Literature DB >> 31568500

Cytoneme-mediated signaling essential for tumorigenesis.

Sol Fereres1, Ryo Hatori1, Makiko Hatori1, Thomas B Kornberg1.   

Abstract

Communication between neoplastic cells and cells of their microenvironment is critical to cancer progression. To investigate the role of cytoneme-mediated signaling as a mechanism for distributing growth factor signaling proteins between tumor and tumor-associated cells, we analyzed EGFR and RET Drosophila tumor models and tested several genetic loss-of-function conditions that impair cytoneme-mediated signaling. Neuroglian, capricious, Irk2, SCAR, and diaphanous are genes that cytonemes require during normal development. Neuroglian and Capricious are cell adhesion proteins, Irk2 is a potassium channel, and SCAR and Diaphanous are actin-binding proteins, and the only process to which they are known to contribute jointly is cytoneme-mediated signaling. We observed that diminished function of any one of these genes suppressed tumor growth and increased organism survival. We also noted that EGFR-expressing tumor discs have abnormally extensive tracheation (respiratory tubes) and ectopically express Branchless (Bnl, a FGF) and FGFR. Bnl is a known inducer of tracheation that signals by a cytoneme-mediated process in other contexts, and we determined that exogenous over-expression of dominant negative FGFR suppressed tumor growth. Our results are consistent with the idea that cytonemes move signaling proteins between tumor and stromal cells and that cytoneme-mediated signaling is required for tumor growth and malignancy.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31568500      PMCID: PMC6786653          DOI: 10.1371/journal.pgen.1008415

Source DB:  PubMed          Journal:  PLoS Genet        ISSN: 1553-7390            Impact factor:   5.917


Introduction

Human tumors include transformed tumor cells, blood vessels, immune response cells, and stromal cells that together with the extracellular matrix (ECM) constitute a “tumor microenvironment” [1]. The tumor microenvironment is essential for oncogenesis, cell survival, tumor progression, invasion and metastasis [2,3], and its stromal cells produce key drivers of tumorigenesis. Known drivers are growth factors (e.g. HGF, FGF, EGF, IGF-1, TGF-β and Wnts), cytokines (e.g. IL-6, SDF-1) and pro-angiogenic factors (e.g. VEGF). It is not known if these proteins function as autocrine, juxtacrine, or paracrine signals, nor is it known how they might move into or within the tumor microenvironment. Studies of tumor models in Drosophila exploit the experimental attributes of the fly that provide uniquely powerful ways to investigate tumorigenesis [4]. We tested two models for the roles of cytonemes. Cytonemes are specialized, actin-based filopodia that extend between cells that produce and secrete signaling proteins and cells that receive them. The signaling proteins move along cytonemes and exchange at transient synapses that form where cytonemes contact target cells. These synapses are similar to neuronal synapses in constitution, structure and function [5-7], and are necessary for paracrine FGF/Bnl, BMP/Dpp, Hedgehog, Wnt/Wingless (Wnt/Wg), and Notch signaling during normal development of Drosophila epithelial tissues [5,7-9]. EGFR activating mutations are drivers of several types of human cancers [10]. However, elevated EGFR expression of wild type EGFR is not sufficient for tumorigenesis, and additional genetic changes are necessary, such as over-expression of Perlecan, a heparan sulfate proteoglycan (HSPG) component of the ECM [11]. In Drosophila, ectopic over-expression of Perlecan and EGFR in epithelial cells of the wing imaginal disc drives tumorigenesis [12]. Growth and metastasis of the epithelial cells require crosstalk with closely associated mesenchymal myoblasts, which also proliferate abnormally when Perlecan and EGFR are over-expressed in epithelial neighbors. The crosstalk includes BMP/Dpp signaling from the epithelial cells to the mesenchymal myoblasts [12]. The RET gene is the primary oncogenic driver for MEN2 (multiple endocrine neoplasia type 2) syndrome. MEN2 is characterized by several types of neoplastic transformations, including an aggressive thyroid cancer called medullary thyroid carcinoma (MTC). A fly model that overexpresses RETMEN2 phenocopies aspects of the aberrant signaling in MEN2-related tumors, such as activation of the SRC signal transduction pathway, which promotes migration and metastasis of tumorigenic cells. The relevance of the fly model has been established by screens for small molecule suppressors of Drosophila tumors driven by RETMEN2 over-expression. Several compounds that were identified are more effective than the drugs that are currently used for patients [13,14]. In the work presented here, we examined the role of cytoneme-mediated signaling in the EGFR-Pcn and RETMEN2 models. Genetic inhibition of cytonemes by downregulation of five genes that were shown previously to be essential in cytoneme-mediated signaling, reduced tumor growth, and we describe genetic conditions that suppress lethality by as much as 60% in the EGFR-Pcn tumor and by as much as 30% in the RETMEN2 tumor. Our results are consistent with the possibility that cytoneme-mediated signaling is necessary for tumor growth and that interfering with cytoneme-mediated tumor-stromal cell signaling might be a therapy for tumor suppression.

Results

Tumor cells and stromal cells extend cytonemes

Most of the wing imaginal disc is a columnar epithelium that will generate the wing and cuticle of the dorsal thorax of the adult fly. The disc also includes myoblasts that grow and spread over much of the dorsal basal surface of the columnar epithelium; these mesenchymal cells will generate the flight muscles of the adult. Tracheal branches (respiratory tubes) also adjoin the basal surface of the columnar epithelium, and one branch, the transverse connective, sprouts a bud (the air sac primordium (ASP), Fig 1A) that initiates growth during the third instar period. The ASP is dependent on Dpp and Bnl signaling proteins produced by the wing disc [7]. The myoblasts relay Wg and Notch signaling between the disc and ASP [9]. Cytonemes mediate and are essential for the Dpp, Bnl, Wg, and Notch signaling [15].
Fig 1

Cytonemes in EGFR-Pcni tumor and tumor-associated cells.

