Literature DB >> 31579420

Long non-coding RNA urothelial cancer associated 1 can regulate the migration and invasion of colorectal cancer cells (SW480) via myocardin-related transcription factor-A.

Long Zhang1, Chengcheng Zheng1, Zhen Sun1, Huaqing Wang1, Fengwei Wang1.   

Abstract

Colorectal cancer (CRC) is the third leading cause of cancer-associated mortalities. Long non-coding RNAs (lncRNAs) have been identified as key regulators in the occurrence and development of CRC. The lncRNA urothelial cancer associated 1 (UCA1) has been demonstrated to promote the development of numerous different types of cancer. In the present study, a novel molecular mechanism of UCA1, regulating the migratory and invasive capabilities of SW480 CRC cells was identified. UCA1 promoted the migration and invasion of SW480 cells by suppressing phosphorylation of myocardin-related transcription factor-A (MRTF-A). Our findings indicated that UCA1 competes with extracellular signal-regulated kinases1/2 to inhibit the phosphorylation of MRTF-A. These novel discoveries may reveal additional functions of UCA1, which may support future clinical development of novel drug targets. Copyright: © Zhang et al.

Entities:  

Keywords:  colorectal cancer; invasion; migration; myocardin-related transcription factor-A; urothelial cancer associated 1

Year:  2019        PMID: 31579420      PMCID: PMC6757313          DOI: 10.3892/ol.2019.10737

Source DB:  PubMed          Journal:  Oncol Lett        ISSN: 1792-1074            Impact factor:   2.967


Introduction

Colorectal cancer (CRC) is one of the most commonly diagnosed malignancies (1). Statistics show that CRC is the second and third most common cancer in males and females, respectively, for the incidence of malignancies (1). The occurrence of CRC is the result of the interaction of multiple factors and multiple genes (2–4). However, the exact mechanism has not yet been fully elucidated. Long non-coding RNAs (lncRNAs) are a class of biological macromolecules >200 nucleotides in length; however, they do not encode proteins (5). They possess numerous biological functions, including regulating gene transcription and modifying histones, which exhibit important effects on the occurrence and development of tumors (6–8). With the application of a number of advanced experimental techniques, including gene chips, lncRNAs associated with the occurrence and development of CRC have been identified (9). Amongst these lncRNAs, urothelial cancer associated 1 (UCA1) serves an important role as an oncogene in tumors of the digestive system, mediating the proliferation, metastasis, apoptosis, resistance and prognosis of tumors (10). The mechanisms underlying the biological functions of UCA1 and its genetic regulation in malignant tumors of the digestive system remain to be elucidated. However, it is hypothesized that alterations in epigenetic modifications in certain key genes caused by the abnormal expression of UCA1 in malignant tumors may underlie the pathophysiological roles of UCA1. LncRNA and transcription factors form molecular networks to function together (11–13). Myocardin-related transcription factor-A (MRTF-A) is an important factor in regulating tumor migration (14–16). Therefore, it was deemed necessary to determine which lncRNA forms a molecular regulatory network with MRTF-A, which may subsequently affect tumor migration. In the present study, UCA1 regulated migration and invasion of CRC cells, possibly through decreasing the phosphorylation of MRTF-A. The present study focused on UCA1 mediated molecular mechanisms in regulation of migration of CRC cells via modulation of the phosphorylation levels of MRTF-A and raises the possibility of UCA1 serving as a tumor biomarker, therapeutic target or prognostic predictor.

Materials and methods

Cell culture

The human CRC cell line SW480 was purchased from American Type Culture Collection (Manassas, VA, USA). The cells were seeded in Leibovitz's L-15 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) at 37°C in humidified air with 5% CO2.

