Literature DB >> 31572503

MicroRNA-9 inhibits gastric cancer cell proliferation and migration by targeting neuropilin-1.

Cheng Hang1, Hui-Shen Yan2,3, Chen Gong1, Hua Gao1, Qiu-Hui Mao1, Jian-Xin Zhu1.   

Abstract

Gastric cancer (GC) is a global health problem with poor clinical outcomes. The mechanism of its development and progression remains largely unclear. The present study investigated the role of microRNA-9 (miR-9-5p) in the development and progression of GC. Overexpression of miR-9-5p led to reduced expression of neuropilin-1 (NRP-1) in GC cells. Dual-luciferase reporter assay results indicated that miR-9-5p directly targeted NRP-1. Furthermore, overexpression of miR-9-5p in GC cells increased the expression of mesenchymal markers, N-cadherin and vimentin, and decreased the expression of epithelial markers, E-cadherin and β-catenin. Overexpression of miR-9-5p inhibited GC cell proliferation, migration and invasion, and increased the sensitivity of GC cells to the anti-cancer drug cisplatin. By contrast, the opposite effects were observed in GC cells following downregulation of miR-9-5p. Taken together, the present findings suggested that miR-9-5p suppressed NRP-1 expression and inhibited GC cell proliferation and invasion. In addition, miR-9-5p overexpression attenuated GC cell resistance to anti-cancer drugs, which highlighted the potential of miR-9-5p as a target for the treatment of GC. Copyright: © Hang et al.

Entities:  

Keywords:  gastric cancer; microRNA-9; neuropilin-1

Year:  2019        PMID: 31572503      PMCID: PMC6755461          DOI: 10.3892/etm.2019.7841

Source DB:  PubMed          Journal:  Exp Ther Med        ISSN: 1792-0981            Impact factor:   2.447


Introduction

Gastric cancer (GC) is one of the leading causes of cancer related mortality globally (1). China has a high prevalence of GC (2), where the incidence ranked second and the mortality ranked third for all types of cancers (3). Although comprehensive studies of GC have been performed, the mechanisms of its development, progression, metastasis and invasion remain largely unclear, which greatly limits GC therapeutic treatments. MicroRNAs (miRs) are a class of small non-coding RNA molecules that contain ~22 nucleotides and have important roles in regulating gene expression at the post-transcriptional level (4). Over the past few decades, significant research has been conducted on the dysregulation of miRs in human cancers, which helped elucidate various mechanisms of the development and progression of cancers (5). Therefore, identification of specific miRs that are responsible for tumorigenesis could serve a role in the treatment of GC. Neuropilin-1 (NRP-1) is a transmembrane protein that participates in various physiological and pathological processes (6). Recently, the role of NRP-1 in mediating tumor development, progression, invasion and metastasis has attracted increasing interest as studies have identified that NRP-1 overexpression is associated with tumorigenesis and poor clinical outcomes in numerous cancer types (7,8). In the present study, the role of miR-9-5p and NRP-1 in GC cells was investigated. It was identified that miR-9-5p could directly bind to the 3′-untranslated region (3′-UTR) of NPR-1 and suppress NRP-1 expression, resulting in inhibition of GC cell proliferation and invasion. miR-9-5p also increased the sensitivity of GC cells to chemotherapeutic drugs. The present findings suggested a mechanism for GC tumorigenesis and provided valuable insights for the development of a novel chemotherapeutic drug for GC.