(A) Cartoon of a 3rd instar larval wing disc with wing blade primordia (wbp), disc-associated myoblasts (orange), trachea (white, outlined in blue) and air sac primordium (ASP), Dpp expressing cells (green stripe), Bnl expressing cells (blue circle). (B) Control wing disc expressing CD8:GFP in dorsal driven epithelial cells (ap-Gal4; green), and mCherry:CAAX in myoblasts ((15B03-lexA; red). (C) Schematic representation of tumor induction: animals developed for five days at 18°C with Gal4 repressed by Gal80, were transferred to 29°C to induce Gal4 and tumor growth for seven days (unless indicated otherwise). (D-F) Unfixed EGFR-Pcn tumor model wing discs. (D) Wing disc with tumor cells (CD8:GFP; green) and myoblasts (mCherry:CAAX; red). Genotype: ap-Gal4,UAS-psq/115B03-lexA,lexO-Cherry-CAAX;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bars: 100μm. (E) Cytonemes in the tumor epithelial cells (green, arrows); genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. (F-F’) Cytonemes in myoblasts (red, arrows) extend towards epithelial cells (green); genotype: ap-Gal4,UAS-psq/115B03-lexA,lexO-Cherry-CAAX;UAS-EGFR,tub-Gal80/UAS-CD8:GFP; scale bars: 50μm. (G-H) Unfixed wing discs with marked tracheal cells (green, arrows); (G) control, genotype: btl-LHG,lexO-CD2-GFP; (H) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/btl-LHG,lexO-CD2-GFP;UAS-EGFR,tub-Gal80/+. Excessive tracheal growth and ectopic branches indicated by arrows; scale bars: 100μm.

Cytonemes in EGFR-Pcni tumor and tumor-associated cells.

(A) Cartoon of a 3rd instar larval wing disc with wing blade primordia (wbp), disc-associated myoblasts (orange), trachea (white, outlined in blue) and air sac primordium (ASP), Dpp expressing cells (green stripe), Bnl expressing cells (blue circle). (B) Control wing disc expressing CD8:GFP in dorsal driven epithelial cells (ap-Gal4; green), and mCherry:CAAX in myoblasts ((15B03-lexA; red). (C) Schematic representation of tumor induction: animals developed for five days at 18°C with Gal4 repressed by Gal80, were transferred to 29°C to induce Gal4 and tumor growth for seven days (unless indicated otherwise). (D-F) Unfixed EGFR-Pcn tumor model wing discs. (D) Wing disc with tumor cells (CD8:GFP; green) and myoblasts (mCherry:CAAX; red). Genotype: ap-Gal4,UAS-psq/115B03-lexA,lexO-Cherry-CAAX;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bars: 100μm. (E) Cytonemes in the tumor epithelial cells (green, arrows); genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. (F-F’) Cytonemes in myoblasts (red, arrows) extend towards epithelial cells (green); genotype: ap-Gal4,UAS-psq/115B03-lexA,lexO-Cherry-CAAX;UAS-EGFR,tub-Gal80/UAS-CD8:GFP; scale bars: 50μm. (G-H) Unfixed wing discs with marked tracheal cells (green, arrows); (G) control, genotype: btl-LHG,lexO-CD2-GFP; (H) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/btl-LHG,lexO-CD2-GFP;UAS-EGFR,tub-Gal80/+. Excessive tracheal growth and ectopic branches indicated by arrows; scale bars: 100μm. To investigate whether cytonemes are also essential in tumorigenesis, we tested a cancer model that requires tumor-stroma interactions in which neoplastic transformation is driven by interactions between the wing disc epithelial cells and myoblasts [12]. Overexpression of wild type EGFR and Perlecan (pcn, a secreted heparan sulfate proteoglycan) in the columnar epithelium drives proliferation of the genetically modified epithelial cells, as well as their genetically wild type myoblast neighbors. Tumorigenesis depends on Dpp signaling from the epithelial cells to the myoblasts. We first investigated if cytonemes are present in EGFR-Pcn overexpressing tumor cells. We induced the EGFR-Pcn tumor model (with ap-Gal4, an epithelial cell-specific driver) together with CD8:GFP, a membrane-tethered GFP protein (Fig 1C and 1D), and independently expressed membrane-tethered mCherry in the myoblasts (with 1151-lexA, lexO-mCherry-CAAX; a myoblast-specific driver). In this system, the epithelial cell membranes are marked with GFP fluorescence and the myoblast membranes are marked with mCherry fluorescence. We observed that, as previously reported [12], the EGFR-Pcn tumor induces overgrowth and proliferation, producing multilayered masses of disorganized disc epithelial cells and myoblasts ([12], Fig 1D). Higher magnification imaging detected both epithelial cell cytonemes and myoblast cytonemes. Some of the cytonemes appear to extend between the tumor and mesenchymal populations (Fig 1E–1F’). These results show that tumor cells and tumor-associated cells extend cytoneme-like structures and are consistent with the possibility that cytonemes may facilitate signaling between these cell populations. To monitor the tracheal branches that are associated with the tumorous discs, we induced the EGFR-Pcn tumor and labelled the trachea with membrane tethered GFP (with LHG lexO-CD2:GFP, a tracheal-specific driver [16]). In the EGFR-Pcn tumor discs, the associated trachea were more extensive and branched than normal (Fig 1G and 1H). Their overgrowth was presumably a response to the disc tumor.

Dpp localizes to tumor epithelial cell cytonemes

In normal development, Dpp produced by wing disc cells at the anterior/posterior compartment border is transported by cytonemes to target cells in both the wing disc and ASP, and cytoneme deficits caused by Capricious (Caps), Neuroglian (Nrg), or Diaphanous (Dia) loss-of-function lead to developmental defects [7]. In the EGFR-Pcn tumor model, Dpp signals from the genetically altered epithelial cells to drive myoblast expansion [12]. Dpp expression is upregulated in the epithelial cells (Fig 2A and 2A’) and pMAD, the phosphorylated form of the Dpp signal transducer MAD, is enriched in the myoblasts (Fig 2A” and 2A’”). This indication of Dpp signal transduction in the myoblasts is consistent with previous results showing that Dpp signaling in this stromal compartment is required for tumor growth [12].
Fig 2

Dpp signaling in the EGFR-Pcn tumor model.

(A,A’,B) Unfixed wing discs showing the Dpp distribution. (A) Control disc with Dpp (red, arrow). Genotype: Dpp:mCherry. Scale bar: 100μm. (A’) Disc with EGFR-Pcn tumor induced for 5 days expressing Dpp (red) in tumor cells. Genotype: ap-Gal4,UAS-psq/Dpp:mCherry;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Arrows indicate Dpp up-regulation. (A”-A”’) EGFR-Pcn wing showing epithelial tumor cells (green) fixed and stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling and α-Cut (blue) to label myoblasts. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bar: 100μm. (A”’) Higher magnification image of the box area in (A”), scale bar: 50μm. (B-B”) Cytoneme (green) extending from epithelial tumor cell (green) with Dpp:mCherry (red); arrow indicates Dpp:mCherry in cytoneme. Genotype: ap-Gal4,UAS-psq/Dpp:mCherry;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bar: 50μm.