Cell transfection

SW480 cells were cultured in growth medium without antibiotics at 60% confluence for 2 days, and then transfected with the pcDNA3.1 plasmid (Addgene, Inc., Cambridge, MA, USA) containing full length human UCA1 sequence obtained from GenScript (Piscataway, NJ, USA) using FuGENE® HD (Roche Diagnostics, Basel, Switzerland) according to manufacturer's protocol. Following incubation for 6 h at 37°C, the medium was removed and replaced with normal culture medium for 24 h and used for subsequent experiments. For the immunocytochemistry assay, SW480 cells were cultured in 24-well plates and 2 µg DNA was added to each well of a 24-well plate. For polymerase chain reaction (PCR) analysis, SW480 cells were cultured in a 6-well plate and 4 µg DNA was added in each well. For western blotting, 10 µg DNA was added to a 10 cm plate of cells. A short hairpin (sh)-negative control (NC) was constructed by inserting a non-targeting sequence into a pLKO.1. sh1, sh2 and sh3 are different MRTF-A interfering plasmids which were created by inserting different MRTF-A interference sequences into a pLKO.1 vector (Addgene, Inc). The sequences of the shRNAs were as follows: sh1, 5′-CCGGTTGTGGGCCAGGTGAACTATCCTCGAGGATAGTTCACCTGGCCCACAATTTTTG-3′; sh2, 5′-CCGGTTCCTCGATGGCCATGATTTGCTCGAGCAAATCATGGCCATCGAGGAATTTTTG-3′; sh3, 5′-CCGGCTGTCTGTCTGGCTACAATTTCTCGAGAAATTGTAGCCAGACAGACAGTTTTTG-3′; and sh-NC 5′-CCGGGCGCGATAGCGCTAATAATTTCTCGAGAAATTATTAGCGCTATCGCGCTTTTTG-3′. The shRNA were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). shUCA1 was a UCA1 interfering plasmid which was created by inserting a UCA1 interference sequence into the pLKO.1 vector (Addgene, Inc). The sequences of the shRNA was, 5′-CCGGAGTGAAATGTCCCAAGCCCTTCTCGAGAAGGGCTTGGGACATTTCACTTTTTTG-3′. The shRNA was purchased from Sangon Biotech Co., Ltd., and shUCA1 was transfected into SW480 cells using Lipofectamine™ 3000 (Thermo Fisher Scientific, Inc.) according to manufacturer's protocol. For the immunocytochemistry assay, SW480 cells were cultured in 24-well plates and 2 µg shUCA1 was added to each well of a 24-well plate. For polymerase chain reaction (PCR) analysis, SW480 cells were cultured in a 6-well plate and 4 µg shUCA1 was added in each well. For western blotting, 10 µg shUCA1 was added to a 10 cm plate of cells.

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from cells using an mRNA kit (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol. The samples were reverse-transcribed using Moloney Murine Leukemia Virus Reverse Transcriptase (Promega Corporation). RT-qPCR was performed in a StepOne Real-Time PCR system (Thermo Fisher Scientific, Inc.). The reverse-transcription temperature protocol was a s follows: 70°C for 10 min; incubation on ice for 5 min; 30°C for 10 min; 42°C for 60 min; 70°C for 15 min and held at 4°C until further use. Fast SYBR Green Master mix was obtained from Applied Biosystems (Thermo Fisher Scientific, Inc.). The relative expression levels of target genes were normalized to GAPDH. The primers used for the RT-qPCR analysis are listed in Table I. Thermocycling conditions were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec, then a melting curve analysis between 60 and 95°C in increments of 0.2°C for 1.5 min was obtained. Each sample was analyzed in triplicate and quantified using the 2−ΔΔCq method (17).
Table I.

Sequences of primers used in reverse transcription-quantitative polymerase chain reaction analysis.

GenePrimer sequence, 5′→3′
MRTF-AF: AAGGAACCACCTGGCTATGA
R: CTCCGCTCTGAATGAGAATGT
MMP9F: CCTGGAGACCTGAGAACCAAT
R: CCACCCGAGTGTAACCATAGC
MMP6F: AGTTGCTGTCCAGCCTCAGT
R: CCAAAGTCTCCTGCCTTCTG
GAPDHF: TCAAGAAGGTGGTGAAGCAG
R: AGGTGGAGGAGTGGGTGTCG

MRTF-A, myocardin-related transcription factor A; MMP, matrix metalloproteinase; F, forward; R, reverse.

