atf3-positive neurons expressed only low levels of key genes including Scn10a, Calca, Tac1 and Trpv1 (Figure 4b), suggesting that the normal sensory function of these cells must be dramatically changed.
Figure 4.

Several types of peripheral injury triggered gene expression changes paralleling those induced by IOT.

Representative images of double label ISH, (Atf3, red) illustrate. (a) upregulation of other injury-related genes (green) and (b) down regulation of key somatosensory transcripts (green) in damaged neurons expressing Atf3. Uninjured control mice typically showed no Atf3 expression (top panels). In contrast three types of mild peripheral injury, IOT sham surgery, facial injury and lesions to the head and neck resulting from scratching (lower panels) induced Atf3-expression in a subset of regionally localized trigeminal neurons. Time points analyzed here were 2 days after injury for IOT sham surgery and facial injury models; scale-bar = 100 μm, see Supplementary file 1 for quantitation of data.

Several types of peripheral injury triggered gene expression changes paralleling those induced by IOT.

Representative images of double label ISH, (Atf3, red) illustrate. (a) upregulation of other injury-related genes (green) and (b) down regulation of key somatosensory transcripts (green) in damaged neurons expressing Atf3. Uninjured control mice typically showed no Atf3 expression (top panels). In contrast three types of mild peripheral injury, IOT sham surgery, facial injury and lesions to the head and neck resulting from scratching (lower panels) induced Atf3-expression in a subset of regionally localized trigeminal neurons. Time points analyzed here were 2 days after injury for IOT sham surgery and facial injury models; scale-bar = 100 μm, see Supplementary file 1 for quantitation of data. The similarity between injury models indicated that induction of the injury-related state is a normal response of somatosensory neurons to peripheral damage. However, our ISH results suggested that there might be some minor differences between models. For example, the level of expression of injury-related genes appeared more variable in animals with mild facial injury or scratch lesions (Figure 4a) than for those subjected to IOT (Figure 2—figure supplement 1b) and although Scn10a and Trpv1 expression was much weaker in injured cells (Figure 4b), they were detectable in a larger proportion of injured cells in these models than after IOT (Supplementary file 1). These differences may reflect a graded response to peripheral injury. We also observed many small diameter Gal-positive, Atf3-negative cells after these types of peripheral injury (Figure 4a) that were not detected following nerve transection (Figure 2a). On the one hand this may indicate that damage to nociceptors can induce distinct patterns of gene expression, but on the other, it may be that local effects of injury can influence gene expression in undamaged neurons. To explore these issues and to better and quantitatively define the extent to which mild peripheral injury mimics full axotomy, we carried out sn-transcriptomic analysis of trigeminal neurons from mice with facial injury and itch lesions (Figure 5, Figure 5—figure supplement 1). We did not carry out sn-sequence analysis for mice subjected to sham IOT surgery because of its localized and more severe nature.
Figure 5.

Neurons damaged by facial injury or scratching induce the same transcriptomic states as SNI.

(a) Co-clustering of sn-data (40,359 trigeminal neurons from a combination of control uninjured mice; mice at day 2, day 7, day 21, day 75 after SNI; facial injury-day 2, and scratch lesion models); each cluster is assigned a distinct color and injury-related classes I1 and I2 are circled. The designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). (b) Separate UMap plots of the data from the control, SNI-day 2, face injury and scratch injury models in the combined clustering; uninjured cells, gray, I1 cells, green; I2 cells, red; injured classes are circled. Note that both types of peripheral injury produce the same classes of injured cells as SNI; in both cases the proportion of I2 cells was higher than after nerve transection. Uninjured neurons cluster just as in control animals for all three injury models. (c) Injury induced transcripts Atf3 and Gal were prominently expressed by injured neural classes (circled) in all three models; relative expression colored as indicated by scale-bar. However, peripheral injury also up-regulated expression of Gal in C7-10 cells in line with ISH results (Figure 3).

(a) Cluster analyses of sn-data from 8660 trigeminal neurons isolated from mice with facial injury (left panel) and 7829 neurons from mice with scratch lesion (right panel). Injured neurons (black) are circled; other colors denote distinct clusters of cells, designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017). (b) Gene expression in the sn-analyses shown in (a), scale-bar indicates relative expression level; injured cells are circled. (c) Dot plot representation of gene expression in the cluster analysis shown in Figure 5; control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); facial injury (red); scratch lesion (purple). Relative expression level color-coded from gray to pure color (see scale-bar); the percent of neurons expressing a gene is depicted by dot size (lower scale). Note the highly consistent gene expression patterns in all clusters before and after injury, regardless of injury type. One exception is integrin beta 6 Itgb6, which was not upregulated in many cells after facial injury but was expressed in I1 and I2 in the other models.

Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); SNI-day 7 (cyan); facial injury (red); scratch lesion (purple); uninjured neurons have been pooled according to predicted size: large diameter (C4-6); small diameter (C1−3/C7-13). Relative expression level color-coded from gray to pure color as indicated); the percent of neurons expressing a gene is depicted by dot size (indicated). Control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Note many upregulated and most down regulated genes show great similarity in all injury models but some upregulated transcripts (boxed) were more prominent in the IOT injury model than after milder peripheral injury.

GO-analysis was carried out for genes that were identified as upregulated or downregulated in injured neurons relative to uninjured neurons; all significantly enriched terms are shown. Upregulated genes were enriched in GO-terms such as developmental process, system development, nervous system development, cell motility and cell adhesion. By contrast, down regulated genes were enriched in GO-terms related to neural function including synaptic signaling, regulation of sodium transport, regulation of transmembrane potential, action potential, sensory representation of pain.

Figure 5—figure supplement 1.

Peripheral injury induces gene expression changes matching those triggered by cutting major nerve branches.

(a) Cluster analyses of sn-data from 8660 trigeminal neurons isolated from mice with facial injury (left panel) and 7829 neurons from mice with scratch lesion (right panel). Injured neurons (black) are circled; other colors denote distinct clusters of cells, designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017). (b) Gene expression in the sn-analyses shown in (a), scale-bar indicates relative expression level; injured cells are circled. (c) Dot plot representation of gene expression in the cluster analysis shown in Figure 5; control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); facial injury (red); scratch lesion (purple). Relative expression level color-coded from gray to pure color (see scale-bar); the percent of neurons expressing a gene is depicted by dot size (lower scale). Note the highly consistent gene expression patterns in all clusters before and after injury, regardless of injury type. One exception is integrin beta 6 Itgb6, which was not upregulated in many cells after facial injury but was expressed in I1 and I2 in the other models.

Neurons damaged by facial injury or scratching induce the same transcriptomic states as SNI.

(a) Co-clustering of sn-data (40,359 trigeminal neurons from a combination of control uninjured mice; mice at day 2, day 7, day 21, day 75 after SNI; facial injury-day 2, and scratch lesion models); each cluster is assigned a distinct color and injury-related classes I1 and I2 are circled. The designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017) and do not distinguish between the new classes of cells identified here (see Supplementary file 4 for detailed description of trigeminal neural classes). (b) Separate UMap plots of the data from the control, SNI-day 2, face injury and scratch injury models in the combined clustering; uninjured cells, gray, I1 cells, green; I2 cells, red; injured classes are circled. Note that both types of peripheral injury produce the same classes of injured cells as SNI; in both cases the proportion of I2 cells was higher than after nerve transection. Uninjured neurons cluster just as in control animals for all three injury models. (c) Injury induced transcripts Atf3 and Gal were prominently expressed by injured neural classes (circled) in all three models; relative expression colored as indicated by scale-bar. However, peripheral injury also up-regulated expression of Gal in C7-10 cells in line with ISH results (Figure 3).

Peripheral injury induces gene expression changes matching those triggered by cutting major nerve branches.

(a) Cluster analyses of sn-data from 8660 trigeminal neurons isolated from mice with facial injury (left panel) and 7829 neurons from mice with scratch lesion (right panel). Injured neurons (black) are circled; other colors denote distinct clusters of cells, designations (C1–C13) are based on earlier single cell data (Nguyen et al., 2017). (b) Gene expression in the sn-analyses shown in (a), scale-bar indicates relative expression level; injured cells are circled. (c) Dot plot representation of gene expression in the cluster analysis shown in Figure 5; control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); facial injury (red); scratch lesion (purple). Relative expression level color-coded from gray to pure color (see scale-bar); the percent of neurons expressing a gene is depicted by dot size (lower scale). Note the highly consistent gene expression patterns in all clusters before and after injury, regardless of injury type. One exception is integrin beta 6 Itgb6, which was not upregulated in many cells after facial injury but was expressed in I1 and I2 in the other models.

