Methylenetetrahydrofolate reductase polymorphism in healthy volunteers and its correlation with homocysteine levels in patients with thrombosis.

OBJECTIVE: To determine prevalence of methylenetetrahydrofolate reductase (MTHFR) mutations in apparently healthy individuals residing in Mumbai and patients with deep vein thrombosis (DVT) and coronary artery disease (CAD) and to correlate these polymorphisms with homocysteine (Hcy) levels.
MATERIALS AND METHODS: This case-control study was initiated after receiving ethical approval and following the participant's written consent. One hundred and twenty unmatched healthy volunteers and 240 patients with arterial and venous thrombosis were enrolled. The prevalence of C677T and A1298C MTHFR mutations was detected using polymerase chain reaction-restriction fragment length polymorphism technique. Serum Hcy concentration and lipid levels were determined using biochemical kits.
RESULTS: Allele frequency of 677T was 7%, 15%, and 14% in healthy controls, DVT, and CAD patients, respectively, while for 1298C allele, it was 31%, 33%, and 29%, respectively. The lipid markers in CAD patients were significantly low in comparison to the controls while the Hcy level in patients with thrombosis was higher in comparison with the controls. Highest Hcy levels were observed in participants with TT genotype followed by CT genotype and CC genotype in all the three groups. A higher risk of raised Hcy levels was seen in the variants (CT + TT) as compared to CC genotype in DVT (odds ratio [OR] = 3.39, 95% confidence interval [CI] = 1.39-8.2,P < 0.01) and CAD (OR = 21.67, 95%CI = 4.87-96.47,P < 0.0001). The risk observed for A1298C was 2.28 and 2.12 times higher in variants (AC + CC) of both DVT and CAD (OR = 2.28, 95%CI = 1.09-4.75 and OR = 2.12, 95%CI = 1.02-4.40, respectively).
CONCLUSIONS: The prevalence of variants was more in thrombosis patients as compared to unmatched controls. Our study highlights the fact that MTHFR C677T polymorphism as compared to A1298C significantly affects Hcy levels in patients with thrombosis indicating that patients with mutant variants are at higher risk of rapid progression of their disease condition. Copyright:

Introduction

Homocysteine (Hcy) metabolism is dependent on folic acid which in turn is influenced by the methylenetetrahydrofolate reductase (MTHFR) enzyme. Thus, MTHFR deficiency causes an increase in Hcy concentration leading to a condition known as homocystinuria. Raised Hcy level is associated with atherosclerosis, venous thrombosis, cardiovascular disorders,[1] neurodegenerative disorders like Alzheimer's disease,[2] diabetes mellitus,[3] and neural tube defects.[4] Conversion of 5,10-methylenetetrahydrofolate to 5-methylenetetrahydrofolate is catalyzed by the MTHFR enzyme by donating a methyl group which converts Hcy to methionine. The methyl cycle is essential for various methylation reactions required for maternal and paternal imprinting by methylated DNA which are dependent on genetic expression of the enzymes.

The MTHFR gene is 20 kb long and is located at 1p36.3 which has 11 exons. More than 40 single nucleotide polymorphisms have been detected in the MTHFR gene, of which C677T and A1298C are of clinical importance. The C677T variant involves substitution of cytosine by thymine at 677th position of the gene and replacement of alanine by valine at the protein level. Another clinically important variant is A1298C, which involves substitution of adenosine by cytosine at 1298th position of the gene resulting in a glutamate to alanine replacement which in turn results in reduced enzymatic activity. Individuals with TT genotype of MTHFR C677T have 50% reduction in enzyme activity. Some studies have documented an increased risk of CVD and hyperhomocysteinemia and/or low levels of folate with the T allele.[5]

Although there are many studies that have demonstrated an association between hyperhomocysteinemia and thrombosis, not much is known about the etiopathogenesis. Different mechanisms may be responsible; however, it is possible that some of these mechanisms have a role in both the etiopathogenesis and the progression of both venous and arterial thrombosis. One meta-analysis showed association between C677T and A1298C polymorphisms and elevated Hcy level in conditions such as deep vein thrombosis (DVT), acute myocardial ischemia, and PE.[6] Conversely, in other meta-analyses, no significant associations were documented.[78] Some studies have analyzed the prevalence of C677T and/or A1298C polymorphisms in coronary artery disease (CAD), pulmonary embolism, DVT, and their correlation with Hcy level. However, there is limited information regarding these polymorphisms in the Indian population,[910111213] and there are no data available for Mumbai.