Protein extraction and western blotting

For western blot analysis, protein samples were extracted from the cells with Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, Inc.). The concentration of protein was determined using a bicinchoninic acid (BCA) quantification kit (Beyotime Institute of Biotechnology, Haimen, China). A total of 20 µg proteins was separated by a 10% SDS PAGE and transferred onto a polyvinylidene fluoride (PVDF) membrane. The membrane was blocked using 5% non-fat milk at 25°C for 1 h, and incubated with primary antibodies overnight at 4°C. The antibodies used were as follows: Anti-human GAPDH antibody (cat. no. 97166; 1:2,000; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-human MRTF-A (cat. no. ab49311; 1:1,000; Abcam, Cambridge, UK), anti-human matrix metalloproteinase (MMP)9 (cat. no. sc-393859; 1:1,000, Santa Cruz Biotechnology, Inc., Dallas TX, USA), anti-human MMP6 (cat. no. sc-101453; 1:1,000, Santa Cruz Biotechnology, Inc.) and anti-human extracellular signal-regulated kinase (ERK)1/2 (cat. no. sc-514302; 1:1,000, Santa Cruz Biotechnology, Inc.). The membrane was incubated with IRDye 800 conjugated anti-mouse (cat. no. 115-005-146) or anti-rabbit (cat. no. 115-005-144) secondary antibodies (both at 1:5,000; Jackson ImmunoReasearch Laboratories, Inc., West Grove, PA, USA) at 25°C for 1 h at room temperature. The protein signals were visualized with the Odyssey Infrared Imaging system version 2.1 (LI-COR Biosciences, Lincoln, NE, USA). GAPDH expression was used as an internal control to show equal loading of the protein samples.

Wound healing assay

Cells were cultured in a 6-well plate at a density of 1×105 cells/well. Upon reaching >80% confluence, the cell monolayer was gently scratched with a 200 ml pipette tip to generate a linear wound and washed twice with serum-free medium to remove cell debris. Subsequently, the cells were cultured in a medium containing 2% FBS. Images were captured at 0 and 24 h subsequent to scratching using a light microscope at ×100 magnification. The closure of the wounds was quantified by the distance the cells had moved into the wounded area. The experiment was repeated twice with triplicate measurements in each experiment. The results were quantified using ImageJ version 1.8.0 software (National Institutes of Health, Bethesda, MD, USA).

Transwell invasion assay

The invasion assay was performed using Transwell chambers (Corning Inc., Corning, NY, USA) with Matrigel™ (50 µl; BD Biosciences, San Jose, CA, USA) pre-coated polycarbonate membranes (8.0 µm pore size). A total of 1×104 cells were suspended in 200 µl FBS-free DMEM (Gibco; Thermo Fisher Scientific, Inc.) was added to the upper chamber. The lower chamber was filled with 500 µl DMEM containing 10% FBS. Following incubation for 24 h, cells on the lower surface of the membrane were fixed in 4% paraformaldehyde for 15 min at room temperature and subsequently stained with 0.1% crystal violet for 15 min at room temperature. Cells in four random microscopic fields using a light microscope (magnification, ×200) were counted in triplicates. Following image acquisition, cells were washed with 33% acetic acid and the absorbance was measured at 570 nm using a SpectraMax i3× (Molecular Devices, LLC, Sunnyvale, CA, USA).

Co-immunoprecipitation (Co-IP)

The SW480 cells were transfected with UCA1 or short hairpin (sh)UCA1. After 48 h, transfected SW480 cells were harvested using IP lysate (Beyotime Institute of Biotechnology). The concentration of protein was determined using a BCA quantification kit with bovine serum albumin (Sigma-Aldrich; Merck KGaA) as a standard. Co-IP was performed using Dynabeads Protein A+G (Invitrogen; Thermo Fisher Scientific, Inc.). The manufacturer's protocol was followed with the following alterations: 1 µg Phosphorylated (p)-Ser (cat. no. ICP9806; 1:1,000; Jackson ImmunoReasearch Laboratories) or ERK1/2 (cat. no. sc-514302; 1:1,000; Santa Cruz Biotechnology) antibody was bound to the beads at room temperature for ≥1.5 h prior to the addition of the sample; IP lysate was used in place of antibody binding and washing buffer; 1 mg protein in 600 µl volume was added to the Dynabeads-antibody complex and incubated overnight at 4°C. Following binding, proteins were eluted off the beads using 30 µl 2X SDS sample buffer, heated at 100°C for 10 min and separated via 10% SDS-PAGE. Following separation, proteins on the gel were transferred to a PVDF membrane for detection by western blotting as mentioned above.