Additional quantitation of genes up- and downregulated in injured trigeminal neurons Dot plot representation of gene expression in the cluster analysis shown in Figure 5.

Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); SNI-day 7 (cyan); facial injury (red); scratch lesion (purple); uninjured neurons have been pooled according to predicted size: large diameter (C4-6); small diameter (C1−3/C7-13). Relative expression level color-coded from gray to pure color as indicated); the percent of neurons expressing a gene is depicted by dot size (indicated). Control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Note many upregulated and most down regulated genes show great similarity in all injury models but some upregulated transcripts (boxed) were more prominent in the IOT injury model than after milder peripheral injury.

GO-analysis of genes that are up- and downregulated in injured neurons.

GO-analysis was carried out for genes that were identified as upregulated or downregulated in injured neurons relative to uninjured neurons; all significantly enriched terms are shown. Upregulated genes were enriched in GO-terms such as developmental process, system development, nervous system development, cell motility and cell adhesion. By contrast, down regulated genes were enriched in GO-terms related to neural function including synaptic signaling, regulation of sodium transport, regulation of transmembrane potential, action potential, sensory representation of pain. Initial clustering of the two datasets from mice with facial injury or scratch lesions (Figure 5—figure supplement 1) revealed that most neurons grouped into clusters resembling those identified from uninjured control mice (Figure 1). However, in both cases an additional class of cells clustered separately (Figure 5—figure supplement 1a) and expressed several markers of damaged trigeminal neurons (Figure 5—figure supplement 1b). The injury-related cells accounted for approximately 1.3% and 2.7% of total neurons in the facial injury and scratch lesion models, respectively. To better assess how these neurons were related to the I1 and I2 classes that result from IOT, we co-clustered all data (Figure 5a) and then compared the two peripheral injury models with effects of nerve transection (Figure 5b,c). This approach makes use of information about the cellular expression level of many genes both to define and display clusters (Butler et al., 2018) and thus is highly quantitative. Remarkably, Atf3-positive neurons from both minor injury models were grouped with I1 and I2 neurons from IOT mice (Figure 5b). There were small differences, for example, in scratch lesion mice, most damaged neurons were in the I2 class with several likely related to normal C3 neurons (Figure 5b). Such variation may reflect the type of injury and/or the innervation of the injured sites by a slightly different distribution of neural-classes from those damaged in the IOT model. One other difference that was evident for both minor injury models was low-level upregulation of Gal in neurons outside the I1 and I2 classes (Figure 5c) in keeping with ISH results (Figure 4a). However, these data and additional gene expression analysis (Figure 5—figure supplement 1c and Figure 5—figure supplement 2) confirm great similarity but not complete identity between the transcriptomic profiles of neurons damaged in peripheral injury models and after nerve transection.
Figure 5—figure supplement 2.

Additional quantitation of genes up- and downregulated in injured trigeminal neurons Dot plot representation of gene expression in the cluster analysis shown in Figure 5.

Dot color indicates dataset: uninjured control (green); SNI-day 2 (blue); SNI-day 7 (cyan); facial injury (red); scratch lesion (purple); uninjured neurons have been pooled according to predicted size: large diameter (C4-6); small diameter (C1−3/C7-13). Relative expression level color-coded from gray to pure color as indicated); the percent of neurons expressing a gene is depicted by dot size (indicated). Control data are not included for injured cells because very few control neurons were identified as clustering in either I1 or I2 (Figure 5). Note many upregulated and most down regulated genes show great similarity in all injury models but some upregulated transcripts (boxed) were more prominent in the IOT injury model than after milder peripheral injury.

Genetically marking the injured state neurons reveals their long-term fate

Since induction of an injured neural state appears to be a physiologically relevant somatosensory neural response to a variety of peripheral injuries, we anticipated that it normally would play a role in the recovery process and therefore, that changes in gene expression should often be reversible. Indeed, after facial cuts had healed, ISH localization anecdotally indicated decreased expression of injury-related transcripts. Nonetheless, even three weeks after injury and thus long after healing of the skin, a few Atf3-positive cells were still observed in the trigeminal ganglion. The time-dependent decrease in proportion of neurons with an injury-related transcriptional profile after IOT (Figure 3) and the absence of new transcriptomic clusters (Figure 3) also indicated that recovery might occur even after nerve transection. However, in both cases it is equally possible that injured neurons progressively die, and indeed significant cell death after SNI has been well characterized (Himes and Tessler, 1989; Vestergaard et al., 1997). Therefore, to explicitly test if neurons can recover after entering the injured state, we generated Atf3-IRES-Cre knockin mice, where damaged neurons could be permanently marked using Cre-recombinase activity (see Figure 6—figure supplement 1 for details). We then used a viral strategy to transduce a subset of trigeminal neurons by intraperitoneal injection of a Cre-dependent adeno associated virus (AAV9-CAG-flex-tdTomato) in neonate knockin mice (Szczot et al., 2018). This approach transduces many somatosensory neurons but avoids complications from developmental expression of Atf3. As expected, adult animals, not subjected to nerve injury exhibited only very sparse expression of Atf3 and no detectable tdTomato in trigeminal neurons (Figure 6a). In contrast, after IOT, prominent labeling of trigeminal neurons with tdTomato was observed (Figure 6b–d). Note that the viral labeling strategy targets about 30–50% of trigeminal neurons meaning that only a proportion of the Atf3-Cre neurons (green) activate tdTomato expression (red).
Figure 6—figure supplement 1.

Generation and characterization of Atf3-IRES-Cre mice.

(a) Scale representation of the Atf3 gene (5’ to 3’ left to right); exons shown boxed with coding sequence black and the targeted Cas9 cleavage site in the non-coding 3’ regions indicated. The targeting construct and targeted locus are shown below: gray box, IRES, yellow box Cre. Positive founders were identified by diagnostic nested PCR. (b) Representative images of triple label ISH of sections through the trigeminal ganglion. Left panel before injury neurons (Tubb3-positive, blue) did not express Atf3 (red) or Cre (green). 2 days after IOT surgery a subset of trigeminal neurons were now positive for Atf3. As expected, all Atf3 cells also expressed Cre; scale-bar = 100 μm. See also Figure 6 demonstrating Cre-recombinase activity in this line.

Figure 6.

Injured neurons revert to an uninjured transcriptional state.

Representative triple label ISH showing sections from Atf3-IRES-Cre mice where a subset of peripheral neurons has been transduced by AAV9-CAG-flex-tdTomato; (a) Before injury (Control), (b) 7 days and (c,d) 21 days after IOT. Upper panels show staining for Atf3 (green) and tdTomato (red): before injury no positive cells were detected; day 7 most tdTomato positive neurons also expressed Atf3; day 21 about half the tdTomato positive neurons were Atf3-negative. Note because of the viral approach not all Atf3-positive cells express tdTomato. Lower panels show the same images but include expression of Calca or Scn10a (blue) demonstrating that these genes are rarely co-expressed with Atf3 but are regularly found in cells labeled by tdTomato but not Atf3; arrowheads (c,d) point to tdTomato-positive cells which also express (c) Calca or (d) Scn10a. Scale-bar = 100 μm; see Supplementary file 1 for quantitation and statistical analysis.

(a) Scale representation of the Atf3 gene (5’ to 3’ left to right); exons shown boxed with coding sequence black and the targeted Cas9 cleavage site in the non-coding 3’ regions indicated. The targeting construct and targeted locus are shown below: gray box, IRES, yellow box Cre. Positive founders were identified by diagnostic nested PCR. (b) Representative images of triple label ISH of sections through the trigeminal ganglion. Left panel before injury neurons (Tubb3-positive, blue) did not express Atf3 (red) or Cre (green). 2 days after IOT surgery a subset of trigeminal neurons were now positive for Atf3. As expected, all Atf3 cells also expressed Cre; scale-bar = 100 μm. See also Figure 6 demonstrating Cre-recombinase activity in this line.

Injured neurons revert to an uninjured transcriptional state.