Dpp signaling in the EGFR-Pcn tumor model.

(A,A’,B) Unfixed wing discs showing the Dpp distribution. (A) Control disc with Dpp (red, arrow). Genotype: Dpp:mCherry. Scale bar: 100μm. (A’) Disc with EGFR-Pcn tumor induced for 5 days expressing Dpp (red) in tumor cells. Genotype: ap-Gal4,UAS-psq/Dpp:mCherry;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Arrows indicate Dpp up-regulation. (A”-A”’) EGFR-Pcn wing showing epithelial tumor cells (green) fixed and stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling and α-Cut (blue) to label myoblasts. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bar: 100μm. (A”’) Higher magnification image of the box area in (A”), scale bar: 50μm. (B-B”) Cytoneme (green) extending from epithelial tumor cell (green) with Dpp:mCherry (red); arrow indicates Dpp:mCherry in cytoneme. Genotype: ap-Gal4,UAS-psq/Dpp:mCherry;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. Scale bar: 50μm. To investigate how Dpp moves in the EGFR-Pcn model, we used CRISPR mutagenesis to tag the endogenous Dpp protein with mCherry. mCherry was inserted at codon 465 as described in [17]. Homozygous Dpp:mCherry flies that lack a wild type dpp gene are viable and develop as wild type, indicating that the Dpp:mCherry chimera has normal function. We induced the EGFR-Pcn tumor in Dpp:mCherry flies, and labeled the EGFR-Pcn tumor cells with CD8:GFP. Dpp:mCherry fluorescence was present in the cytonemes of the epithelial tumor cells (Fig 2B, 2B’ and 2B”), consistent with the possibility that Dpp signaling is mediated by cytonemes in the EGFR-Pcn tumor model.

Genetic suppression of tumor phenotypes

To assess the role of cytonemes in tumorigenesis, we examined discs in which cytonemes are impaired. Downregulation of Nrg, Caps, SCAR, or dia decreases the number and length of cytonemes, and decreases signaling in tracheal cells, myoblasts and wing disc cells [7,9,18]. Nrg and Caps are cell adhesion proteins and SCAR and Dia are actin-binding proteins. Although severe loss-of-function conditions for Nrg, caps, SCAR or dia are lethal, the partial loss-of-function conditions we used and previously characterized do not perturb cell polarity, cell viability, or cell cycle during normal development [7,9,19,20]. Previous studies of the wing disc and associated tracheal cells and myoblasts identified cytonemes that either “send” signaling proteins from producing cells or “receive” signaling proteins from target cells, and reported cytonemes that link disc cells to each other or to tracheal cells or myoblasts [9,18,20-22]. Available genetic tools can be used to impair cytoneme function but they do not distinguish among these types of cytonemes. For the tumor discs with diminished Nrg, Caps, SCAR, or Dia, we compared disc morphology, Dpp signaling (monitored by anti-pMad antibody staining), and myoblast distribution (monitored by anti-Cut antibody staining, a marker of myoblasts [23]) in three types of wing discs: control non-tumor discs, EGFR-Pcn tumor discs and EGFR-Pcn tumor discs that also expressed CapsDN or RNAi constructs targeting Nrg, Dia, or SCAR. These genotypes were generated from two crosses. In the first, EGFR-Pcn tumor discs were generated from a cross between ap-Gal4,UAS-psq/CyO;UAS-EGFR,tub-Gal80 and UAS-CD8:GFP that produces equal numbers of animals with the tumor genotype and non-tumor controls that have the CyO balancer and lack ap-Gal4,UAS-psq. The animals were incubated to the 2nd instar stage at low temperature (18°C) to permit repression of the transgenes by Gal80ts and were incubated at non-permissive temperature (29°C) thereafter (Fig 1C). The CyO control animals develop to late 3rd instar within one day and eclose in approximately four days as curly wing adults. All remaining animals developed tumors and were developmentally-delayed, and were analyzed after seven days of culture at 29°C. The second cross mated ap-Gal4,UAS-psq/CyO;UAS-EGFR,tub-Gal80 to flies with the respective “tester chromosome” carrying UAS-Caps or UAS-RNAi, and were incubated with the same regimen involving removal of CyO balancer adults. The remaining larvae had tumor phenotypes to varied degrees. Tumor discs were misshapen and approximately 6.3 times larger than control discs, their number of Cut-expressing cells increased by four times, and their anti-pMad staining was not patterned normally (Fig 3A and 3B). In contrast, discs with tumor cells that expressed NrgRNAi in addition to EGFR and Pcn were morphologically less distorted, only 1.8 times larger than controls, and the number and distribution of Cut-expressing cells was close to normal (Fig 3C and 3C’). In these animals, expression of EGFR, Pcn, and NrgRNAi is driven by ap-Gal4 continuously after the second instar, but the noxious effects of NrgRNAi suppress the tumor phenotype induced by EGFR and Pcn overexpression and are tolerated by the disc cells in which NrgRNAi is expressed. The implication is that tumor cells are more sensitive to the consequences of Nrg downregulation than are normal cells. Hyper-sensitivity to sub-lethal levels of toxic conditions is a common hallmark of tumor cells.
Fig 3

Conditions that ablate cytonemes decrease signaling, reduce myoblast and tumor growth.