Immunocytochemistry assay

Following transfection, the cells were fixed in 4% paraformaldehyde for 15 min at room temperature and then blocked with normal goat serum (Wuhan Boster Biological Technology, Ltd., Wuhan, China) for 20 min at room temperature. Following incubation with the primary antibody (cat. no. sc-398675, mouse anti-MRTF-A; 1:200; Santa Cruz Biotechnology, Inc.) in a humidified chamber overnight at 4°C, cells were incubated with the secondary antibody [cat. no. BA1101; fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse IgG; 1:100; Wuhan Boster Biological Technology, Ltd.] for 30 min at 37°C. Subsequently, cells were incubated with DAPI (5 µg/ml; cat. no. C1005; Beyotime Institute of Biotechnology) for 15 min at room temperature. Following washing with PBS, the samples were observed under laser scanning confocal microscope (magnification, ×200; Olympus Corporation, Tokyo, Japan).

RNA pull down

LncRNA-UCA1 was transcribed in vitro from the pcDNA3.1 vector (Addgene, Inc.) via T7 RNA polymerase (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and biotin-labeled with the Biotin RNA Labeling mix (Roche Diagnostics), treated with RNase-free DNase I (Roche Diagnostics) and purified with an RNeasy Mini kit (Qiagen China Co., Ltd., Shanghai, China). A total of 1 mg SW480 whole-cell lysate was incubated with 3 µg purified biotinylated transcripts for 1 h at 25°C; complexes were isolated with streptavidin agarose beads (Invitrogen; Thermo Fisher Scientific Inc.). Binding of protein to UCA1 in the pull-down material was detected by western blotting and the antibody used was the anti-human MRTF-A.

Statistical analysis

Data are expressed as the mean ± standard error of the mean of at least three repeats. Comparisons between two groups were performed using a Student's t-test; one-way ANOVA followed by a post-hoc Tukey's test was used compare differences among multiple groups. Statistical analysis was performed with GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

UCA1 promotes the migration and invasion of SW480 cells without alterations in MRTF-A expression levels

To determine the effects of UCA1 in SW480 cells, SW480 cells that either overexpressed UCA1 or had expression knocked down were established (Fig. 1A). The wound healing and Transwell assays demonstrated that the migration and invasive abilities of SW480 cells were positively associated with the expression of UCA1 (all P<0.01; Fig. 1B and C). RT-qPCR and western blot analysis were used to evaluate the expression of MMP9, MMP6 and MRTF-A. The results demonstrated that the expression of MMP9 and MMP6 was significantly upregulated when UCA1 was overexpressed (P<0.01; Fig. 2). Similarly, when UCA1 was silenced, the expression of MMP6 and MMP9 was significantly downregulated compared with the control (P<0.01; Fig. 2). However, the expression of MRTF-A was markedly affected by alterations in UCA1 expression levels (Fig. 2).
Figure 1.

UCA1 expression is associated with migration and invasion of SW480 cells. (A) Detection of UCA1 expression subsequent to overexpression or knockdown in SW480 cells by reverse transcription-quantitative polymerase chain reaction. **P<0.01. (B) UCA1 expression was positively associated with wound closure in SW480 cells. **P<0.01 vs. control or NC. (C) Transwell invasion assay was used to detect the effect of UCA1 on SW480 cells invasion. Magnification, ×200; scale bar, 50 µm. **P<0.01. UCA1, urothelial cancer associated 1; sh, small hairpin; MMP, matrix metalloproteinase; MRTF-A, myocardin-related transcription factor A; NC, negative control.

Figure 2.