Materials and methods

Cell culture

GC cell lines, MKN-45 and HGC-27, were purchased from the Type Culture Collection of the Chinese Academy of Sciences. All cells were cultured in RPMI-1640 supplemented with 20% fetal bovine serum (FBS) and 1% antibiotics (all Gibco; Thermo Fisher Scientific, Inc.) in a 37°C incubator with 5% CO2. Cells in the exponential growth phase were used for experiments.

miR-9-5p transfection

miR-9-5p mimic, inhibitor and scramble control were purchased from GeneCopoeia Ltd. (iGeneBio). The mimic, inhibitor and their scramble controls were transfected to MKN-45 and HGC-27 cells at a concentration of 100 nM by Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 48 h after transfection, the cells were used for further experiments. The sequences are as follows: Mimic: 5′-AUAAAGCUAGAUAACCGAAAGU-3′; scramble control for mimic: 5′-UCACAACCUCCUAGAAAGAGUAGA-3′; inhibitor: 5′-UCUUUGGUUAUCUAGCUGUAUGA-3′; scramble control for inhibitor: 5′-GGUUCGUACGUACACUGUUCA-3′.

Dual-luciferase assay

TargetScan (www.targetscan.org) is an online database to predict biological targets of miRNAs. By searching for miR-9-5p, the authors found that NRP-1 is a potential biological target. In order to understand the interaction between miR-9-5p and NRP-1, pmiR-RB-report plasmids (RiboBio Inc) containing WT NRP-1 3-UTR were transfected into GC cells simultaneously with mimic, inhibitor or scramble control using Lipofectamine 2000. pmiR-RB-report plasmids containing mutant (MUT) NRP-1 3-UTR were also used as a negative control as it should not interact with miR-9-5p. The assay was performed using the Dual luciferase reporter assay (Promega Corporation) according to manufacturer's protocol. After 48 h, luciferase activity was measured using Dual-Luciferase report assay luminometer (Promega Corporation). The data were presented as the ratio of firefly to Renilla luciferase activity.

Western blot analysis

RIPA cell lysis buffer (Beyotime Institute of Biotechnology) was used to obtain cell lysates. Proteins were quantified using bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.) then 20 µg protein were loaded per lane and separated via SDS-PAGE on a 10% gel. Separated proteins were then transferred to polyvinylidene difluoride membranes. Following blocking with 5% fat-free milk in PBS for 2 h at room temperature, the membranes were incubated with primary antibodies against GAPDH (cat. no. MB001; 1:2,000; Bioworld Technology, Inc.), NRP-1 (cat. no. ab81321; 1:1,000; Abcam), N-cadherin (cat. no. sc-59987; 1:1,000; Santa Cruz Technology, Inc.), vimentin (cat. no. BS1855; 1:1,000; Bioworld Technology, Inc.), E-cadherin (cat. no. sc-71007; 1:1,000; Santa Cruz Technology, Inc.) and β-catenin (cat. no. ab32572; 1:1,000; Abcam) at 4°C overnight. Membranes were then incubated with horseradish peroxidase-conjugated goat anti-mouse (cat. no. BS12478) or anti-rabbit (cat. no. BS13278; both 1:5,000; Bioworld Technology, Inc.) secondary antibodies for 1 h at room temperature. Following washing, the proteins of interest were visualized by enhanced chemiluminescence Plus Western Blotting Substrate (Thermo Fisher Scientific, Inc.) and ChemiDoc Gel Imaging System (Bio-Rad Laboratories, Inc.).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reverse transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio, Inc.) at 37°C for 15 min and 85°C for 5 sec. TB Green Advantage qPCR premixes (Takara Bio, Inc.) was used to amplify the target genes. The following thermocycling conditions were used: Initial denaturation at 95°C for 30 sec; 40 cycles of 95°C for 5 sec and 60°C for 31 sec. GAPDH was used as an internal control and the relative mRNA expression of genes were calculated using 2−ΔΔCq (9). Primers are listed in Table I.
Table I.

Primer sequences used for reverse transcription- quantitative PCR.