Representative triple label ISH showing sections from Atf3-IRES-Cre mice where a subset of peripheral neurons has been transduced by AAV9-CAG-flex-tdTomato; (a) Before injury (Control), (b) 7 days and (c,d) 21 days after IOT. Upper panels show staining for Atf3 (green) and tdTomato (red): before injury no positive cells were detected; day 7 most tdTomato positive neurons also expressed Atf3; day 21 about half the tdTomato positive neurons were Atf3-negative. Note because of the viral approach not all Atf3-positive cells express tdTomato. Lower panels show the same images but include expression of Calca or Scn10a (blue) demonstrating that these genes are rarely co-expressed with Atf3 but are regularly found in cells labeled by tdTomato but not Atf3; arrowheads (c,d) point to tdTomato-positive cells which also express (c) Calca or (d) Scn10a. Scale-bar = 100 μm; see Supplementary file 1 for quantitation and statistical analysis.

Generation and characterization of Atf3-IRES-Cre mice.

(a) Scale representation of the Atf3 gene (5’ to 3’ left to right); exons shown boxed with coding sequence black and the targeted Cas9 cleavage site in the non-coding 3’ regions indicated. The targeting construct and targeted locus are shown below: gray box, IRES, yellow box Cre. Positive founders were identified by diagnostic nested PCR. (b) Representative images of triple label ISH of sections through the trigeminal ganglion. Left panel before injury neurons (Tubb3-positive, blue) did not express Atf3 (red) or Cre (green). 2 days after IOT surgery a subset of trigeminal neurons were now positive for Atf3. As expected, all Atf3 cells also expressed Cre; scale-bar = 100 μm. See also Figure 6 demonstrating Cre-recombinase activity in this line. We reasoned that if the gradual loss of damaged neurons (approx. 50% after 21 days) exclusively reflected cell death (Himes and Tessler, 1989; Vestergaard et al., 1997) then tdTomato labeled neurons would always express Atf3 (and their number would decrease with time). However, if they also reverted to an uninjured transcriptional state, these cells would continue to express tdTomato even though they were no longer positive for Atf3. Our results (Figure 6b–d) show that the fraction of Atf3 negative, tdTomato-positive (red-only) neurons rose with time after injury indicating a progressive recovery occurs. Quantitation of data revealed that the percentage of tdTomato-neurons that were Atf3-negative rose from 11.0 ± 5.3% at day-7 to 42.7 ± 14.7% at day-21 (see Supplementary file 1 for details and statistics). This change parallels the decrease in number of I1 and I2 neurons identified by sn-transcriptomics (Figure 3), demonstrating that even after IOT many of the damaged neurons recover rather than die. These cells must reacquire a normal trigeminal neuron gene expression profile since no new classes of trigeminal neuron were detected in corresponding sn-analysis (Figure 3). Further support for this conclusion comes from examination of genes that are downregulated in Atf3-positive cells after injury. For example, Calca and Scn10a were very rarely co-expressed with Atf3 (Figure 6 lower panels) but were detected in a large subset (approx. 40%, see Supplementary file 1 for quantitation and statistics) of the recovered neurons (Figure 6c,d). In the future, it will be important to assess whether neurons return to their own original transcriptional state after recovery from injury. However, the residual traces of original neural class that were retained amongst damaged neurons (Figure 2—figure supplement 2) make this the most likely scenario. It will also be interesting to see if some neural classes exhibit slower recovery and if the severity of the injury model makes a difference in this regard.

Concluding remarks

Our results expose four key features that suggest the gene expression changes linked to SNI and the development of tactile allodynia have a much broader role as a neural response to many types of peripheral injury. First, we demonstrated that a stereotyped injured neural state is not only induced by nerve transection but also by other far less significant types of trauma. Minimal injury such as self-inflicted scratch lesions or cuts through the dermis but not deeper layers of the skin induced a very similar change in neural gene-expression profile to nerve transection. In part, this may have been missed previously because studies of nerve injury typically do not examine such minor trauma, but the power of looking at gene-expression at the single-cell level was also important. Using ISH, we showed that sham IOT surgery (another minor injury model that is less extensive) also induced injury-related transcripts in a few neurons. Second, many of the genes that are upregulated by injury have roles in tissue remodeling, neural development, and axon guidance (see Table 1a and Figure 5—figure supplement 3). These genes probably contribute to restoration of normal peripheral innervation of tissue during wound healing (Shin et al., 2019). Thirdly, the injury response involves downregulation of genes encoding receptors, ion channels and neuropeptides that normally play major roles in sensory detection and signaling (see Table 1b and Figure 5—figure supplement 1). We speculate that this widespread transcriptomic silencing of functionally relevant molecules may help prevent damaged neurons from conveying aberrant sensory input to central targets. Fourthly, genetic marking of damaged cells using a new Atf3-IRES-Cre line (Figure 5) and sn-transcriptomic data (Figures 1 and 2) show that the injury-induced state, although potentially long-lived, is transient and likely to be reversible. Thus, rather than simply being a predictor of morbidity after serious nerve damage, we surmise that the transcriptomic transformation induced by axotomy is in fact a standard response to many types of peripheral trauma probably serving as an important driver for restoration of sensation and providing a mechanism for modulating sensory input from sites of injury.
Figure 5—figure supplement 3.

GO-analysis of genes that are up- and downregulated in injured neurons.

GO-analysis was carried out for genes that were identified as upregulated or downregulated in injured neurons relative to uninjured neurons; all significantly enriched terms are shown. Upregulated genes were enriched in GO-terms such as developmental process, system development, nervous system development, cell motility and cell adhesion. By contrast, down regulated genes were enriched in GO-terms related to neural function including synaptic signaling, regulation of sodium transport, regulation of transmembrane potential, action potential, sensory representation of pain.

Single cell sequencing has vastly expanded the definition of neural class, with the general assumption that distinct transcriptomic classes are fundamentally different types of cell (Li et al., 2016; Nguyen et al., 2017; Tasic et al., 2018; Usoskin et al., 2015; Zeisel et al., 2018). Here, sn-sequencing defined a dozen new types of large diameter trigeminal neurons (Supplementary file 2) that may have select functions in various types of mechanosensitive response. Notably, however, we also demonstrated that the transcriptomic diversity that defines 27 distinct classes of uninjured trigeminal neurons is almost completely lost within 2 days of nerve injury. This would be remarkable enough if the transformation required gross neural damage but is all the more so because relatively minor peripheral injury also triggers this abrupt transition. Working out the signaling mechanisms that preserve normal neural gene expression and cause its collapse after injury will be of great interest. However, the simple fact that the different transcriptomic classes can all be rapidly transformed to a much more uniform state (and then reappear on recovery from injury) exposes great transcriptional plasticity amongst somatosensory neurons. What is the role of the injured state in triggering neuropathic pain? Here we demonstrate that in this experimental model the injury-related gene expression program is essentially complete two days after IOT and thus precedes the peak development of pain (Cobos et al., 2018; Hardt et al., 2019; Wlaschin et al., 2018). Thus, it is likely that symptoms are induced well downstream of gene-regulation in injured cells in keeping with recent studies suggesting that neuropathic pain and mechanical allodynia primarily involves modulation of central processing rather than altered sensory input (Guan et al., 2016; Szczot et al., 2018). Further support for this comes from the fact that uninjured neurons are unchanged at a transcriptomic level after SNI. It is interesting that more minor injuries can induce a very similar pattern of gene expression, raising the possibility that long-term peripheral trauma and delayed recovery might have some potential to trigger similar types of neuropathy to more frank nerve injury. Finally, we note that the type of nerve damage caused by transection makes it unlikely that precise reinnervation of target sites can be required for neurons to initiate the transition back to normal function. Indeed, it is possible that aberrant signaling from neurons with inappropriate peripheral endings could contribute to some types of pain and sensory disturbances associated with severe injuries. In the future, we expect that genetic approaches using the Atf3-Cre driver to ablate and silence damaged neurons will help address these issues and reveal if and when these injured neurons are required for development (and perhaps resolution) of various types of pain.