UCA1 expression is not associated with alterations in MRTF-A expression levels. When UCA1 was (A) overexpressed or (B) knocked down in SW480 cells, the mRNA and protein expression levels of MMP9, MMP6 and MRTF-A (relative to GAPDH) were measured by reverse transcription-quantitative polymerase chain reaction and western blotting. **P<0.01. UCA1, urothelial cancer associated 1; MRTF-A, myocardin-related transcription factor A; MMP, matrix metalloproteinase; sh, small hairpin; mRNA, messenger RNA; NC, negative control; N.S., not significant.

UCA1 promotes MRTF-A nuclear transport by decreasing the phosphorylation of MRTF-A protein

MRTF-A protein is an important transcription factor associated with tumor metastasis and its localization is closely associated with its function (18,19). As presented in Fig. 3A and B, the localization of endogenous MRTF-A may be regulated by UCA1. UCA1 may promote the nuclear export of MRTF-A when MRTF-A is phosphorylated; inhibiting cell migration. Co-IP was used to examine the possible alterations in MRTF-A protein phosphorylation modification in SW480 cells. The results demonstrated that the protein phosphorylation levels of MRTF-A were negatively associated with the expression of UCA1 (Fig. 3C and D).
Figure 3.

UCA1 promoted MRTF-A nuclear transport by decreasing the phosphorylation level of MRTF-A protein. (A) Immunofluorescence and (B) confocal microscopy were used to determine the subcellular distribution of MRTF-A subsequent to overexpressing or knocking down UCA1. Magnification, ×200; scale bar, 50 µm. (C) Overexpression and (D) knockdown of UCA1 modulates the phosphorylation level of MRTF-A. Western blots demonstrated the changes in MRTF-A following p-Ser co-IP with overexpressed or knocked down UCA1 in SW480 cells. UCA1, urothelial cancer associated 1; MRTF-A, myocardin-related transcription factor A; sh, small hairpin; ERK, extracellular signal-regulated kinase; IB, immunoblot; IP, immunoprecipitation; IgG, immunoglobulin G.

UCA1 regulates the migration and invasion of SW480 via MRTF-A

UCA1 promoted migration and invasion of SW480 cells without alterations in MRTF-A expression. However, UCA1 additionally promoted MRTF-A nuclear transport by decreasing the phosphorylation level of MRTF-A protein. As it was unclear whether MRTF-A is necessary for UCA1 to regulate the migration and invasion of SW480 cells, MRTF-A was subsequently silenced. Based on the results shown in Fig. 4A, sh2 was used for all subsequent experiments. As presented in Fig. 4B-C, when MRTF-A was silenced, UCA1 lost its regulatory function on migration-associated genes. The wound healing and Transwell assays confirmed that UCA1 lost its ability to regulate migration and invasion of SW480 cells with MRTF-A knockdown (Fig. 4D and E).
Figure 4.

UCA1 may regulate the migration and invasion of SW480 cells via MRTF-A. (A) Detection of shRNA interference effect. SW480 cells were transfected with NC, sh1, sh2 and sh3, respectively. Changes in the protein expression levels of MRTF-A were detected by western blotting (NC is constructed by inserting a non-targeting sequence into a vector of plko.1 and sh1, sh2 and sh3 were different MRTF-A interfering plasmids which were formed by the construction of different MRTF-A interference sequences into the vector of pLKO.1). Following knockdown of endogenous MRTF-A, the (B) mRNA and (C) protein expression levels of MMP9 and MMP6 were measured by reverse transcription-quantitative polymerase chain reaction and western blotting following UCA1 overexpression or knock down., #P>0.05. (D) Wound healing assay was used to detect the effect of UCA1 following knockdown of MRTF-A on SW480 cells migration. Migration, ×100. #P>0.05 vs. control or NC at 24 h, respectively. (E) Transwell invasion assay was used to detect the effect of MRTF-A following overexpression or knockdown of UCA1 on SW480 cells invasion. Scale bar, 50 µm. #P>0.05. UCA1, urothelial cancer associated 1; MRTF-A, myocardin-related transcription factor A; sh, small hairpin RNA; MMP, matrix metalloproteinase; NC, negative control; N.S., not significant.