GenePrimer sequence (5′-3′)
microRNA-9-5pF: ACACTCCAGCTGGGTCTTTGGTTATCTAGCT
R: TGGTGTCGTGGAGTCG
NRP-1F: CAGGTGATGACTTCCAGCTC
R: CCCAGTGGCAGAAGGTCTTG
E-cadherinF: AAGAAAACCCGAAGAGG
R: CTGACTCAAGGTGCAGC
N-cadherinF: TGACTCCCTGTTAGTGTTTGAC
R: CCCAGTCGTTCAGGTAATCATAG
VimentinF: CCTGAACCTGAGGGAAACTAAT
R: CGTTGATAACCTGTCCATCTCT
β-cateninF: CTTCACCTGACAGATCCAAGTC
R: CCTTCCATCCCTTCCTGTTTAG
GAPDHF: GGTGTGAACCATGAGAAGTATG
R: GAGTCCTTCCACGATACCAAAG

NRP-1, neuropilin-1; F, forward; R, reverse.

Cell migration assays

Cells in the exponential growth phase were plated into 6-well plates and cultured to 95% confluence. Following serum starvation overnight, a wound was created using a sterile tip that was scratched in the central area of the well. Cells were cultured in serum-free medium following washing with PBS to remove floating cells and debris. Images of cell migration were captured at 0 and 48 h following wound induction by using a light microscope at a magnification of ×40.

Invasion assay

A total of 5×104 cells were suspended in 200 µl serum-free RPMI-1640 medium and seeded into the upper chambers of Transwell inserts (BD Biosciences). The Transwell inserts had been coated with 30 µl Matrigel (BD Biosciences) and incubated in the incubator for 4 h. A total of 500 µl RPMI-1640 medium containing 10% fetal calf serum (FCS; Gibco; Thermo Fisher Scientific, Inc.), used as the chemo-attractant, were added to the lower wells. Following incubation for 16 h, the chambers were fixed with 4% paraformaldehyde for 20 min at room temperature and stained with crystal violet (Beyotime Institute of Biotechnology) for 30 min at room temperature. Cells on the lower membranes were counted in five randomly selected fields (magnification, ×200) under a light microscope.

Colony-formation assay

Cells in the exponential growth phase were plated into 60-mm dishes at a concentration of 1,000 cells/dish and cultured in RPMI-1640 medium with 10% FCS for 14 days. Then the culture media were removed and the cells were fixed in 4% paraformaldehyde solution for 30 min at room temperature. Following staining with 1% crystal violet solution for 30 min at room temperature, the cells were counted using an inverted microscope at a magnification of ×40.

Flow cytometry

A total of 3×104 cells/well were plated into 96-well plates, and were treated with 10 µg/ml cisplatin (Sigma Aldrich; Merck KGaA). After 24 h, the cells were stained with propidium iodide (PI) and Annexin V-fluroescein isothiocyanate (FITC) kit [Multisciences (Lianke) Biotech Co., Ltd.] and analyzed by flow cytometry. The percentage of live cells, apoptotic cells and dead cells were analyzed using FlowJo software (version 10; FlowJo LLC).

Statistical analysis

Data were analyzed with the statistical software SPSS (version 19; IBM Corp.) and displayed as a mean ± standard deviation. Comparisons between two groups were analyzed using Student's unpaired two-sample t-test. Cells transfected with miR-9-5p mimics were compared with the cells transfected with the corresponding scramble control only, whilst the cells transfected with miR-9-5p inhibitor were compared with the cells transfected with the corresponding scramble control only. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-9-5p suppresses NRP-1 expression

TargetScan was used to predict genes under the regulation of miR-9-5p and it was determined that NRP-1 was a candidate. Thus, the mimic and inhibitor of miR-9-5p were transfected into the GC cell lines, MKN-45 and HGC-27, to investigate whether miR-9-5p could regulate the expression of NRP-1. Expression of miR-9-5p was upregulated following transfection with its mimics in both cell lines, whilst the inhibitor downregulated the expression of miR-9-5p (Fig. 1A). Western blotting and RT-qPCR were used to examine the NRP-1 protein and mRNA expression. When miR-9-5p was overexpressed, the mRNA and protein expression levels of NRP-1 were significantly decreased compared with GC cells transfected with the scramble control. By contrast, the inhibitor of miR-9-5p increased NRP-1 expression compared with the inhibitor control (Fig 1B and C). To understand whether NRP-1 was a direct target of miR-9-5p, dual-luciferase reporter vectors containing wild-type NRP-1 3-UTR sequence and mutant NRP-1 3-UTR sequence were established. The transcriptional activity of NRP-1 3-UTR decreased when cells were transfected with miR-9-5p mimics, whilst the miR-9-5p inhibitor demonstrated the opposite effect. miR-9-5p had no significant effect on mutant NRP-1 3-UTR (Fig. 1D-F). These results indicated that miR-9-5p suppressed the expression of NRP-1.
Figure 1.