Given that the available evidence is equivocal, the present study was planned to determine the population prevalence of MTHFR C677T and MTHFR A1298C gene in normal healthy Indian individuals residing in Mumbai for more than two generations. We also assessed whether this genetic mutation influences Hcy concentration in patients with both arterial and venous thrombosis.

Materials and Methods

Ethical considerations

Institutional Ethics Committee for Academic Research Projects (ECARP) approval was obtained (vide no. ECARP/2013/142 dated October 10, 2014) before study commencement. The study was conducted in accordance to Indian GCP (2001) guidelines and ICMR ethical guidelines (2006). The study has been registered at the Clinical Trials Registry of India (CTRI/2018/08/015420).

Study participants

A total of 360 participants were enrolled to study the association of MTHFR C677T and MTHFR A1298C gene polymorphism and Hcy levels in healthy volunteers and patients with thrombosis. This cross-sectional unmatched case–control study involved 2 subsets of study participants, 120 apparently healthy controls, and 240 patients with venous thrombosis (DVT) and arterial thrombosis (CAD). Healthy individuals between age group of 25–70 years with no history of any major illness in the past 6 months and no personal history of cardiovascular disease or thrombosis, diabetes mellitus, hypertension, and hyperlipidemia and who were ready to give informed consent were considered for the study. Among the patients with thrombosis, there were 2 subsets; one subset had patients with CAD as determined on angiogram, with at least 1 major vessel having more than 75% stenosis or patients with previous history of myocardial infarction or angina pectoris and the second subset includes patients with evidence of DVT involving lower extremities, abdominal vein as seen on Doppler studies, cortical venous thrombosis (as seen from magnetic resonance venography), and pulmonary embolism (as seen from computed tomography [CT] pulmonary angiography).

Apparently healthy volunteers were recruited through word-of-mouth publicity about the study. Patients attending the hematology and cardiology OPD of our hospital were screened for their eligibility to participate in the study. All participants who fulfilled the inclusion criteria and consented to participate in the study were recruited. Detailed medical history, demographic data, and medications taken were obtained from each patient and recorded. All the study participants were asked to come after an overnight fasting of 12 h for blood collection, and 10 ml of blood was aseptically collected (5 ml in polystyrene tube containing EDTA for assessing MTHFR polymorphisms and 5 ml of tube in red cap vacutainer with clot activator for Hcy and lipid profile [except for DVT patients]).

Phenotypic and genotypic variables' assessment

Serum Hcy levels were analyzed using kits procured from accurex and lipid profile (cholesterol, triglyceride, high-density lipoprotein [HDL] cholesterol, and low-density lipoprotein [LDL] cholesterol) were assessed only in controls and CAD patients using kit procured from Diasys on fully automated biochemistry analyzer, XL-640 (Transasia Biomedicals limited).

Genomic DNA was isolated by phenol–chloroform method, and the purity and quantification were carried out spectrophotometrically. Genotyping of MTHFR 6C77T and MTHFR A1298C polymorphism was carried out by the polymerase chain reaction-restriction fragment length polymorphism technique. The details of the same are mentioned in Table 1.