Potential competitive binding of UCA1 of ERK1/2 for MRTF-A

Previous studies have demonstrated that ERK1/2 phosphorylates MRTF-A (20,21). In the present study it was determined that UCA1 binds to MRTF-A protein directly through RNA-pull down technology (Fig. 5A). The Co-IP assay suggested that the presence of UCA1 may reduce the combination of ERK1/2 and MRTF-A (Fig. 5B). Further experiments suggested that UCA1 lost the ability to regulate the phosphorylation level of MRTF-A protein following inhibition of the ERK pathway (Fig. 5C). These results suggested that UCA1 regulated the phosphorylation of MRTF-A protein through ERK1/2.
Figure 5.

Potential competitive binding of UCA1 and ERK1/2 for MRTF-A. (A) RNA pull down experiment using cell lysate of SW480 cells followed by western blotting of the indicated proteins. (B) Western blotting demonstrated ERK1/2 co-IP with overexpressed or knocked down UCA1 in SW480 cells. UCA1 reduced the combination of ERK1/2 and MRTF-A. (C) SW480 cells were pre-treated with 10 µM PD98059 or an equivalent volume of dimethyl sulfoxide (control). Western blotting demonstrated p-Ser co-IP with overexpressed or knocked down UCA1. Co-IP, co-immunoprecipitation; UCA1, urothelial cancer associated 1; MRTF-A, myocardin-related transcription factor A; sh, small hairpin; ERK, extracellular signal-regulated kinase; IB, immunoblot; IP, immunoprecipitation; NC, negative control; p, phosphorylated.

Discussion

UCA 1 was first identified by Wang et al (22). It has three exons and two introns, and is located on chromosome 19 p13.12 (22,23). Tissue expression profiles demonstrated that the UCA1 gene was ubiquitously expressed in embryonic tissues, whereas, UCA1 was silenced in the majority of normal tissues in adults (with the exception of the heart and spleen) (24). Of note, accumulating evidence has indicated that the abnormal overexpression of UCA1 may cause cancer in tissues (22,23,25); however, further investigation into the molecular mechanism underlying its abnormal overexpression is required. In bladder cancer, UCA1 activates PI3K, Stat3, or Wnt signaling pathways to promote cell migration in bladder cancer (26–28) or esophageal cancer (29–31). Additionally, UCA1 alters the ability of cells to develop resistance to antineoplastic drugs through regulation of certain microRNAs (miRs) or BCL-2 in bladder cancer, CRC or gastric cancer cells (25,32–34). These previous studies confirmed that UCA1 is a biological molecule capable of promoting tumor development. It has been demonstrated that miR-1 inhibits bladder cancer by degrading UCA1 (35). These results suggested that UCA-1 may be a suitable molecular target for the clinical treatment of cancer. In-depth exploration of the function of the UCA1 molecule may contribute to the development of potential therapeutic strategies. As a nuclear transcription factor, MRTF-A may promote tumor cell migration (19). However, when MRTF-A protein is phosphorylated, it loses the ability of nuclear localization and significantly reduces the function of activating downstream target genes (20). In the present study, UCA1 and ERK may have competitively combined with MRTF-A to reduce the phosphorylation modification of MRTF-A protein, and thus increase the expression level of MRTF-A protein in the nucleus. A number of lncRNAs have been demonstrated to bind to miRs, inhibiting the silencing effect of miRs on target genes, thereby regulating the transcriptional activity of downstream genes. However, several lncRNAs are involved in the post-transcriptional regulation of genes. In the present study, it was demonstrated that UCA1 may regulate the phosphorylation of MRTF-A protein. Our findings revealed a novel molecular mechanism by which UCA1 regulates cell migration in CRC. It may additionally provide a theoretical basis for the development of UCA1 as a drug target in clinical settings. There is one limitation of the present study. For the wound healing assay, ideally cells should be serum starved during the assay. However, as medium containing 2% FBS was used, it is not completely possible to determine the effects proliferation has on wound closure.
  35 in total

1.  Silence of long noncoding RNA UCA1 inhibits malignant proliferation and chemotherapy resistance to adriamycin in gastric cancer.