miR-9-5p suppresses NRP-1 expression in GC cells. (A) Expression of miR-9-5p was upregulated following transfection with its mimics and downregulated by its inhibitor as determined by RT-qPCR. (B) Western blot analysis and (C) RT-qPCR demonstrated that NRP-1 expression increased in GC cells treated with miR-9-5p inhibitor, and decreased in GC cells following miR-9-5p overexpression. (D) Design of WT NRP-1 3′-UTR and Mut NRP-1 3′-UTR. Dual-luciferase assay demonstrated that miR-9-5p inhibitor increased NRP-1 3′-UTR transcriptional activities and miR-9-5p mimic had the opposite effect in (E) MKN-45 and (F) HGC-27 cells. Co-transfection with mutant NRP-1 3′-UTR inhibitor and mimic did not change the activities. *P<0.05 vs. miR-9-5p inhibitor control group; #P<0.05 vs. miR-9-5p-5p mimics control group. miR, microRNA; NRP-1, neuropilin-1; GC, gastric cancer; RT-qPCR, reverse transcription-quantitative PCR; UTR, untranslated region; WT, wild-type; Mut, mutant.

miR-9-5p inhibits epithelial-mesenchymal transition (EMT) in GC cells

NRP-1 has been reported to promote EMT in different types of cancer (7,8). In order to understand if miR-9-5p could inhibit EMT by targeting NRP-1 in GC cells, GC cells were transfected with miR-9-5p mimic, inhibitor or respective scramble controls. Results demonstrated that EMT phenotypes were inhibited in MKN-45 and HGC-27 cells transfected with miR-9-5p mimic, which presented as an increased expression of mesenchymal markers, N-cadherin and vimentin, and decreased expression of epithelial markers, E-cadherin and β-catenin, when compared to its corresponding control (Fig. 2). By contrast, MKN-45 and HGC-27 cells transfected with miR-9-5p inhibitor displayed the opposite effects with decreased expression of N-cadherin and vimentin, and increased expression of E-cadherin and β-catenin (Fig. 2). These results demonstrated that overexpression of miR-9-5p downregulated NRP-1 expression and inhibited EMT in GC cells.
Figure 2.

miR-9-5p inhibits EMT in GC cells by targeting NRP-1. (A) Western blot analysis of mesenchymal and epithelial proteins. (B) Reverse transcription-quantitative PCR demonstrated that miR-9-5p inhibitor increased expression of E-cadherin and (C) β-catenin, and decreased (D) N-cadherin and (E) vimentin expression whilst overexpression of miR-9-5p produced the opposite effect. *P<0.05 vs. miR-9-5p inhibitor control group; #P<0.05 vs. miR-9-5p mimics control group. miR, microRNA; EMT, epithelial-mesenchymal transition; GC, gastric cancer; NRP-1, neuropilin-1.

miR-9-5p inhibits GC cell migration and invasion

The effect of miR-9-5p on cell migration and invasion by targeting NRP-1 was investigated. Scratch assay demonstrated that MKN-45 and HGC-27 cells transfected with miR-9-5p mimic exhibited decreased cell migration as the wounded area was larger compared with GC cells transfected with the scramble control at 48 h (Fig. 3A). By contrast, miR-9-5p inhibitor increased cell migration compared with the control (Fig. 3A). Transwell assay also demonstrated significantly decreased invasive ability of cells in the miR-9-5p mimic group compared with the control. GC cells transfected with miR-9-5p inhibitor demonstrated increased ability of invasion compared with the control (Fig. 3B).
Figure 3.