Table 1

Details of polymerase chain reaction and restriction enzyme of methylenetetrahydrofolate reductase C677T and A1298C polymorphism

MTHFR polymorphism	Primers	PCR product size (bp)	RE and banding pattern
6C77T	FP=5’TGAAGGAGAAGGTGTCTGCGGGA3’RP=5’AGGACGGTGCGGTGAGAGTG3’	198	Hinf ICC=198CT=198,175,23TT=175,23
A1298C	FP=5’CTT TGG GGA GCT GAA GGA CTA CTAC3’RP=5’CAC TTT GTG ACC ATT CCG GTT TG3’	163	Mbo IIAA=56,30,28,18AC=84,56,30,28,18CC=84,30,18

PCR=Polymerase chain reaction, MTHFR=Methylenetetrahydrofolate reductase, RE=Restriction enzyme

Statistical analysis

The fasting serum Hcy concentration above 15μmol/dl was considered as hyperhomocysteinemia for the study. Allele and genotype frequency was calculated and tested for Hardy–Weinberg equilibrium using Chi-square test. Relative risk among the genotypes in both CAD and DVT patients was estimated by odds ratio. Chi-square analysis was done to assess the genotype distributions between controls and cases. Quantitative data were assessed for normality using the Kolmogorov–Smirnov test. Serum lipid profile between controls and CAD patients were analyzed using Mann–Whitney test. One-way ANOVA followed by Tukey's post hoc test was used to evaluate the difference between Hcy concentrations and the different genotypes between DVT and controls whereas Kruskal–Wallis test with Dunn post hoc test was applied for comparison between CAD patients and controls. Statistical significance was considered at P < 0.05. Graphpad Instat Version 3.06 software (San Diego, California) was used for data analysis.

Results

The median age was 38.5 years in the healthy control group 42 and 52 years in the DVT and CAD patients, respectively. There was significant increase in age in CAD patients as compared to controls and DVT patients. CAD patients showed significant increase in BMI as compared to controls. Majority of participants were males except among the DVT patients. The percentage of smokers and alcohol consumers was similar in both patients with thrombosis and controls. The demographic details of patients and controls are depicted in Table 2.

Table 2

Characteristics details of controls and patients (n=360)

Parameters	Control (n=120)	DVT (n=120)	CAD (n=120)	χ2, P
Age, years	38.5 (33-47.5)	42 (31-50)	52***,@@@ (42.5-59.5)	-
Sex, (male:female)	61:59	43:77	91:29	39.47, <0.0001
BMI, kg/m2	26.1 (24.3-28.3)	25.85 (24.2-28.02)	27.3**,@@ (25.2-30.8)	-
Smoker, %	20	18.3	27.5	3.34, 0.188
Alcohol, %	15	17.5	23.3	2.89, 0.234

Results are expressed as median (range). ***P<0.001 as compared to controls. @@@P<0.001 as compared to DVT using Kruskal-Wallis followed by Dunn post hoc test. **P<0.01 as compared to controls. @@P<0.01 as compared to DVT using Kruskal-Wallis followed by Dunn post hoc test. DVT=Deep vein thrombosis, CAD=Coronary artery disease, BMI=Body mass index

Estimation of homocysteine levels and lipid profile levels

As shown in Table 3, DVT and CAD patients had significantly higher Hcy levels in comparison to controls. CAD patients had a significant decrease in serum cholesterol, HDL-cholesterol, and LDL cholesterol levels in comparison to controls.

Table 3

Serum lipid profile and homocysteine levels in control, deep vein thrombosis and coronary artery disease patients

Parameters	Control (n=120)	DVT (n=120)	CAD (n=120)
Cholesterol, mg/dl	176.8 (153.5-194.3)	-	149.3*** (129.2-179.8)
Triglyceride, mg/dl	109.05 (85.47-137.77)	-	111.15 (86.7-147.2)
HDL, mg/dl	48.45 (39.62-56.47)	-	45.5* (37.95-51.75)
LDL, mg/dl	98.4 (77.35-117.25)	-	83.1*** (67-105.27)
VLDL, mg/dl	21.81 (17.09-27.55)		21.9 (17.21-29.2)
Hcy, µmol/dl	13.25 (9.95-16.57)	15.33$ (10.22-20.7)	15.10$ (10.62-20.30)