Materials and methods

Mice, surgery and viral transduction

Animal experiments were carried out in strict accordance with the US National Institutes of Health (NIH) guidelines for the care and use of laboratory animals and were approved by the NIDCR ACUC. Male and female mice were used for all experiments but were not analyzed separately; animals were assigned to groups without randomization. Mice were C57BL/6NCrl except where specified and were 6 weeks or older at the time of surgery. IOT was carried out as previously described (Xu et al., 2008) and cut the superficial three branches of the infraorbital (trigeminal) nerve, which were not ligated. Sham IOT surgery exposed these branches, but the nerve was not cut or damaged, while facial injury involved a series of 3–5, approx. 0.6 cm cuts to the facial skin but did not penetrate deeper tissues; mice were used 2 days post injury in each of these mild injury models. Atf3-IRES-Cre mice were generated by homologous recombination in C57BL/6J mouse zygotes using clustered regularly interspersed short palindromic repeats (CRISPR) associated protein 9 (Cas9) to assist targeting (Wu et al., 2018) see Figure 6—figure supplement 1 for details and characterization of the line. Intraperitoneal injection of AAV9-CAG-FLEX-tdTomato-WPRE was carried out in heterozygous neonate animals (Szczot et al., 2018). A standard transgenic line (random insertion in the genome) with a tetO repeat upstream of a mCherry-2A-Gnaq mutant allele encoding constitutively active Gqα was generated by pronuclear injection. The constitutively active Gqα was engineered by substituting the glutamine (CAA) at position 209 with a leucine (CTA). The mice with scratch lesions were a double heterozygous transgenic strain where a TetTag, Fos-tTA (Reijmers et al., 2007) drove expression of this tetO-mCherry-2A-Gnaq mutant. These mice invariably developed an itch-like phenotype, characterized by excessive scratching at 5–8 weeks of age that rapidly resulted in development of skin lesions. As expected, feeding the mice a doxycycline containing diet prevented the development of this phenotype. However, no expression of mCherry was detected in somatosensory neurons either before or after mice began to exhibit itch-like behavior; thus, the cause of scratching remains unclear. For the studies reported here, mice with visible lesions in the head and neck area were selected.

Isolation of trigeminal neural nuclei

Trigeminal ganglia were harvested and incubated overnight in RNAlater (ThermoFisher, Cat# AM7021) at 4°C. Excess RNAlater was removed, ganglia were frozen on dry ice and stored at −80°C. To isolate nuclei, we adapted methods described previously (Sathyamurthy et al., 2018) to the trigeminal ganglion. To generate sufficient nuclei for capture and sequencing, we pooled ganglia from several animals (males and females). For initial Dropseq capture (a subset of the uninjured controls only) we used 16 mice; 10X Chromium-based sequencing used ganglia from 10 animals in all cases except the 75 days post IOT, which was from six mice. Ganglia were homogenized in a Dounce homogenizer (Fisher Scientific, Cat# 357538); five strokes with the ‘loose’ pestle (A) and 15 strokes with the ‘tight’ pestle (B) in 1 ml of freshly prepared ice-cold homogenization buffer (250 mM sucrose, 25 mM KCl, 5 mM MgCl2, 10 mM Tris, pH 8.0, 1 µM DTT, 0.1% Triton X-100 (v/v). The homogenate was filtered through a 40 µm cell strainer (ThermoFisher, cat# 08-771-1), transferred to low bind microfuge tubes (Sorenson BioScience, cat# 11700) and centrifuged at 800 g for 8 mins at 4°C. The supernatant was removed, the pellet gently resuspended in 500 µl of PBS with 1% BSA and SUPERaseIn RNase Inhibitor (0.2 U/µl; ThermoFisher, Cat#AM2696) and was incubated on ice for 10 min. Neuronal nuclei selection was performed by incubating the sample with a rabbit polyclonal anti-NeuN antibody (Millipore, cat#ABN78) at 1:2000 with rotation at 4°C for 30 min. The sample was then washed with 500 µl of PBS with 1% BSA and SUPERaseIn RNase Inhibitor and centrifuged at 800 g for 8 mins at 4°C. The resulting pellet was resuspended in 80 µl of PBS, 0.5% BSA, 2 mM EDTA. 20 µl of anti-rabbit IgG microbeads (Miltenyi biotec, cat# 130-048-602) were added to the sample followed by a 20 min incubation at 4°C. Nuclei with attached microbeads were isolated using LS column (Miltenyi Biotec, cat# 130-042-401) according to the manufacturer’s instruction. The neural nuclei enriched eluate was centrifuged at 500 g for 10 min, 4°C. The supernatant was discarded, and the pellet was resuspended in 1.5 ml of PBS with 1% BSA. To disrupt clumped nuclei, the sample was homogenized on ice with an Ultra-Turrax homogenizer (setting 1) for 45 secs. An aliquot was then stained with trypan blue and the nuclei were counted using a hemocytometer. The nuclei were pelleted at 800 g, 8 mins at 4°C and resuspended in an appropriate volume for Dropseq or 10X Chromium capture. A second count was performed to confirm nuclei concentration and for visual inspection of nuclei quality.

Droplet capture of single nuclei, cDNA sequencing and data analysis

Dropseq capture (for a subset of control data only) and library generation were performed as described previously (Nguyen et al., 2017) with the following modification: the concentration of sarkosyl in the lysis buffer was doubled to decrease the droplet size. 10X Chromium capture (control and all injury data) and library generation were performed according to manufacturer’s instructions using v2 chemistry kit. Next generation sequencing was performed using Illumina sequencers. Dropseq data were mapped to the transcriptome as described previously (Nguyen et al., 2017) except that the gene structure was modified to include intronic sequence (pre-mRNA modified mouse genome mm10). 10X Chromium data were mapped using CellRanger and the same pre-mRNA modified mouse genome (mm10). Data analysis used the Seurat V2 and V3 packages developed by the Satija lab and followed standard procedures (Butler et al., 2018; Stuart et al., 2018). For sn-RNA sequencing experiments cell filtering was performed as follows: outliers were identified and removed based on number of expressed genes and mitochondrial proportion as is standard practice in single cell transcriptomic analysis. In addition, all data were clustered using standard methods, any residual non-neuronal cell clusters were identified by their gene expression profiles: clusters not expressing somatosensory genes like Scn9a, Scn10a, Piezo2, etc. but instead expressing highly elevated levels of markers of non-neuronal cells including Prp1, Mbp, Apod, Apoe were tagged as non-neuronal and were removed prior to the clustering reported here. Outside single cell experiments no data were excluded. Reclustering data excluding specific genes was achieved by analyzing data for significantly up- or down-regulated transcripts and removal of these genes from the list of variable genes used in principle component selection prior to standard clustering. Numbers of sn-transcriptomes analyzed were typical for this type of experiment. GO-analysis was performed using the Gene Ontology Resource (Ashburner et al., 2000; The Gene Ontology Consortium, 2018).

In situ hybridization

Trigeminal ganglia from mice aged 6 weeks and older were harvested and fresh frozen in OCT (Tissue-Tek). 10 µm sections were used for multi-color in situ hybridization using RNAscope Multiplex Fluorescent Assay (Advanced Cell Diagnostics) according to the manufacturer’s instructions. Confocal images were acquired with a Nikon C2 Eclipse Ti (Nikon) at 1 µm optical section. All images are maximum projection (collapsed) stacks of 10 individual optical sections; consistency of staining was assessed using multiple sections from at least three mice as is considered standard; images were processed using Adobe Photoshop CC to adjust brightness, contrast and set channel color for display. Because expression of Atf3 was strongly clustered in the trigeminal ganglion of IOT, sham surgery and facial injury models, images shown for controls and all injury models are of this region. Cell counts were determined from images of multiple sections from three animals. Total neuronal counts were determined using ISH for tubulin beta type 3 (Tubb3), injured neurons were identified using ISH for Atf3 and recovered neurons (Figure 6) were defined as tdTomato-positive, Atf3-negative. The fraction of these populations positive for a specific marker gene was determined for each section in a series; the reported expression levels (Supplementary file 1) are the mean ± standard deviation across sections because biological variation includes regional differences in expression of genes in the trigeminal ganglion. Sections were collected from three mice for all quantitation. Statistical analysis of ISH data was carried out using Graph Pad Prism and is reported in Supplementary file 1. For simple comparisons we used Welch’s t-test since it makes no assumption of equal variance; multiple comparisons used a one-way ANOVA with Dunnett’s T3 post hoc testing since we were only testing one dataset against two others.