miR-9-5p reduces GC cell migration and invasion. (A) Migration assay demonstrated that downregulation of miR-9-5p increased GC cell migration whilst overexpression of miR-9-5p decreased GC cell migration. (B) Transwell assay demonstrated that miR-9-5p inhibitor increased cell invasion whilst upregulation of miR-9-5p decreased GC cell invasion. Magnification, ×40. *P<0.05 vs. miR-9-5p inhibitor control group; #P<0.05 vs. miR-9-5p mimics control group. miR, microRNA; GC, gastric cancer.

miR-9-5p inhibits cell proliferation and alleviates drug- resistance in GC cells

Colony-formation assay was used to examine the effect of miR-9-5p on cell proliferation as NRP-1 has been reported to promote cancer cell growth (7). Results demonstrated that MKN-45 and HGC-27 cells transfected with miR-9-5p mimics displayed a decreased colony-formation capability compared with the scramble control whilst GC cells transfected with miR-9-5p inhibitor demonstrated a higher colony-formation capability (Fig. 4A), which suggested that miR-9-5p inhibited GC cell proliferation. When GC cells were treated with a chemotherapeutic drug (10 µg/ml cisplatin for 24 h) the cells transfected with miR-9-5p mimic had a high rate of apoptosis compared with cells transfected with the scramble control (Fig. 4B). In addition, GC cells transfected with the inhibitor of miR-9-5p had a decreased apoptosis rate compared with the control (Fig. 4B). These results suggested that miR-9-5p decreased the resistance of GC cells to a widely used chemotherapy drug.
Figure 4.

miR-9-5p inhibits cell proliferation and drug resistance of GC cells. (A) Colony-formation assay demonstrated that GC cells transfected with miR-9-5p inhibitor increased colony-formation whilst the opposite effects were observed when GC cells overexpressed miR-9-5p. (B) Flow cytometry demonstrated that miR-9-5p inhibitor increased GC cell apoptosis, whilst miR-9-5p mimic decreased the apoptosis of GC cells following treatment with 10 µg/ml cisplatin. *P<0.05 vs. miR-9-5p inhibitor control group; #P<0.05 vs. miR-9-5p mimics control group. miR, microRNA; GC, gastric cancer; PI, propidium iodide.