Authors:  Chao Shang; Yan Guo; Jiaxing Zhang; Baojun Huang
Journal:  Cancer Chemother Pharmacol       Date:  2016-04-07       Impact factor: 3.333

2.  Recombinant human erythropoietin pretreatment attenuates myocardial infarct size: a possible mechanism involves heat shock Protein 70 and attenuation of nuclear factor-kappaB.

Authors:  Biao Xu; Guo-hua Dong; Hong Liu; Yan-qing Wang; Hai-wei Wu; Hua Jing
Journal:  Ann Clin Lab Sci       Date:  2005       Impact factor: 1.256

Review 3.  Colorectal Cancer: From the Genetic Model to Posttranscriptional Regulation by Noncoding RNAs.

Authors:  María Antonia Lizarbe; Jorge Calle-Espinosa; Eva Fernández-Lizarbe; Sara Fernández-Lizarbe; Miguel Ángel Robles; Nieves Olmo; Javier Turnay
Journal:  Biomed Res Int       Date:  2017-05-10       Impact factor: 3.411

4.  lncRNA DANCR promotes tumor progression and cancer stemness features in osteosarcoma by upregulating AXL via miR-33a-5p inhibition.

Authors:  Nian Jiang; Xuedi Wang; Xianbiao Xie; Yan Liao; Ni Liu; Junfeng Liu; Nabo Miao; Jingnan Shen; Tingsheng Peng
Journal:  Cancer Lett       Date:  2017-06-19       Impact factor: 8.679

5.  Upregulated H19 contributes to bladder cancer cell proliferation by regulating ID2 expression.

Authors:  Ming Luo; Zuowei Li; Wei Wang; Yigang Zeng; Zhihong Liu; Jianxin Qiu
Journal:  FEBS J       Date:  2013-03-06       Impact factor: 5.542

6.  lncRNA UCA1 inhibits esophageal squamous-cell carcinoma growth by regulating the Wnt signaling pathway.

Authors:  Xianghu Wang; Zhikui Gao; Juan Liao; Muhe Shang; Xiajun Li; Lihong Yin; Yuepu Pu; Ran Liu
Journal:  J Toxicol Environ Health A       Date:  2016

7.  Urothelial carcinoma associated 1 is a hypoxia-inducible factor-1α-targeted long noncoding RNA that enhances hypoxic bladder cancer cell proliferation, migration, and invasion.

Authors:  Mei Xue; Xu Li; Zhengkun Li; Wei Chen
Journal:  Tumour Biol       Date:  2014-04-16

8.  UCA1, a long non-coding RNA up-regulated in colorectal cancer influences cell proliferation, apoptosis and cell cycle distribution.

Authors:  Yu Han; Ying-nan Yang; Heng-heng Yuan; Ting-ting Zhang; Hong Sui; Xiao-li Wei; Lei Liu; Peng Huang; Wen-jie Zhang; Yu-xian Bai
Journal:  Pathology       Date:  2014-08       Impact factor: 5.306

Review 9.  Urothelial cancer associated 1: a long noncoding RNA with a crucial role in cancer.

Authors:  Mei Xue; Wei Chen; Xu Li
Journal:  J Cancer Res Clin Oncol       Date:  2015-09-04       Impact factor: 4.553

10.  Upregulation of long non-coding RNA urothelial carcinoma associated 1 by CCAAT/enhancer binding protein α contributes to bladder cancer cell growth and reduced apoptosis.

Authors:  Mei Xue; Xu Li; Wenjing Wu; Shuwan Zhang; Shouzhen Wu; Zhengkun Li; Wei Chen
Journal:  Oncol Rep       Date:  2014-03-19       Impact factor: 3.906

View more
  1 in total

1.  Circular RNA MAT2B Induces Colorectal Cancer Proliferation via Sponging miR-610, Resulting in an Increased E2F1 Expression.

Authors:  Jian Pei Zhao; Li Li Chen
Journal:  Cancer Manag Res       Date:  2020-08-10       Impact factor: 3.989

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.