Results are expressed as median (range). *P<0.05, ***P<0.001 as compared to controls using Mann-Whitney test, $P<0.05 as compared to controls using Kruskal-Wallis followed by Dunn post hoc test. DVT=Deep vein thrombosis, CAD=Coronary artery disease, Hcy=Homocysteine, HDL=High density lipoprotein, LDL=Low density lipoprotein, VLDL=Very low density lipoprotein

Genotype analysis

Table 4 summarizes the allelic and genotype frequencies of MTHFR C677T and A1298C mutations. On analyzing the genotype distribution of MTHFR C677T data among the controls and patients, it was seen that in all the three groups, majority of the participants belonged to wild type (CC) in comparison to the mutant variant (CT + TT). All populations were observed to be in Hardy–Weinberg equilibrium. A significant difference in the frequency of the mutant variants was noted vis-a-vis the wild type genotype in case of DVT (odds ratio [OR] = 2.07; 95% confidence interval [CI]: 1.06–4.06); whereas, in case of CAD, there was significant difference in frequency of heterozygous (CT) and mutant (CT + TT) in comparison to wild genotype (CC) with OR: 2.28; 95%CI: (1.15–4.53) and OR: 2.36; 95%CI: (1.22–4.59), respectively.

Table 4

Allelic frequency of methylenetetrahydrafolate reductase C677T and A1298C polymorphism in control, deep vein thrombosis and coronary artery disease patients

MTHFR polymorphism	Control (n=120), n (%)	DVT (n=120), n (%)	CAD (n=120), n (%)	Crude ORa (95% CI)	Crude ORb (95% CI)
MTHFR6C77T
C/C	104 (86.67)	91 (75.83)	88 (73.33)	1.0 (reference)	1.0 (reference)
C/T	15 (12.50)	25 (20.83)	29 (24.17)	1.90 (0.95-3.83)	2.28* (1.15-4.53)
T/T	1 (0.83)	4 (3.33)	3 (2.50)	4.57 (0.50-41.66)	3.54 (0.36-34.71)
CT + TT	16 (13.33)	29 (24.16)	32 (26.67)	2.07* (1.06-4.06)	2.36* (1.22-4.59)
Allele frequency
C	0.93	0.86	0.85
T	0.07	0.14	0.15
MTHFR A1298C
AA	49 (40.83)	55 (45.83)	58 (48.33)	1.0 (reference)	1.0 (reference)
AC	68 (56.67)	51 (42.50)	54 (45.00)	0.67 (0.39-1.13)	0.67 (0.40-1.13)
CC	3 (2.50)	14 (11.67)	8 (6.67)	4.16* (1.13-15.34)	2.25 (0.57-8.96)
AC + CC	71 (59.17)	65 (54.17)	62 (51.67)	0.81 (0.49-1.36)	0.74 (0.44-1.23)
Allele frequency
A	0.69	0.67	0.71
C	0.31	0.33	0.29

*P<0.05 as compared to reference genotype using Chi-square analysis, aOR=OR for DVT and, bOR=OR for CAD. OR=Odd ratio, CI=Confidence interval, DVT=Deep vein thrombosis, CAD=Coronary artery disease, MTHFR=Methylenetetrahydrafolate reductase

In case of A1298C polymorphism, no difference in the allelic or genotypic frequencies was seen among the cases and controls except in DVT patients for CC genotype in comparison to AA genotype.

Comparison of homocysteine levels with respect to genotype between controls and patients

As shown in Table 5, highest Hcy levels were observed in participants with TT genotype followed by CT genotype and CC genotype in all the three groups. A significant increase in Hcy levels was observed in mutant genotype (TT) in comparison to wild genotype (CC). Similar findings were also observed in all 3 groups across the A1298C genotype. However, the difference was not statistically significant.