Discussion

In recent years, a strong correlation between miRs and malignant tumors has been identified. miRs are not only involved in the regulation of metastasis, invasion and progression of cancers (10,11), but also in resistance initiation to anticancer therapeutics (11). miR-9-5p was discovered in 2005 and identified to be a factor that regulates neuronal progenitor cells. Over the past decades, the role of miR-9-5p on tumorigenesis in breast cancer, osteosarcoma and hepatocellular carcinoma has been confirmed since the overexpression of miR-9-5p correlates with advanced tumor stages and poor prognosis (12–14). However, there is evidence that miR-9-5p suppresses the proliferation, invasion and metastasis of cancers (15,16) and also enhances the sensitivity of cancer cells to anti-cancer therapy (17). The present study identified that upregulation of miR-9-5p in GC cells resulted in the inhibition of invasion, and increased GC cell sensitivity to anticancer therapeutics. By contrast, downregulation of miR-9-5p in GC cells produced the opposite results. Therefore, the present findings suggested that miR-9-5p had a role in suppressing the development of GC. EMT is a potential mechanism of tumor progression where epithelial-derived tumor cells undergo phenotypic switches to acquire mesenchymal phenotypes (18). During the transition, tumor cells downregulate E-cadherin, leading to disassembly of intercellular adhesions (19) and enhanced cell motility and migration (20). Recently, increasing evidence suggests that EMT has a key role in GC progression, invasion and metastasis (21). GC patients with a non-EMT phenotype have a better prognosis compared with patients with EMT phenotypes (22,23). Mesenchymal markers are overexpressed and the epithelial markers are weakly expressed in human gastric circulating tumor cells, indicating that EMT plays a key role in GC metastasis (24). The present study determined that miR-9-5p overexpression inhibited the EMT process by upregulating the expression of mesenchymal markers N-cadherin and vimentin, and downregulating the epithelial cell markers, E-cadherin and β-catenin. NRP-1 is a 120–130 kDa type I transmembrane glycoprotein first reported as a regulator of neuron development (25). Recently, the role of NRP-1 in tumor initiation and development has been identified since it is overexpressed in numerous cancers (26). NRP-1 functions as a vascular endothelial growth factor receptor to regulate angiogenesis in tumors. Miao et al (27) established a xenograft tumor model with overexpression of NRP-1 and observed enhancement of microvessel density and dilated blood vessels, which resulted in increased tumor size and decreased tumor cell apoptosis. NRP-1 has a direct role in the function of tumor cells. NRP-1 expression in patient tumor samples directly correlates with tumor stage, poor prognosis and tumor aggressiveness (28). In the present study, it was identified that NRP-1 was the direct target of miR-9-5p, as the transcriptional activity of NRP-1 3′-UTR was decreased when miR-9-5p was overexpressed in GC cells. Overexpression of miR-9-5p in GC cells decreased NRP-1 expression leading to inhibition of the EMT process and invasion, as well as the increased sensitivity of GC cells to an anticancer drug. By contrast, downregulation of miR-9-5p in GC cells produced the opposite effect. Therefore, the miR-9-5p/NRP-1 axis may be a potential therapeutic target for the treatment of GC; however further in vitro, in vivo and clinical studies are required to fully elucidate the regulatory mechanisms between miR-9-5p and NRP-1 in GC. In conclusion, the present findings suggested that miR-9-5p inhibited NRP-1 expression resulting in the suppression of EMT, and the inhibition of cell proliferation and invasion of GC cells. Overexpression of miR-9-5p reduced cell resistance to anticancer therapeutics and therefore, the miR-9-5/NRP-1 axis may be a potential therapeutic target for the treatment of GC.
  28 in total

1.  Neuropilin-1 expression by tumor cells promotes tumor angiogenesis and progression.

Authors:  H Q Miao; P Lee; H Lin; S Soker; M Klagsbrun
Journal:  FASEB J       Date:  2000-12       Impact factor: 5.191

Review 2.  New signals from the invasive front.

Authors:  Gerhard Christofori
Journal:  Nature       Date:  2006-05-25       Impact factor: 49.962

3.  Epithelial-to-mesenchymal transition predicts prognosis in clinical gastric cancer.

Authors:  Toshifumi Murai; Suguru Yamada; Bryan C Fuchs; Tsutomu Fujii; Goro Nakayama; Hiroyuki Sugimoto; Masahiko Koike; Michitaka Fujiwara; Kenneth K Tanabe; Yasuhiro Kodera
Journal:  J Surg Oncol       Date:  2014-01-22       Impact factor: 3.454

4.  Gastric cancer.

Authors:  Henk H Hartgrink; Edwin P M Jansen; Nicole C T van Grieken; Cornelis J H van de Velde
Journal:  Lancet       Date:  2009-07-20       Impact factor: 79.321

Review 5.  Neuropilins: structure, function and role in disease.

Authors:  Caroline Pellet-Many; Paul Frankel; Haiyan Jia; Ian Zachary
Journal:  Biochem J       Date:  2008-04-15       Impact factor: 3.857

6.  Specific cell surface labels in the visual centers of Xenopus laevis tadpole identified using monoclonal antibodies.

Authors:  S Takagi; T Tsuji; T Amagai; T Takamatsu; H Fujisawa
Journal:  Dev Biol       Date:  1987-07       Impact factor: 3.582

7.  miR-23a inhibits E-cadherin expression and is regulated by AP-1 and NFAT4 complex during Fas-induced EMT in gastrointestinal cancer.