(A-I) Fixed wing discs stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling and α-Cut (cyan) to label myoblasts. Scale bars: 100μm. (A,A’) Control. (B,B’) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. (C,C’) Tumor + NrgRNAi, genotype: ap-Gal4,UAS-psq/UAS-Nrg;UAS-EGFR,tub-Gal80/+. (D) Tumor + CapsDN, genotype:ap-Gal4,UAS-psq/UAS-CAPS;UAS-EGFR,tub-Gal80/+. (E) Tumor + SCARRNAi, genotype:ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-SCAR. (F,F’) EGFR-Pcn + diaRNAi in epithelial cells. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-dia. (G) Tumor + NrgRNAi, diaRNAi, genotype: ap-Gal4,UAS-psq/UAS-Nrg;UAS-EGFR,tub-Gal80/UAS-dia. (I-I’) EGFR-Pcn + diaRNAi expressed in the myoblasts. Genotype: ap-Gal4,UAS-psq/115B03-lexA;UAS-EGFR,tub-Gal80/ lexO-dia. (H) Quantification of the total wing disc area (blue) and relative area of Cut-expressing cells (orange) of control, EGFR+Pcn tumor, tumor + diaRNAi expressed in epithelial cells, diaRNAi expressed in myoblasts, NrgRNAi, SCARRNAi, CapsDN, NrgRNAi+diaRNAi, dsRNAi, ftRNAi, fjRNAi and BtlDN larvae. Data was normalized to control. Student’s t test P values (P >1.10−9 for all except no significant difference for tumor + dsRNAi, ftRNAi and fjRNAi); n = 15–20 discs for each genotype. (J-J”) Sagittal sections of fixed wing discs stained with α-Dlg antibody (red) to mark the cell’s apical compartments, Scale bar: 50μm. (J) Control. (J’) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/UAS-CD8:GFP;UAS-EGFR,tub-Gal80/+) (J”) EGFR-Pcn + diaRNAi expressed in epithelial cells, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-dia.

Conditions that ablate cytonemes decrease signaling, reduce myoblast and tumor growth.

(A-I) Fixed wing discs stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling and α-Cut (cyan) to label myoblasts. Scale bars: 100μm. (A,A’) Control. (B,B’) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-CD8:GFP. (C,C’) Tumor + NrgRNAi, genotype: ap-Gal4,UAS-psq/UAS-Nrg;UAS-EGFR,tub-Gal80/+. (D) Tumor + CapsDN, genotype:ap-Gal4,UAS-psq/UAS-CAPS;UAS-EGFR,tub-Gal80/+. (E) Tumor + SCARRNAi, genotype:ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-SCAR. (F,F’) EGFR-Pcn + diaRNAi in epithelial cells. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-dia. (G) Tumor + NrgRNAi, diaRNAi, genotype: ap-Gal4,UAS-psq/UAS-Nrg;UAS-EGFR,tub-Gal80/UAS-dia. (I-I’) EGFR-Pcn + diaRNAi expressed in the myoblasts. Genotype: ap-Gal4,UAS-psq/115B03-lexA;UAS-EGFR,tub-Gal80/ lexO-dia. (H) Quantification of the total wing disc area (blue) and relative area of Cut-expressing cells (orange) of control, EGFR+Pcn tumor, tumor + diaRNAi expressed in epithelial cells, diaRNAi expressed in myoblasts, NrgRNAi, SCARRNAi, CapsDN, NrgRNAi+diaRNAi, dsRNAi, ftRNAi, fjRNAi and BtlDN larvae. Data was normalized to control. Student’s t test P values (P >1.10−9 for all except no significant difference for tumor + dsRNAi, ftRNAi and fjRNAi); n = 15–20 discs for each genotype. (J-J”) Sagittal sections of fixed wing discs stained with α-Dlg antibody (red) to mark the cell’s apical compartments, Scale bar: 50μm. (J) Control. (J’) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/UAS-CD8:GFP;UAS-EGFR,tub-Gal80/+) (J”) EGFR-Pcn + diaRNAi expressed in epithelial cells, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-dia. Expression of CAPSDN, SCARRNAi, or diaRNAi in the epithelial cells of the EGFR-Pcn model also reduced tumor growth, pMAD expression and number of Cut-expressing cells (Fig 3D–3F’). Expression of diaRNAi also suppressed excessive tracheation in the tumor discs (Fig 3S). To test whether the suppressive, ameliorative effects might be additive, we expressed NrgRNAi and diaRNAi simultaneously in EGFR-Pcn tumor cells. We did not observe that the degree of tumor suppression changed relative to expression of either NrgRNAi or diaRNAi alone (Fig 3G). We also tested the roles of three genes that are essential for planar cell polarity [24]: the dachsous (ds) and fat (ft) genes that encode cadherin family proteins, and four-jointed (fj) that encodes a transmembrane kinase. Expression of dsRNAi, ftRNAi or fjRNAi does not perturb cytoneme-mediated signaling between wing disc and tracheal cells [19], and expression of these RNAi lines in the tumor cells had no apparent effect on tumorigenesis (S2 Fig). Fig 3H summarizes the growth suppression we observed in the genetic conditions we tested. The presence of cytonemes in both the tumor columnar epithelial and mesenchymal myoblast cells, and the essential role of the myoblasts for tumor progression raises the possibility that myoblast cytonemes might also play an essential role in tumorigenesis. To investigate the role of myoblast cytonemes, we expressed diaRNAi (with 1151-lexA lexO-diaRNAi) in the myoblasts of discs that overexpress EGFR and Pcn in the columnar epithelial cells. The morphology, Dpp signaling pattern and myoblast growth characteristic of the EGFR-Pcn tumors were suppressed (Fig 3I and 3I’). This result is consistent with the idea that the myoblasts signal to the epithelial tumor cells [12], and that this signaling is mediated by cytonemes. We also analyzed the apical-basal organization of the disc cells by monitoring the distribution of Discs large (Dlg), which associates with the septate junction and localizes to the apical compartment of the columnar epithelial cells. Sagittal optical sections of discs stained with anti-Dlg antibody revealed that the specific apical distribution of Dlg characteristic of wild type cells is disorganized in EGFR-Pcn tumor discs (Fig 3J and 3J’). Expression of diaRNAi in the tumor cells restored the Dlg distribution to normal (Fig 3J”). This demonstrates that expression of diaRNAi suppresses a critical feature of tumor cells and that downregulation of Dia is compatible with normal cellular morphology and behavior. Although EGFR and Pcn expression in the EGFR-Pcn model (driven by ap-Gal4) is restricted to the dorsal compartment of the wing disc, the tumors grow extensively and metastasize (Fig 4A). The tumorous condition is 100% lethal; animals with these tumors do not mature beyond the larval stage [12]. However, the conditions of Nrg, Caps, SCAR, or dia downregulation that suppress tumor growth also suppressed lethality: the number of EGFR-Pcn tumor-bearing larvae that pupated and that reached the pharate adult stage increased, and for the animals that expressed diaRNAi, approximately 60% survived to adult stage (Fig 4B). These surviving adults were fertile, and wing blade morphological defects were the only visible phenotype (Fig 4C and 4D). Given that cytoneme-mediated signaling is reduced by downregulation of Nrg, Caps, SCAR, or Dia, these results are consistent with the possibility that cytoneme-mediated signaling is necessary for tumor growth and that interfering with signaling either between tumor cells or between tumor and stromal cells suppresses many if not all aspects of tumorigenesis.
Fig 4

Conditions that ablate cytonemes promote survival.