Data availability statement

All sequence data have been deposited in GEO (Accession number: GSE131272). Other data that support the findings of this study are available from the corresponding author upon request. There are no restrictions on data availability. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Stereotyped transcriptomic transformation of somatosensory neurons in response to injury" for consideration by eLife. Your article has been reviewed by four peer reviewers, including Peggy Mason as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Eve Marder as the Senior Editor. The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. This work suggests that injured trigeminal neurons from animals with a wide range of injuries – from a scratch to a nerve crush – will de-differentiate into a phenotype that is common to all afferent types. The independence of phenotype from afferent type and the range of injuries that yield this are both exciting new developments. Yet the conclusions are more intriguing and appealing than the data are compelling. To do justice to this work, the authors are requested to expand, increase the quantification, and all-around sharpen the results and figures. Thus, the reviewers all believe that the authors would be best served by tightening the results up substantially. Areas that would benefit from attention include but are not limited to the following. - Place a clear methodological description of the minimal injury that yields the common phenotypic change in the results narrative. And explicitly compare the minimal injury to sham surgery. - A full analysis of RNAseq data, that goes beyond a list of genes in a table, such as GO, pathway analysis, transcription factor binding site analysis etc. - Provide detailed description of the mice used and validation of the Atf3-IRES-Cre knockin mouse generated. Please use the detailed comments of the reviewers. We look forward to a substantial revision, Reviewer #1: This is an exciting contribution that takes a new look at the idea that changes in gene regulation are critical to the generation of neuropathic pain. Support for this attractive idea derives from abundant studies looking at the upregulation of genes in DRG cells after peripheral injury. Here the authors look at several far more innocuous manipulations beyond the typical constriction/partial transection injury. And surprisingly these manipulations cause similar genetic changes as do the frank injuries. These findings suggest that the role of changes in gene regulation to the generation of neuropathic pain is at least more nuanced than currently formulated. Additional findings (e.g. all types of cells adopt a pair of injured cell profiles) round out this contribution. While these findings are exciting, this reviewer has a request and a concern: 1) The impact of these findings on the idea that changes in gene regulation are critical to the generation of neuropathic pain should be discussed explicitly. These results suggest that by not looking at more innocuous / acute manipulations, previous research may have missed the full natural history of gene expression changes after peripheral damage. Please add this to the Discussion. 2) The results are not compelling because the figures do not illustrate the results in a compelling fashion. The results wrt the sham controls are also confusing. Were there changes after sham surgeries? Why isn’t sham listed in Figure 5—figure supplement 1C. Reviewer #2: The authors combined single-nuclei RNAseq of isolated trigeminal neuronal nuclei with in situ hybridization (ISH) to characterize changes in gene expression after infraorbital trigeminal nerve transection (IOT) or a more moderate facial cut injury. The authors find that IOT leads to two new injury related clusters, with peak cell numbers 2-7dpi followed by a progressive decline starting 21dpi. They find that facial cut injury with or without scratching also generates two similar injury related clusters albeit with far less cells in each cluster. ISH was performed to validate these findings by showing either the presence or absence of colocalization of select genes with the injury-marker gene ATF3. Overall, the conclusions are modest, expected, and narrow in scope. Further, the RNAseq data provides little analysis beyond identification of neuronal clusters and the ISH experiments lack scientific rigor. Hence, the impact of the paper is limited. This work might be more suitable to be published as a resource rather than a research. The major finding of the RNAseq data is that injured peripheral neurons alter their gene expression and form distinct cluster(s), whether injury occurs to the nerve or the terminations in the facial skin, and that this clustering persists yet subsides over time. This conclusion lacks novelty and rather mainly validates decades of research on this topic. No additional analysis is done with the RNAseq data (e.g., GO/Pathway Analysis). The authors perform no quantification or statistical testing for the ISH experiments and basic controls are not used (Figure 1D-G – uninjured staining for Atf3 and select genes). In Figure 1D-G, Atf3 expression looks very high and might not match the number of injured cells reported in the sequencing (13.8%). Clarification of total number of neurons using a general neuronal marker can help. The 'tables' provided appear to be raw data excel files generated by the sequencing software more suitable to be labeled as supplements rather than 'tables'. Tables a1 and a2 are mentioned but not included in the current version. The sn-transcriptomics experiments represent a mix of sequencing from different platforms (DropSeq- for controls and 10X genomics for injuries). This inconsistency can lead to misinterpretation of the results. Information on sequencing depth and counts normalization is missing. In Figure 3, there is no mention of time post injury where the ISH was done. Quantification of co-localized markers would help. In Figure 4, does control represent sham-injury as in Figure 3? In Figure 5, quantifications of images are necessary. Some indication on the infection rate of the virus are needed, since on day 7 it looks like only about 50% of Atf3 cells are also TdTomato positive. Details on the Atf3 -IRES-cre mice are missing, are these homozygous or heterozygous. Claiming injury does not lead to cell death of injured cells should be shown by using a dead cell marker. Using the Atf3-cre; Flx TdTomato together with markers for different neuronal cell types could shed light on the injured cells identity following an injury. Reviewer #3: In general this is a well written study about an interesting topic and the results are of fundamental importance. Namely that all sensory neurons collapse into close to one phenotype after injury, which is likely a transcription profile related to regeneration. Following recovery, however, they return to their original phenotypes independent of developmental cues. The conclusions of this study are important and of interest to many, those interested in nerve regeneration, sensory neuron physiology and neural development. Within the tables please include a control and injured neuron expression levels. I.e. a p-value for inclusion in the group, a mean expression level for the cells in this group (Log2 TPM+1), a mean expression level in all other groups, and a fraction of cells in this group with non-zero expression. As in Lacar et al., 2016, and others. Is there a reason for just showing the top 100 genes in each category in Supplementary file 3, then the top 50 in Supplementary file 2? As the full data sets will be placed on GEO please include full summary lists in the tables, to enable straightforward downstream analysis of these lists by a reader. Please include a diagram of how the nuclear sequencing was performed early in the manuscript, as this reviewer wondered while reading this paper if there were any non-neuronal groups and if not why not? By reading the Materials and methods this became clear, but for the general understanding of the study a diagram of the experiments performed would help a great deal. Please perform pathway analysis on the regulated gene clusters. Also on the remaining 'non-regulated' transcripts that still clustered into the I1 and I2 groups. Would transcription factor binding site analysis demonstrate what TF binding sites are over represented in the injured groups? Can the I1 and I2 groups be separated this way? Do the expression levels of the genes differ with different injury paradigms? Please quantify. Are the uninjured profiles in the injured ganglia the same as their control uninjured counterparts? As there is extensive monocyte/non-neuronal activation in injured ganglia after nerve injury do the 'uninjured cell profiles' vary because of these changes and/or via other mechanisms? This study mentioned Gal but expand to the full group of genes and quantify the extent of these similarities/differences. Related to the point above; in the long term injured cells (21 and 75 days) that have returned to 'normal' are there any retained strongly regulated gene signatures in common. Ganglia from male and female mice were analyzed in these studies, do any sex specific transcripts separate into specific groups? Non-neuronal cells? Do you have any data on those? The study would be significantly enhanced with the addition of such profiles. Reviewer #4: The manuscript by Nguyen et al. analyzes transcriptomic changes that occur at a single cell level in primary afferents upon injury. Although many groups have looked at changes in gene expression upon injury, this is the first to do so at the single cell level, and the results are extremely novel and interesting. The major conceptual advance that is revealed through these analyses is that injured neurons take on a new, somewhat de-differentiated phenotype that appears to be independent of the primary afferent cell type involved – an injured state, that is common across afferents. The study also has the potential to provide a very valuable resource to the pain community. 1) In many places, it feels like the authors are describing their impression of the data. Although I have full confidence that the authors have looked at their data carefully, the analyses would appear more rigorous if they were backed up with quantitative data, where possible. 2) In other instances, quantification is not possible. Nevertheless, a fuller description of the examples that led the authors to their interpretation would be helpful. For instance, "I1 neurons expressed markers that suggested they were originally involved in more discriminative types of sensation, while I2 neurons had an expression profile more related to nociceptors (Figure 2—figure supplement 2)" Which genes led to this interpretation? 