Authors:  Haoxuan Zheng; Wenjing Li; Yadong Wang; Tingting Xie; Yidong Cai; Zhiqing Wang; Bo Jiang
Journal:  Carcinogenesis       Date:  2013-08-08       Impact factor: 4.944

8.  miR-17-92 host gene, uderexpressed in gastric cancer and its expression was negatively correlated with the metastasis.

Authors:  F Bahari; M Emadi-Baygi; P Nikpour
Journal:  Indian J Cancer       Date:  2015 Jan-Mar       Impact factor: 1.224

9.  Up-regulation of miR-9 expression predicate advanced clinicopathological features and poor prognosis in patients with hepatocellular carcinoma.

Authors:  Lizhi Cai; Xi Cai
Journal:  Diagn Pathol       Date:  2014-12-31       Impact factor: 2.644

10.  microRNA-9 suppresses the proliferation, invasion and metastasis of gastric cancer cells through targeting cyclin D1 and Ets1.

Authors:  Liduan Zheng; Teng Qi; Dehua Yang; Meng Qi; Dan Li; Xuan Xiang; Kai Huang; Qiangsong Tong
Journal:  PLoS One       Date:  2013-01-31       Impact factor: 3.240

View more
  7 in total

1.  miR-128-3p Inhibits NRP1 Expression and Promotes Inflammatory Response to Acute Kidney Injury in Sepsis.

Authors:  Lin Wang; Kai Wang; Zhengyun Tian
Journal:  Inflammation       Date:  2020-10       Impact factor: 4.092

2.  Long non-coding RNA linc00921 suppresses tumorigenesis and epithelial-to-mesenchymal transition of triple-negative breast cancer via targeting miR-9-5p/LZTS2 axis.

Authors:  Jie Zhang; Lina Zhang; Jianlong Wang; Jing Zhao; Xuelian Zhao; Chunli Zhang; Peng Han; Cuizhi Geng
Journal:  Hum Cell       Date:  2022-02-18       Impact factor: 4.374

3.  MicroRNA-19b-3p suppresses gastric cancer development by negatively regulating neuropilin-1.

Authors:  Yingfeng Wei; Sheng Guo; Jianhua Tang; Jianjun Wen; Huifen Wang; Xiaobo Hu; Qiuping Gu
Journal:  Cancer Cell Int       Date:  2020-05-25       Impact factor: 5.722

4.  Neuropilin1 silencing impairs the proliferation and migration of cells in pancreatic cancer.

Authors:  Li-Hong He; Yong-Lin He; Wen-Hang Zuo; Yue Kang; Huan Xue; Ling-Yun Wang; Yun-Liang Zhang; Yong Meng
Journal:  J Clin Lab Anal       Date:  2020-05-30       Impact factor: 2.352

Review 5.  Neuropilin (NRPs) Related Pathological Conditions and Their Modulators.

Authors:  Matic Broz; Anja Kolarič; Marko Jukič; Urban Bren
Journal:  Int J Mol Sci       Date:  2022-07-29       Impact factor: 6.208

6.  miR-9-5p Promotes Lung Adenocarcinoma Cell Proliferation, Migration and Invasion by Targeting ID4.

Authors:  Kai Zhu; Jinlan Lin; Shengjia Chen; Qian Xu
Journal:  Technol Cancer Res Treat       Date:  2021 Jan-Dec

7.  Evaluation of Serum MicroRNAs (miR-9-5p, miR-17-5p, and miR-148a-3p) as Potential Biomarkers of Breast Cancer.

Authors:  Xiaoqin Li; Xinyue Tang; Kunsong Li; Ling Lu
Journal:  Biomed Res Int       Date:  2022-01-24       Impact factor: 3.411

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.