(A) Cartoon of a wild type larva depicting cells expressing GFP in the imaginal disc dorsal compartments (ap-Gal4; green, arrow) and of EGFR-Pcn tumor larva with overgrowth and metastasis throughout the larva (green). (B) Survival of EGFR-Pcn tumor, tumor + diaRNAi, NrgRNAi, SCARRNAi and CapsDN larvae to pupal (blue), pharate adult (orange) and adult stage (gray). Student’s t test P values: (between P<0.05 and P >1.10−8) with n = 15–30 larvae for each genotype. (C) Control adult wing. (D) EGFR-Pcn + diaRNAi wing, genotype: ap-Gal4,UAS-psq/UAS-CD8:GFP;UAS-EGFR,tub-Gal80/UAS-dia.

Conditions that ablate cytonemes promote survival.

(A) Cartoon of a wild type larva depicting cells expressing GFP in the imaginal disc dorsal compartments (ap-Gal4; green, arrow) and of EGFR-Pcn tumor larva with overgrowth and metastasis throughout the larva (green). (B) Survival of EGFR-Pcn tumor, tumor + diaRNAi, NrgRNAi, SCARRNAi and CapsDN larvae to pupal (blue), pharate adult (orange) and adult stage (gray). Student’s t test P values: (between P<0.05 and P >1.10−8) with n = 15–30 larvae for each genotype. (C) Control adult wing. (D) EGFR-Pcn + diaRNAi wing, genotype: ap-Gal4,UAS-psq/UAS-CD8:GFP;UAS-EGFR,tub-Gal80/UAS-dia.

Bnl signaling in the EGFR-Pcn model

The disc-associated ASP branch of the tracheal system is dependent on and sensitive to signals produced by the disc [25,26], and Bnl signaling from the disc to the ASP is cytoneme-mediated and cytoneme-dependent [7,21]. Because tracheal branches grow excessively in the EGFR-Pcn tumor model (Fig 1H), we investigated if Bnl signaling is upregulated in tumor discs. Bnl is normally produced by a small, discrete group of disc cells (Fig 1A). Disc cells do not express Btl, but tracheal cells express Btl and not Bnl [26]. To monitor Bnl signaling in the EGFR-Pcn tumor model, we examined a Bnl reporter that expresses mCherry:CAAX in Bnl-expressing cells [27]. The number and location of Bnl-expressing cells increased in tumor discs (Fig 5A and 5B). We also examined fluorescence of Btl:mCherry (with a CRISPR-generated knock-in [21]). Whereas Btl:mCherry fluorescence was not detected in the epithelial cells of normal wing discs (Fig 5C and 5C’), Btl:mCherry fluorescence was present in many epithelial cells of the tumor (Fig 5D and 5D’). These results are consistent with the possibility that the tumor induces ectopic expression of Btl and that ectopic activation of the Bnl signaling pathway might correlate with excessive growth of the tracheal branches in this tumor.
Fig 5

FGF signaling in the EGFR-Pcn tumor model.

(A-B) Unfixed wing discs with Bnl-expressing cells marked with Cherry-CAAX (red, arrows). (A) Control, genotype: bnl-lexA,lexO-mCherry:CAAX/+. Scale bar: 100μm. (B) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/bnl-lexA,lexO-mCherry:CAAX. Arrows indicate FGF up-regulation (red). (C-D’) Unfixed wing discs with Btl distribution marked by Btl:mCherry (red, arrows). (C) Control, genotype: Btl:mCherry/+. Btl is only expressed in the tracheal cells. Scale bar: 100μm (C’) Higher magnification image of the boxed area in (C). (D) 5 day EGFR-Pcn tumor disc, genotype: ap-Gal4,UAS-psq/UAS-CD4-mIFP;UAS-EGFR,tub-Gal80/Btl:mCherry. Btl expression is upregulated in the tumor cells. (D’) Higher magnification image of the box area in (D). Scale bars: 50μm. (E-F) EGFR-Pcn tumor +BtlDN fixed wing disc stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling (E) and α-Cut (cyan) to label myoblasts (F). Scale bar: 100μm. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl. (G) EGFR mRNA measured by quantitative real-time PCR. RNA was extracted from 5 discs of the indicated genotypes. Data were normalized to rp49. The data show mean ± SD from three technical replicates of a representative experiment. Significance was analyzed using Student’s t-test (p<0.001). Comparable results were obtained in 3 independent biological replicates. Genotypes are ap-Gal4,UAS-CD8:GFP (WT), ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/ UAS-CD8:GFP (tumor) and ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl. (H-K) Fixed wing disc stained with α-phosphorylated ERK to monitor EGF signaling (dpERK, red). (H) Control, genotype: ap-Gal4,UAS-CD8:GFP. (I) Control+BtlDN, genotype: ap-Gal4/+;UAS-Btl/+. (I) EGFR-Pcn tumor disc, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/ UAS-CD8:GFP. EGFR-Pcn tumor + BtlDN, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl.

FGF signaling in the EGFR-Pcn tumor model.