3) Although the raw data have been made available, I think this form of data will only be useful to those who have extensive experience with clustering algorithms and wish to reanalyze all the data from scratch. It would be much better to provide the datasets in which gene expression in individual cells has been assigned to a cluster. This resource would allow people to readily look up genes of interest and mine the data for other interesting observations. 4) The mice that have scratch lesions should be described in more detail. They seem to be a double transgenic strain where TetTag, Fos-tTA drove expression of tetO-mCherry-2A-Gnaq. Were there mCherry-positive neurons in these mice that was (presumably) indicative of neurons that were driving the itch-like behavior? If so, were they primary afferents with somatotopy consistent with the lesions? Even if the authors have no idea why these mice scratch to the point of injury, I think it would be better to be more transparent about it. Also, although I acknowledge that this allele is not a major part of your study, given that you used it, I think it is important to describe it in more detail. For instance, was the mCherry-2A-Gnaq allele targeted to the Rosa locus or randomly inserted? 5) Please provide a map for the construction of the Atf3-IRES-Cre knockin mouse and some indication that you have validated it. This work suggests that injured trigeminal neurons from animals with a wide range of injuries – from a scratch to a nerve crush – will de-differentiate into a phenotype that is common to all afferent types. The independence of phenotype from afferent type and the range of injuries that yield this are both exciting new developments. Yet the conclusions are more intriguing and appealing than the data are compelling. To do justice to this work, the authors are requested to expand, increase the quantification, and all-around sharpen the results and figures. Thus, the reviewers all believe that the authors would be best served by tightening the results up substantially. Areas that would benefit from attention include but are not limited to the following. - Place a clear methodological description of the minimal injury that yields the common phenotypic change in the results narrative. And explicitly compare the minimal injury to sham surgery. - A full analysis of RNAseq data, that goes beyond a list of genes in a table, such as GO, pathway analysis, transcription factor binding site analysis etc. - Provide detailed description of the mice used and validation of the Atf3-IRES-Cre knockin mouse generated. Please use the detailed comments of the reviewers. We look forward to a substantial revision, Reviewer #1: This is an exciting contribution that takes a new look at the idea that changes in gene regulation are critical to the generation of neuropathic pain. Support for this attractive idea derives from abundant studies looking at the upregulation of genes in DRG cells after peripheral injury. Here the authors look at several far more innocuous manipulations beyond the typical constriction/partial transection injury. And surprisingly these manipulations cause similar genetic changes as do the frank injuries. These findings suggest that the role of changes in gene regulation to the generation of neuropathic pain is at least more nuanced than currently formulated. Additional findings (e.g. all types of cells adopt a pair of injured cell profiles) round out this contribution. While these findings are exciting, this reviewer has a request and a concern: 1) The impact of these findings on the idea that changes in gene regulation are critical to the generation of neuropathic pain should be discussed explicitly. These results suggest that by not looking at more innocuous / acute manipulations, previous research may have missed the full natural history of gene expression changes after peripheral damage. Please add this to the Discussion. 2) The results are not compelling because the figures do not illustrate the results in a compelling fashion. The results wrt the sham controls are also confusing. Were there changes after sham surgeries? Why isn’t sham listed in Figure 5—figure supplement 1C. Reviewer #2: The authors combined single-nuclei RNAseq of isolated trigeminal neuronal nuclei with in situ hybridization (ISH) to characterize changes in gene expression after infraorbital trigeminal nerve transection (IOT) or a more moderate facial cut injury. The authors find that IOT leads to two new injury related clusters, with peak cell numbers 2-7dpi followed by a progressive decline starting 21dpi. They find that facial cut injury with or without scratching also generates two similar injury related clusters albeit with far less cells in each cluster. ISH was performed to validate these findings by showing either the presence or absence of colocalization of select genes with the injury-marker gene ATF3. Overall, the conclusions are modest, expected, and narrow in scope. Further, the RNAseq data provides little analysis beyond identification of neuronal clusters and the ISH experiments lack scientific rigor. Hence, the impact of the paper is limited. This work might be more suitable to be published as a resource rather than a research. The major finding of the RNAseq data is that injured peripheral neurons alter their gene expression and form distinct cluster(s), whether injury occurs to the nerve or the terminations in the facial skin, and that this clustering persists yet subsides over time. This conclusion lacks novelty and rather mainly validates decades of research on this topic. No additional analysis is done with the RNAseq data (e.g., GO/Pathway Analysis). The authors perform no quantification or statistical testing for the ISH experiments and basic controls are not used (Figure 1D-G – uninjured staining for Atf3 and select genes). In Figure 1D-G, Atf3 expression looks very high and might not match the number of injured cells reported in the sequencing (13.8%). Clarification of total number of neurons using a general neuronal marker can help. The 'tables' provided appear to be raw data excel files generated by the sequencing software more suitable to be labeled as supplements rather than 'tables'. Tables a1 and a2 are mentioned but not included in the current version. The sn-transcriptomics experiments represent a mix of sequencing from different platforms (DropSeq- for controls and 10X genomics for injuries). This inconsistency can lead to misinterpretation of the results. Information on sequencing depth and counts normalization is missing. In Figure 3, there is no mention of time post injury where the ISH was done. Quantification of co-localized markers would help. In Figure 4, does control represent sham-injury as in Figure 3? In Figure 5, quantifications of images are necessary. Some indication on the infection rate of the virus are needed, since on day 7 it looks like only about 50% of Atf3 cells are also TdTomato positive. Details on the Atf3 -IRES-cre mice are missing, are these homozygous or heterozygous. Claiming injury does not lead to cell death of injured cells should be shown by using a dead cell marker. Using the Atf3-cre; Flx TdTomato together with markers for different neuronal cell types could shed light on the injured cells identity following an injury. Reviewer #3: In general this is a well written study about an interesting topic and the results are of fundamental importance. Namely that all sensory neurons collapse into close to one phenotype after injury, which is likely a transcription profile related to regeneration. Following recovery, however, they return to their original phenotypes independent of developmental cues. The conclusions of this study are important and of interest to many, those interested in nerve regeneration, sensory neuron physiology and neural development. Within the tables please include a control and injured neuron expression levels. I.e. a p-value for inclusion in the group, a mean expression level for the cells in this group (Log2 TPM+1), a mean expression level in all other groups, and a fraction of cells in this group with non-zero expression. As in Lacar et al., 2016, and others. Is there a reason for just showing the top 100 genes in each category in Supplementary file 3, then the top 50 in Supplementary file 2? As the full data sets will be placed on GEO please include full summary lists in the tables, to enable straightforward downstream analysis of these lists by a reader. Please include a diagram of how the nuclear sequencing was performed early in the manuscript, as this reviewer wondered while reading this paper if there were any non-neuronal groups and if not why not By reading the Materials and methods this became clear, but for the general understanding of the study a diagram of the experiments performed would help a great deal. Please perform pathway analysis on the regulated gene clusters. Also on the remaining 'non-regulated' transcripts that still clustered into the I1 and I2 groups. Would transcription factor binding site analysis demonstrate what TF binding sites are over represented in the injured groups? Can the I1 and I2 groups be separated this way? Do the expression levels of the genes differ with different injury paradigms? Please quantify. Are the uninjured profiles in the injured ganglia the same as their control uninjured counterparts? As there is extensive monocyte/non-neuronal activation in injured ganglia after nerve injury do the 'uninjured cell profiles' vary because of these changes and/or via other mechanisms? This study mentioned Gal but expand to the full group of genes and quantify the extent of these similarities/differences. Related to the point above; in the long term injured cells (21 and 75 days) that have returned to 'normal' are there any retained strongly regulated gene signatures in common. Ganglia from male and female mice were analyzed in these studies, do any sex specific transcripts separate into specific groups? Non-neuronal cells? Do you have any data on those? The study would be significantly enhanced with the addition of such profiles. Reviewer #4: The manuscript by Nguyen et al. analyzes transcriptomic changes that occur at a single cell level in primary afferents upon injury. Although many groups have looked at changes in gene expression upon injury, this is the first to do so at the single cell level, and the results are extremely novel and interesting. The major conceptual advance that is revealed through these analyses is that injured neurons take on a new, somewhat de-differentiated phenotype that appears to be independent of the primary afferent cell type involved – an injured state, that is common across afferents. The study also has the potential to provide a very valuable resource to the pain community. 