Table 5

Comparison of homocysteine levels in control, deep vein thrombosis and coronary artery disease with respect to genotype

Genotype MTHFR	Hcy in control (µmol/dl)	Hcy in DVT patients (µmol/dl)	Hcy in CAD patients (µmol/dl)
C677T (n=360)
CC	12.43±4.75 (n=104)	14.66±7.76 (n=91)	14.2 (10.14-16.88) (n=88)
CT	18.66±5.96 (n=15)	26.57±21.16*** (n=25)	33.77$$$ (20.4-39.5) (n=29)
TT	24.7 (n=1)	44.69±12.01***,# (n=4)	46.2$$ (37.22-56.91) (n=3)
CT + TT	18.92±5.95@@@@ (n=16)	29.87±20.83@@@ (n=29)	35.7$$$$ (22.35-47.0) (n=32)
A1298C (n=360)
AA	13.22 (9.92-15.70)	13.3 (10.2-19.16)	13.23 (9.13-21.81)
AC	13.56 (10.08-18.23)	15.41 (8.48-19.92)	15.47 (11.07-18.480)
CC	14.87 (10.74-27.98)	18.49 (12.41-24.71)	18.1 (10.44-25.1)

Results are expressed as mean±SD for control and DVT and median (range) for CAD patients. @@@P<0.001, @@@@P<0.0001 as compared to CC genotype using unpaired t-test, ***P<0.001, #P<0.05 as compared to CC using ANOVA followed by Tukey post hoc test, $$P<0.01, $$$P<0.001, $$$$P<0.0001 as compared to CC genotype using Kruskal-Wallis followed by Dunn post hoc test. SD=Standard deviation, DVT=Deep vein thrombosis, CAD=Coronary artery disease, Hcy=Homocysteine, MTHFR=Methylenetetrahydrofolate reductase

Association of hyperhomocysteinemia among control, deep vein thrombosis, and coronary artery disease patients

Hyperhomocysteinemia is defined as Hcy levels above the normal range (>15 μmol/dl). As shown in Table 6, the OR was significantly different between controls and both arterial and venous thrombosis patients carrying mutant variant in comparison to the wild genotype. Highest OR = 21.67, 95% CI = 4.87–96.47, P < 0.0001 was observed in CAD patient carrying CT + TT variant of MTHFRC677T as compared to wild genotype. Similarly, the OR was significantly higher in patients carrying the AC + CC genotype of MTHFRA1298C and was maximum in DVT patient carrying (AC + CC) genotype as compared to AA genotype (OR: 2.28, 95%CI = 1.09–4.75, P < 0.05). However, the risk associated was higher in thrombotic patients with 6C77T mutation than the A1298C mutation.

Table 6

Association of hyperhomocysteinemia (≥15 µmol/dl) in controls and patients with thrombosis

MTHFR genotype	Crude OR (95% CI)
	Controls	DVT	CAD
C677T
CC (dominant model)	Reference (1.0)
CT	2.48 (0.8-7.73)	3.25* (1.27-8.31)	19.50**** (4.36-87.24)
TT	1.22 (0.05-31.06)	4.58 (0.46-45.83)	10.07 (0.5-201)
CT + TT	2.24 (0.73-6.83)	3.39** (1.39-8.2)	21.67**** (4.87-96.47)
A1298C
AA (dominant model)	Reference (1.0)
AC	1.49 (0.68-3.25)	1.97 (0.91-4.28)	2.04 (0.96-4.35)
CC	1.13 (0.09-13.49)	4.05* (1.12-14.57)	2.73 (0.59-12.55)
AC + CC	1.48 (0.68-3.19)	2.28* (1.09-4.75)	2.12* (1.02-4.40)

*P<0.05, **P<0.01, ****P<0.0001 using Chi-square analysis in comparison to dominant model. OR=Odds ratio, CI=Confidence interval, DVT=Deep vein thrombosis, CAD=Coronary artery disease, MTHFR=Methylenetetrahydrofolate reductase

Discussion

Prevalence studies at the population level help in exploring the frequency of mutant MTHFR genotype in patients with thrombosis in comparison to healthy individuals residing in Mumbai region for more than two generations. There exist marked ethnic variations among individuals residing in various geographical regions.

An elevated level of Hcy occurs due to alterations in MTHFR gene by which methionine is resynthesized to Hcy and thus impairs the folate metabolism. The two most clinically important mutations are C677T and A1298C which involves transition of C>T and A>C, respectively, leading to reduced enzyme activity. Thus, the study aimed to looked at the relationship between hyperhomocysteinemia and MTHFR polymorphism in healthy controls and in patients with venous and arterial thrombosis.