(A-B) Unfixed wing discs with Bnl-expressing cells marked with Cherry-CAAX (red, arrows). (A) Control, genotype: bnl-lexA,lexO-mCherry:CAAX/+. Scale bar: 100μm. (B) EGFR-Pcn tumor, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/bnl-lexA,lexO-mCherry:CAAX. Arrows indicate FGF up-regulation (red). (C-D’) Unfixed wing discs with Btl distribution marked by Btl:mCherry (red, arrows). (C) Control, genotype: Btl:mCherry/+. Btl is only expressed in the tracheal cells. Scale bar: 100μm (C’) Higher magnification image of the boxed area in (C). (D) 5 day EGFR-Pcn tumor disc, genotype: ap-Gal4,UAS-psq/UAS-CD4-mIFP;UAS-EGFR,tub-Gal80/Btl:mCherry. Btl expression is upregulated in the tumor cells. (D’) Higher magnification image of the box area in (D). Scale bars: 50μm. (E-F) EGFR-Pcn tumor +BtlDN fixed wing disc stained with α-phosphorylated MAD (pMad, red) antibody to monitor Dpp signaling (E) and α-Cut (cyan) to label myoblasts (F). Scale bar: 100μm. Genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl. (G) EGFR mRNA measured by quantitative real-time PCR. RNA was extracted from 5 discs of the indicated genotypes. Data were normalized to rp49. The data show mean ± SD from three technical replicates of a representative experiment. Significance was analyzed using Student’s t-test (p<0.001). Comparable results were obtained in 3 independent biological replicates. Genotypes are ap-Gal4,UAS-CD8:GFP (WT), ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/ UAS-CD8:GFP (tumor) and ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl. (H-K) Fixed wing disc stained with α-phosphorylated ERK to monitor EGF signaling (dpERK, red). (H) Control, genotype: ap-Gal4,UAS-CD8:GFP. (I) Control+BtlDN, genotype: ap-Gal4/+;UAS-Btl/+. (I) EGFR-Pcn tumor disc, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/ UAS-CD8:GFP. EGFR-Pcn tumor + BtlDN, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-Btl. To investigate the role of Bnl signaling in EGFR-Pcn tumorigenesis, we overexpressed a dominant negative FGFR mutant in the tumor cells to block Bnl signaling (UAS-Btl). We monitored wing discs for morphology, Cut expression, and pMAD in EGFR-Pcn tumor discs, and EGFR-Pcn tumor discs that also express BtlDN. Experimental crosses were carried out with the regimen described previously and produced either tumor larvae or suppressed tumor larvae; both crosses generate control (CyO balancer) and tumor-containing animals in a Mendelian ratio of 1:1. In the cross with UAS-Btl, 50.6% (76/151) of the larvae pupated and eclosed within 4 days as curly wing adults. The presence of the balancer chromosome indicates that the genotype of these flies lacked ap-Gal4, as expected of control, non-tumor animals. The remaining larvae do not develop beyond the pupal stage, consistent with their having the tumor genotype. Larvae analyzed after 7 days of Gal4 expression at the non-permissive were compared to tumor discs of the same age (Fig 1C). In the EGFR-Pcn tumor discs that also express BtlDN, characteristics of tumor morphology, size, pattern of Dpp signaling, and distribution of myoblasts were suppressed (Fig 5E and 5F). To confirm the identity genotype of the suppressed tumor discs, RNA isolated from wild type, EGFR-Pcn tumor, and BtlDN-expressing tumor discs was quantified by QPCR. This analysis confirmed the overexpression of EGFR in both tumor and suppressed tumor discs (Fig 5G). We also examined EGF and Bnl signal transduction in tumor and suppressed tumor discs by staining with anti-dpERK antibody. The presence of dpERK was observed in control, tumor, and BtlDN -over-expressing control and tumor discs, and whereas the pattern of dpERK in the tumor discs was expanded and disordered in the tumor discs, the patterns and levels in the suppressed discs was close to normal (Fig 5H–5K). These findings are consistent with the idea that tracheogenesis is necessary for tumor growth and with a previous report that describes comparable findings in studies of a lethal giant larvae Drosophila tumor model [28]. In this tumor, ectopic tracheal sprouting is associated with hypoxic responses and tracheal differential of wing disc tumor cells, a process that may be analogous to “sprouting angiogenesis” and vascular co-option in mammalian tumors [29].

Cytonemes in a RET-MEN2 tumor model

We investigated the role of cytonemes in the Drosophila RET-MEN2 tumor model developed by the Cagan lab [14]. This model mimics the mis-regulation of signaling pathways that have been implicated in MEN2-related tumors. Overexpression of RETMEN2 in a discrete set of wing disc epithelial cells (with ptc-Gal4) resulted in a >4X increase in the number of ptc-expressing cells and a 7X increase in the portion of the disc that consists of ptc-expressing cells (Fig 6A and 6B) [14]. Approximately one-half of the animals survive to the pupal stage, but none survive to adult. We tested whether expression of Irk2DN (an inwardly-rectifying potassium channel required for cyteneme-mediated signaling [5]), diaRNAi, or SCARRNAi in the RET-mutant cells affects tumor growth and survival. We observed that excessive growth of the ptc-expressing cells was suppressed by more than 2X in all three genotypes (Fig 6C–6F). Approximately two-thirds of the animals developed to the pupal stage, and survival to adult also increased (Fig 6G). These flies have normal morphology, and with the exception of small wing vein abnormalities, the wings are indistinguishable from wild type (Fig 6H). These results are consistent with a general role for cytonemes in tumorigenesis and tumor progression.
Fig 6

RET-MEN2 tumor growth and survival depends on cytonemes.

(A-B’) Unfixed wing discs expressing CD8:GFP (green) driven by ptc-Gal4. Scale bar: 100μm. (A) Control. (A’) Cytonemes in wild type cells (green, arrows). Scale bar: 50μm. (B) RET tumor, genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-CD8:GFP. (B’) Cytonemes in RET tumor cells (green, arrows). (C-E) Unfixed wing discs expressing CD8:GFP (green) and either RET + diaRNAi (C); RET + SCARRNAi (D); and RET + Irk2DN (E). (C) Genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-dia. (D) Genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-SCAR. (E) Genotype: ptc-Gal4,CD8:GFP/Irk2 ;UAS-RET. (F) Quantification of the area of the disc expressing GFP (% of disc) in control, RET tumor, or RET and either diaRNAi, SCARRNAi or Irk2DN. Significance was analyzed using Student’s t-test (P<1.10−5) with 15–18 discs. (G) Survival of RET-tumor and RET and either diaRNAi, SCARRNAi or Irk2DN to pupa (blue) and adult (orange). Significance using Student’s t-test for adults is (P<0.001), n = 30–40 for each genotype. (H) RET tumor, diaRNAi wing blade; genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-dia. Arrow points to abnormal crossvein.

RET-MEN2 tumor growth and survival depends on cytonemes.