1) In many places, it feels like the authors are describing their impression of the data. Although I have full confidence that the authors have looked at their data carefully, the analyses would appear more rigorous if they were backed up with quantitative data, where possible. 2) In other instances, quantification is not possible. Nevertheless, a fuller description of the examples that led the authors to their interpretation would be helpful. For instance, "I1 neurons expressed markers that suggested they were originally involved in more discriminative types of sensation, while I2 neurons had an expression profile more related to nociceptors (Figure 2—figure supplement 2)" Which genes led to this interpretation? 3) Although the raw data have been made available, I think this form of data will only be useful to those who have extensive experience with clustering algorithms and wish to reanalyze all the data from scratch. It would be much better to provide the datasets in which gene expression in individual cells has been assigned to a cluster. This resource would allow people to readily look up genes of interest and mine the data for other interesting observations. 4) The mice that have scratch lesions should be described in more detail. They seem to be a double transgenic strain where TetTag, Fos-tTA drove expression of tetO-mCherry-2A-Gnaq. Were there mCherry-positive neurons in these mice that was (presumably) indicative of neurons that were driving the itch-like behavior? If so, were they primary afferents with somatotopy consistent with the lesions? Even if the authors have no idea why these mice scratch to the point of injury, I think it would be better to be more transparent about it. Also, although I acknowledge that this allele is not a major part of your study, given that you used it, I think it is important to describe it in more detail. For instance, was the mCherry-2A-Gnaq allele targeted to the Rosa locus or randomly inserted? 5) Please provide a map for the construction of the Atf3-IRES-Cre knockin mouse and some indication that you have validated it. The editorial summary requested additional quantification and general sharpening of the results to better highlight the findings and do justice to the work. We have added significant new data and analysis and have edited the text taking all the individual reviewers’ comments into account as follows: 1) Reviewer 1 requested Figure 1—figure supplement 1 be added to the main figures and reviewer 3 wanted a diagram of how the nuclear sequencing was performed: these are now included in a new Figure 1. To accommodate this change we added a short section explaining the uninjured control results and highlighting advantages of nuclear sequencing vs. cell sequencing (see also new Figure 1—figure supplement 1) for studying injury related changes in trigeminal neurons. 2) We have now provided quantitation, and statistical analysis of ISH data as requested by all reviewers. This is detailed in Supplementary file 1; the quantitation fully supports conclusions drawn from ISH results in the manuscript. 3) We have added uninjured controls to Figure 2 (old Figure 1) and Figure 4 (old Figure 3) as requested by reviewers 1 and 2. We also relabeled Figure 4 and hope that the new labeling making clear that sham IOT surgery is a mild peripheral injury rather than a control clears up any confusion about these data. That sham surgery is a mild injury model was stated in the original text, but we understand that readers often concentrate on the figures. We have also made sure colors are explained and time after injury is detailed wherever these were missing. 4) We have added GO-pathway analysis as requested by the editor and reviewers 2 and 3: Figure 2—figure supplement 3 and Figure 5—figure supplement 1. These support the conclusions about differences in the I1 and I2 classes of injured neurons as well as the role of upregulated vs. downregulated genes. The new Supplementary file 2 goes with Figure 2—figure supplement 3 and provides additional analysis of I1 vs. I2 requested by reviewer 3. Unfortunately, transcription factor analysis that this reviewer suggested might be interesting was rather uninformative (with many rather general and overlapping binding sites) and was thus not included. 5) We have added Figure 6—figure supplement 1 detailing the generation and validation of Atf3-IRES-Cre knockin mice as requested by the editor and reviewers 2 and 4 as well as more detail about the mice with scratch lesions (in the Materials and methods section). 6) We have added Figure 2—figure supplement 2 which augments quantitation of gene expression changes in the injury models as requested by reviewer 3. We have also explained in the text that the clustering and UMAP representation of the data provide analysis of gene expression based on the quantitative expression of many genes, thus the co-clustering of the different injury models is very significant. The clustering approach we used (Butler et al., 2018) minimizes impact of technical variation without forcing cells into shared clusters assuaging concerns of reviewer 2. 7) We added a clear description of the mild injuries that induce the I1/I2 injured state in the results and add comparison to the sham IOT surgery (another mild injury) as requested by the editor. 8) Reviewers 3 and 4 wanted more extensive data for readers: as requested we have included the full set of genes in Supplementary files 2-4, and as reviewer 3 wanted these include p-value for inclusion, adjusted p-value, relative expression in a class vs. other classes, fractional expression in the class in question, fractional expression in other classes. 9) As requested by the editor we added discussion focused on the idea that changes in gene regulation are critical to the generation of neuropathic pain and highlight that by not looking at more innocuous / acute manipulations, previous research may have missed the full natural history of gene expression changes after peripheral damage. 10) We supply higher resolution figures (note that there are size limits for the first review that degraded quality).
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Mus musculus)Atf3NAENSMUSG00000026628
Strain, strain background (Mus musculus)C57BL/6Charles RiverStrain code: 027
Genetic reagent (Mus musculus)Atf3-IRES-CreThis paperKnockin mouse; details Figure 6—figure supplement 1
Genetic reagent (Mus musculus)TetO-mCherry-2A-Gnaq*This paperRandom insertion transgene (See Materials and methods)
Genetic reagent (Mus musculus)Fos-tTAThe Jackson LaboratoryJAX: 018306Reijmers et al., 2007
Genetic reagent (Adeno-associated virus)AAV9-CAG-FLEX-tdTomato-WPREAddgene; Oh et al., 2014Addgene: 51503-AAV92.1 × 10^13 GC/µl
AntibodyAnti-NeuN (rabbit polyclonal)MilliporeCat#ABN78; RRID:AB_10807945(1:2000)
Sequence- based reagentcrRNADharmacon Inc.Edit-R Modified Synthetic crRNATarget sequence: GCAGAAGTGTCTACCTTGAT
Peptide, recombinant proteinCas9PNA Bio Inc.CP01
Commercial assay or kitRNAscope multiplex fluorescent development kitAdvanced Cell DiagnosticsACD: 320851
Commercial assay or kitRNAscope probe-Mm-S100bAdvanced Cell DiagnosticsACD: 431731
Commercial assay or kitRNAscope probe-Mm-Slit2Advanced Cell DiagnosticsACD: 449691
Commercial assay or kitRNAscope probe-Mm-Ntng1Advanced Cell DiagnosticsACD: 488871
Commercial assay or kitRNAscope probe-Mm-Rgs6Advanced Cell DiagnosticsACD: 521211
Commercial assay or kitRNAscope probe-Mm-Cacna1hAdvanced Cell DiagnosticsACD: 459751
Commercial assay or kitRNAscope probe-Mm-Scn5aAdvanced Cell DiagnosticsACD: 429881
Commercial assay or kitRNAscope probe-Mm-Htr3aAdvanced Cell DiagnosticsACD: 411141
Commercial assay or kitRNAscope probe-Mm-MrgprdAdvanced Cell DiagnosticsACD: 417921
Commercial assay or kitRNAscope probe-Mm-Scn10aAdvanced Cell DiagnosticsACD: 426011
Commercial assay or kitRNAscope probe-Mm-Atf3Advanced Cell DiagnosticsACD: 426891
Commercial assay or kitRNAscope probe-Mm-TrpV1Advanced Cell DiagnosticsACD: 313331
Commercial assay or kitRNAscope probe-Mm-Tac1Advanced Cell DiagnosticsACD: 410351
 commercial assay or kitRNAscope probe-Mm-CalcaAdvanced Cell DiagnosticsACD: 420361
Commercial assay or kitRNAscope probe-Mm-Grik1Advanced Cell DiagnosticsACD: 438771
Commercial assay or kitRNAscope probe-Mm-Piezo2Advanced Cell DiagnosticsACD: 400191
Commercial assay or kitRNAscope probe-Mm-GalAdvanced Cell DiagnosticsACD: 400961
Commercial assay or kitRNAscope probe-Mm-NtsAdvanced Cell DiagnosticsACD: 420441
Commercial assay or kitRNAscope probe-Mm-NpyAdvanced Cell DiagnosticsACD: 313321
Commercial assay or kitRNAscope probe-Mm-Sox11Advanced Cell DiagnosticsACD: 440811
Commercial assay or kitRNAscope probe-Mm-Sema6aAdvanced Cell DiagnosticsACD: 508101
Commercial assay or kitRNAscope probe-Mm-Csf1Advanced Cell DiagnosticsACD: 315621
Commercial assay or kitRNAscope probe-TdTomatoAdvanced Cell DiagnosticsACD: 317041
Commercial assay or kitRNAscope probe-FosAdvanced Cell DiagnosticsACD: 316921
Commercial assay or kitRNAscope probe-Egr1Advanced Cell DiagnosticsACD: 423371
Commercial assay or kitChromium single cell 3’ reagent kit (v2)10X GenomicsCat# 120237
Commercial assay or kitChromium i7 Multiplex Kit, 96 rxns10x GenomicsCat# 120262
Commercial assay or kitChromium Single Cell A Chip Kit10x GenomicsCat# 120236
Software, algorithmSeuratButler et al., 2018; Stuart et al., 2018RRID:SCR_016341https://satijalab.org/
Software, algorithmCellRanger10x Genomics
Software, algorithmDrop-seqMcCarroll Labhttp://mccarrolllab.org/dropseq/
Software, algorithmRR Project for Statistical ComputingRRID:SCR_001905http://www.r-project.org/
Software, algorithmR StudioR Studiorstudio.com
Software, algorithmPrism v8GraphPadRRID:SCR_002798
Software, algorithmPhotoShop CCAdobeRRID:SCR_014199
OtherRNAlaterThermoFisherCat# AM7021
OtherGlass dounce homogenizerFisher ScientificCat# 357538
Other40 µm cell strainerThermoFisherCat# 08-771-1
OtherSUPERaseIn RNase InhibitorThermoFisherCat# AM26960.2 U/ml
OtherAnti-rabbit IgG microbeadsMiltenyi BiotecCat# 130-048-602
OtherLS columnsMiltenyi BiotecCat# 130-042-401
OtherMACS MultiStandMiltenyi BiotecCat# 130-042-303
OtherMidiMACS SeparatorMiltenyi BiotecCat# 130-042-302
OtherUltra-Turrax T10Laboratory Supply Network, Inc.IKA:3737001
OtherDispersing element S10N-5G for Ultra-Turrax T10Laboratory Supply Network, Inc.IKA:3304000
  36 in total