In present cross-sectional unmatched case–control study, 360 participants were enrolled in the study. Due to unmatched controls, the variations in sex and age were observed in cases as compared to controls. Significantly lower lipid levels were seen in CAD patients as compared to controls. This may be due to the statin therapy that majority of patients in our study were receiving which could account for the lower lipid levels.

The present study shows the prevalence of 677T allele frequency in healthy controls as 7% whereas a higher prevalence was seen in patients with both venous and arterial thrombosis with frequencies of 14% and 15%, respectively. Our observed frequency is in accordance to studies conducted in Tamilian,[14] Asia Indian, South Indian, Eastern Uttar Pradesh Indian, and South Indian populations[91011121315] wherein it ranged from 8% to 19%. Thus, the prevalence of 677T allele is lower in comparison to Caucasians and Asians[16] and whereas maximum frequency observed was among Mexican populations.[17] When data was analyzed with respect to the OR, the heterozygous mutant of MTHFR C667T genotype showed significant increased risk of CAD than DVT with OR: 2.28 for CAD and 1.90 for DVT as compared to control. Homozygous mutant TT also showed the highest risk with an OR of 4.57% and 3.54% in CAD and DVT patients, respectively, as compared to controls indicating the deleterious effect of T allele prevalence among the patients. Similar trend has been reported in literature too.[18]

With regard to A1298C polymorphism, the frequency of C allele in controls and both DVT and CAD patients was almost similar; however, a significant difference in CC genotype frequency was observed among patients when compared to healthy controls. Similar frequency has been reported among the various ethnic populations. The prevalence across the world wide ranges from 13% to 70%. The highest frequency of 1298C allele was seen in East Asia and lowest in America.[19] Our study showed the frequency of 31% in controls and 33% in DVT and 29% in CAD patients and is in accordance to studies carried among North Indians.[20]

Elevated levels of Hcy levels were observed in DVT and CAD patients as compared to controls. Similar findings have been reported by various authors indicating that hyperhomocysteinemia is associated with thrombosis.[21] However, it is still controversial whether Hcy itself causes damage or raised Hcy is a result of damage. A dose-dependent increase in Hcy levels was observed across both the genotypes in all the groups. Maximum levels were observed in TT genotype followed by CT in comparison to CC genotypes. Several authors also documented the increased susceptibility to hyperhomocysteinemia in participants with TT genotypes.[22232425] Our results are in accordance to the published literature.

Thus, hyperhomocysteinemia, especially that seen in individuals with C677T mutation, is multifactorial, involving genetic, nutritional, and environmental factors. Besides mutations involved in the metabolic pathway of folic acid; deficiency of Vitamins like B6 and B12 also contribute to this condition. Correction of these deficiencies by supplementation may help reduce Hcy levels by enhancing the function of the MTHFR enzyme thereby decreasing the risk for disorders associated with hyperhomocysteinemia.

Our study too has its limitations, the healthy controls selected in our study were not age and sex matched to both the subsets of cases under study as it was practically difficult to get healthy controls that matched both the subsets of cases. Also, the lipid profile was not estimated in case of DVT patients unlike the CAD patients and hence we could not determine whether this finding would impact our results.

Conclusions

The present study aimed to explore association between MTHFR C677T and A1298C genetic polymorphisms and Hcy levels in patients with DVT and CAD. Our study highlights the fact that MTHFR C677T polymorphism in comparison to A1298C allele significantly influences the Hcy concentration in patients with arterial and venous thrombosis. These findings need to be substantiated by carrying out longitudinal long-term studies. It would also be worthwhile to investigate Vitamin B12and folate levels as these cofactors may influence the findings.

Financial support and sponsorship

We are grateful to the Research Society of our hospital for providing financial support for the procurement of the homocysteine kits used in the study.

Conflicts of interest

There are no conflicts of interest.