(A-B’) Unfixed wing discs expressing CD8:GFP (green) driven by ptc-Gal4. Scale bar: 100μm. (A) Control. (A’) Cytonemes in wild type cells (green, arrows). Scale bar: 50μm. (B) RET tumor, genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-CD8:GFP. (B’) Cytonemes in RET tumor cells (green, arrows). (C-E) Unfixed wing discs expressing CD8:GFP (green) and either RET + diaRNAi (C); RET + SCARRNAi (D); and RET + Irk2DN (E). (C) Genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-dia. (D) Genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-SCAR. (E) Genotype: ptc-Gal4,CD8:GFP/Irk2 ;UAS-RET. (F) Quantification of the area of the disc expressing GFP (% of disc) in control, RET tumor, or RET and either diaRNAi, SCARRNAi or Irk2DN. Significance was analyzed using Student’s t-test (P<1.10−5) with 15–18 discs. (G) Survival of RET-tumor and RET and either diaRNAi, SCARRNAi or Irk2DN to pupa (blue) and adult (orange). Significance using Student’s t-test for adults is (P<0.001), n = 30–40 for each genotype. (H) RET tumor, diaRNAi wing blade; genotype: ptc-Gal4,CD8:GFP;UAS-RET/UAS-dia. Arrow points to abnormal crossvein.

Discussion

The tumor microenvironment is a niche that responds to signaling proteins produced by tumor cells and supplies growth factors that support tumor growth and metastasis [30]. Much ongoing work seeks inhibitors of tumorigenesis that target the signaling molecules and growth factors, their signal transduction pathways, and the stromal cells of the microenvironment [31,32]. Two previous studies reported cellular extensions of human tumor cells in ex vivo co-cultures with non-metastatic cells and in vivo, and have been implicated these structures in material transfer between tumor and non-tumor cells [33,34]. In this work, we also investigated the mechanism that transfers signaling molecules and growth factors between tumor cells and stromal cells in vivo, and report the first evidence for their essential role in tumorigenesis. Previous work established that during Drosophila development, paracrine signaling by the signaling proteins/growth factors Dpp, Bnl, Wg, Notch and Hedgehog, is mediated by cytonemes [35-37]. Cytonemes are specialized filopodia that extend between signal producing and signal receiving cells, making synaptic contacts where the signaling proteins transfer from producing to receiving cells. To extend this work to tumorigenesis, we applied the strategies and tools we developed for previous studies to ask if cytonemes are present in the tumor microenvironment, and if genetic conditions that inhibit cytoneme function and cytoneme-dependent signaling in normal development also inhibit tumorigenesis. In a EFGR-Pcn tumor model, we found that cytonemes extend from both Drosophila tumor and stromal cells (Fig 1). This is consistent with previous studies that reported increased signaling between tumor and stromal cells in this model [12], and with the presence of cytonemes in many other contexts of paracrine signaling [7,18,20,38-41]. We confirmed that Dpp is expressed by the tumor cells (Fig 2; [12]), and found that ectopic Bnl signaling also has an essential role in this tumor (Fig 5). These results imply functional connections between the EGF, Dpp, and Bnl signaling pathways in this tumor, and although we did not identify regulatory interactions between the pathways, our results show that ectopic activation of the Bnl pathway is essential to tumorigenesis. We also found conditions that impair cytonemes and rescue flies of lethal tumors in both EGFR-Pcn and RET models. We selected five genes from among the more than twenty that are known to be essential for cytoneme-mediated signaling [5,7,18,19]. nrg, caps, Irk2, SCAR, and dia are recessive lethal genes whose functions can be partially reduced in genetic mosaics without affecting viability, cell shape, or the cell cycle, but are necessary for cytoneme function. Downregulating any one of these genes improved viability in the tumor models. dia downregulation is the most effective inhibitor of cytoneme-mediated signaling in other contexts [7,19,20], and it is the most effective in both tumor models. The cures that downregulation effected suggest that cytoneme-mediated signaling, which might be a general mechanism for tumorigenesis in a variety of cancers, might also be a potential target for therapy. The high degree of evolutionary conservation of Drosophila and human proteins makes Drosophila a clinically relevant platform for understanding mechanisms human disease, and Drosophila tumor models have successfully identified new therapeutic candidates for colorectal, lung and thyroid and stem-cells derived cancers [42-44]. Our work provides proof principle for tumor suppression by interfering with cytoneme-mediated signaling.

Materials and methods

Drosophila stocks and husbandry

Flies were reared on standard cornmeal and agar medium at 29°C, unless otherwise stated. ap-Gal4 UAS-psqRNAi/CyO; UAS-EGFR tub-Gal80ts from S. Cohen [12], UAS-RETMEN2 from R. Cagan [14], Btl:mCherry and Bnl-lexA, from S. Roy [21,27], lexO-diaRNAi from H. Huang, UAS-CapsDN [45] (deletion mutant lacking the intracellular domain), UAS-BtlDN from B. Shilo [46] (dominant negative construct lacking a functional cytoplasmic tyrosine-kinase domain), Irk2DN from E. Bates [47] (a subunit predicted to block the channel). btl-LHG,lexO-CD2:GFP, a tracheal-specific driver [16]; ptc-Gal4 enhancer is an enhancer trap line that mimics ptc expression [48], lexO-mCherry:CAAX from K. Basler; lines from Bloomington Stock Center: 15B03-lexA (#52486), UAS-CD8:GFP (#5137), UAS-diaRNAi (#28541 and #35479), UAS-NrgRNAi (#37496), UAS-dsRNAi (#32964), UAS-ftRNAi (#34970), UAS-fjRNAi (#34323); and UAS-SCARRNAi (#21908) from Vienna Drosophila Research Center Stock Center.