1.  Distal infraorbital nerve injury: a model for persistent facial pain in mice.

Authors:  Stefanie Hardt; Caroline Fischer; Alexandra Vogel; Annett Wilken-Schmitz; Irmgard Tegeder
Journal:  Pain       Date:  2019-06       Impact factor: 6.961

2.  Pathophysiological implication of CaV3.1 T-type Ca2+ channels in trigeminal neuropathic pain.

Authors:  Soonwook Choi; Eunah Yu; Eunjin Hwang; Rodolfo R Llinás
Journal:  Proc Natl Acad Sci U S A       Date:  2016-02-08       Impact factor: 11.205

Review 3.  Neuronal diversity in the somatosensory system: bridging the gap between cell type and function.

Authors:  Graziana Gatto; Kelly Megan Smith; Sarah Elizabeth Ross; Martyn Goulding
Journal:  Curr Opin Neurobiol       Date:  2019-04-04       Impact factor: 6.627

4.  Partial infraorbital nerve ligation as a model of trigeminal nerve injury in the mouse: behavioral, neural, and glial reactions.

Authors:  Mei Xu; Megumi Aita; Charles Chavkin
Journal:  J Pain       Date:  2008-08-16       Impact factor: 5.820

5.  Effect of permanent axotomy on number and volume of dorsal root ganglion cell bodies.

Authors:  S Vestergaard; T Tandrup; J Jakobsen
Journal:  J Comp Neurol       Date:  1997-11-17       Impact factor: 3.215

Review 6.  Neuropathic pain: a maladaptive response of the nervous system to damage.

Authors:  Michael Costigan; Joachim Scholz; Clifford J Woolf
Journal:  Annu Rev Neurosci       Date:  2009       Impact factor: 12.449

7.  PIEZO2 mediates injury-induced tactile pain in mice and humans.

Authors:  Marcin Szczot; Jaquette Liljencrantz; Nima Ghitani; Arnab Barik; Ruby Lam; James H Thompson; Diana Bharucha-Goebel; Dimah Saade; Aaron Necaise; Sandra Donkervoort; A Reghan Foley; Taylor Gordon; Laura Case; M Catherine Bushnell; Carsten G Bönnemann; Alexander T Chesler
Journal:  Sci Transl Med       Date:  2018-10-10       Impact factor: 17.956

Review 8.  The functional and anatomical dissection of somatosensory subpopulations using mouse genetics.

Authors:  Claire E Le Pichon; Alexander T Chesler
Journal:  Front Neuroanat       Date:  2014-04-22       Impact factor: 3.856

9.  Molecular Architecture of the Mouse Nervous System.

Authors:  Amit Zeisel; Hannah Hochgerner; Peter Lönnerberg; Anna Johnsson; Fatima Memic; Job van der Zwan; Martin Häring; Emelie Braun; Lars E Borm; Gioele La Manno; Simone Codeluppi; Alessandro Furlan; Kawai Lee; Nathan Skene; Kenneth D Harris; Jens Hjerling-Leffler; Ernest Arenas; Patrik Ernfors; Ulrika Marklund; Sten Linnarsson
Journal:  Cell       Date:  2018-08-09       Impact factor: 41.582

10.  Mechanistic Differences in Neuropathic Pain Modalities Revealed by Correlating Behavior with Global Expression Profiling.

Authors:  Enrique J Cobos; Chelsea A Nickerson; Fuying Gao; Vijayendran Chandran; Inmaculada Bravo-Caparrós; Rafael González-Cano; Priscilla Riva; Nick A Andrews; Alban Latremoliere; Corey R Seehus; Gloria Perazzoli; Francisco R Nieto; Nicole Joller; Michio W Painter; Chi Him Eddie Ma; Takao Omura; Elissa J Chesler; Daniel H Geschwind; Giovanni Coppola; Manu Rangachari; Clifford J Woolf; Michael Costigan
Journal:  Cell Rep       Date:  2018-01-30       Impact factor: 9.423

View more
  29 in total

Review 1.  The physiological function of different voltage-gated sodium channels in pain.

Authors:  George Goodwin; Stephen B McMahon
Journal:  Nat Rev Neurosci       Date:  2021-03-29       Impact factor: 34.870

2.  Transcriptomic Classification of Neurons Innervating Teeth.

Authors:  J J Emrick; L J von Buchholtz; N J P Ryba
Journal:  J Dent Res       Date:  2020-07-23       Impact factor: 6.116

3.  Isolation of Nuclei from Mouse Dorsal Root Ganglia for Single-nucleus Genomics.

Authors:  Lite Yang; Ivan Tochitsky; Clifford J Woolf; William Renthal
Journal:  Bio Protoc       Date:  2021-08-05

4.  The Development of Mechanical Allodynia in Diabetic Rats Revealed by Single-Cell RNA-Seq.

Authors:  Han Zhou; Xiaosheng Yang; Chenlong Liao; Hongjin Chen; Yiwei Wu; Binran Xie; Fukai Ma; WenChuan Zhang
Journal:  Front Mol Neurosci       Date:  2022-05-20       Impact factor: 6.261

5.  Human and mouse trigeminal ganglia cell atlas implicates multiple cell types in migraine.

Authors:  Lite Yang; Mengyi Xu; Shamsuddin A Bhuiyan; Jia Li; Jun Zhao; Randall J Cohrs; Justin T Susterich; Sylvia Signorelli; Ursula Green; James R Stone; Dan Levy; Jochen K Lennerz; William Renthal
Journal:  Neuron       Date:  2022-03-28       Impact factor: 18.688

Review 6.  The Form and Function of PIEZO2.

Authors:  Marcin Szczot; Alec R Nickolls; Ruby M Lam; Alexander T Chesler
Journal:  Annu Rev Biochem       Date:  2021-06-20       Impact factor: 23.643

7.  Diversity of Receptor Expression in Central and Peripheral Mouse Neurons Estimated from Single Cell RNA Sequencing.

Authors:  Andi Wangzhou; Candler Paige; Pradipta R Ray; Gregory Dussor; Theodore J Price
Journal:  Neuroscience       Date:  2021-03-26       Impact factor: 3.590

8.  Sex Differences in Nociceptor Translatomes Contribute to Divergent Prostaglandin Signaling in Male and Female Mice.

Authors:  Diana Tavares-Ferreira; Pradipta R Ray; Ishwarya Sankaranarayanan; Galo L Mejia; Andi Wangzhou; Stephanie Shiers; Ruta Uttarkar; Salim Megat; Paulino Barragan-Iglesias; Gregory Dussor; Armen N Akopian; Theodore J Price
Journal:  Biol Psychiatry       Date:  2020-10-05       Impact factor: 13.382

9.  Human Type II Taste Cells Express Angiotensin-Converting Enzyme 2 and Are Infected by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

Authors:  Máire E Doyle; Ashley Appleton; Qing-Rong Liu; Qin Yao; Caio H Mazucanti; Josephine M Egan
Journal:  Am J Pathol       Date:  2021-06-06       Impact factor: 4.307

Review 10.  Pharmacological Manipulation of Translation as a Therapeutic Target for Chronic Pain.

Authors:  Muhammad Saad Yousuf; Stephanie I Shiers; James J Sahn; Theodore J Price
Journal:  Pharmacol Rev       Date:  2021-01       Impact factor: 25.468

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.