Dpp:mCherry

The Dpp:mCherry transgene has mCherry inserted C-terminal to Dpp amino acid 465 [17], with Leu-Val linkers inserted before and after a mCherry coding sequence deleted of its stop codon. The transgene was generated by CRISPR mutagenesis as follows:

Dpp:mCherry donor vector

Left homology arm fragment contains overlapping sequence with PBS-SK vector and mCherry. The mCherry fragment contains overlapping sequence with the left homology arm and right homology arm. The right homology arm fragment contains overlapping sequence with mCherry and PBS-SK vector. The three fragments were stitched together and cloned into PBS-SK vector using Gibson Assembly (NEB). The resulting vector is designated as Dpp:Cherry donor vector. Left arm homology sequence was amplified from wild-type genomic DNA using: L-arm-fwd: cggtatcgataagcttgatcaccttgccgcacaaatacatatac L-arm-rev: CCTCGCCCTTGCTCACCATCTCCAGGCCACCGCCCTCTCCGGCAGACACGTCCCGA The mCherry tag was amplified using: mCherry-fwd:TGTCTGCCGGAGAGGGCGGTGGCCTGGAGATGGTGAGCAAGGGCGAGGAGGATAAC Cherry-rev:CGCTTGTTCCGGCCGCCCTTCTCTAACTTGTACAGCTCGTCCATGCCGC The right arm homology sequence was amplified from wild-type genomic DNA using: R-arm-fwd:GGACGAGCTGTACAAGTTAGAGAAGGGCGGCCGGAACAAGCGGCAGCCGA R-arm-rev:ccgggctgcaggaattcgatGTCATTATTCGGTTATGCTCTCGCTAG pCFD-3 gRNA vector gRNA sequence: CGCTCCATTCGGGACGTGTCTGG The gRNA sequence without the PAM was cloned into pCFD-3 vector obtained from Addgene.

Dpp:Cherry CISPR lines

pCFD-3 gRNA vector and Dpp:mCherry donor vector were co-injected into Cas9 expressing flies (nanos-Cas9) by Rainbow Transgenics. The resulting CRISPR-generated flies were screened and verified by sequencing. The Dpp:mCherry homozygous fly is viable and has normal morphology. The distribution of Cherry fluorescence in the wing disc is consistent with images in [17,49], and the gradient of Cherry fluorescence in the columnar epithelial cells of the disc is intracellular (S1 Fig).

EGFR-Pcn tumor

EGFR-Pcn tumors were induced as described by Herranz et al, [12] by overexpression of EGFR and down-regulation of pipsqueak (psq), which leads to increased levels of Pcn. Female flies from the stock ap-Gal4,UAS-psq/CyO;UAS-EGFR,tub-Gal80 were crossed to males of the corresponding genotypes at 18°C, and were cultured at 18°C to maintain Gal80 repression of Gal4 and allow normal development. After 5 days larvae were transferred to 29°C to induce Gal4 expression and tumor growth. 4 days after the temperature shift CyO/+ flies eclosed and were removed from the vial. Tumor growth was induced for 7 days, unless otherwise indicated, whereupon larvae were dissected for live imaging or immunostaining, or were maintained at 29°C for survival studies. To control for possible effects on Gal4 expression, all tested genotypes had three UAS transgenes–either UAS-EGFR, UAS-psqRNAi and UAS-CD8:GFP for tumor flies, or UAS-EGFR, UAS-psqRNAi and additional RNAi for comparisons. Experimental and control crosses were carried out in parallel.

RET tumor model

Female flies from the RETMEN2 stock [14] were crossed at room temperature to either ptc-Gal4, 2xUAS-CD8:GFP males or either with UAS-diaRNAi, or SCARRNAi or Irk2DN males. For analysis of discs, embryos from one day collections were transferred to 29°C and cultured to third instar stage. For survival comparisons, animals were cultured at 25°C.

Live imaging of wing imaginal discs

Wing discs with trachea attached were dissected in cold phosphate-buffered saline (PBS), placed on a coverslip and mounted upside-down on a coverslip on a depression slide as described [9]. Samples were imaged with a Leica TCS SPE confocal or an Olympus FV3000 inverted confocal laser scanning microscope.

Immunohistochemistry

Wing discs were dissected in cold PBS and fixed in 4% formaldehyde for 20 minutes. After extensive washing, the samples were permeablized with PBST (PBS + 0.3% TritonX-100), blocked for 1h with PBST+3%BSA blocking buffer, and incubated with primary antibodies previously diluted in blocking buffer overnight at 4°C. The following primary antibodies were used: α-pMad (Abcam), α-Discs large (Dlg), α-Cut and α-β-galactosidase (Developmental Studies Hybridoma Bank). Secondary antibodies were conjugated to Alexa Fluor 405, 488, 555, or 647. Samples were mounted in Vectashield and imaged with a Leica TCS SPE confocal or an Olympus FV3000 inverted confocal laser scanning microscope.

Image analysis and quantification

All measurements and quantifications of wing discs were done in z-section stacks of confocal images using Fiji software from 15–20 discs for each genotype. Total wing disc area and Cut-expressing cells in the EGFR-Pcn tumor or GFP-expressing cells in the RET tumor, were quantified by measuring the mean intensity of fluorescence relative to the total area of the wing disc. Data was normalized to control. Statistical significance values were calculated with Student’s t test.

Quantitative real-time PCR

Total RNA was extracted from 5 wing discs of either wild type, EGFR-Pcn tumor or EGFR-Pcn tumor + BtlDN larvae using the RNeasy Micro Kit (Quiagen). Larvae corresponding from 3 genotypes were under the same temperature conditions (5 days of tumor induction at 29°C). Reverse transcription was carried out using the Applied Biosystem High Capacity RNA-to-cDNA. qPCR reactions were performed with a BioRad C1000 Touch Thermal Cycler and SYBR Green (Bioline). qPCR results were analyzed according to the comparative threshold cycle (Ct) method, where the amount of target, normalized to an endogenous actin reference and relative to an experimental control, is given by 2–ΔΔCt. Ct represents the PCR cycle number at which the amount of target reaches a fixed threshold. The ΔCt value is determined by subtracting the reference Ct value (rp49) from the target Ct value. ΔCt was calculated by subtracting the ΔCt experimental control value.

Dpp:mCherry distribution in the wing disc.

Wing discs from a L3 larva with the CRISPR-generated Dpp:mCherry allele stained with phalloidin (green) to mark the cells. Frontal section shows Cherry fluorescence extending anteriorly and posteriorly from the band of Dpp expression. Orthogonal section shows that the Cherry fluorescence in the cells outside the band of Dpp expression is intracellular. (TIF) Click here for additional data file.

Conditions that don’t ablate cytonemes do not reduce tumor growth.

(A) Unfixed wing disc with marked tracheal cells (green). Genotype: ap-Gal4,UAS-psq/btl-LHG,lexO-CD2-GFP;UAS-EGFR,tub-Gal80/UAS-diaRNAi. (B-D) Fixed wing discs stained with α-pMad (red) antibody to monitor Dpp signaling and α-Cut (cyan) to label myoblasts. Scale bar: 100μm. (B-B’) Tumor + fjRNAi, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-fj. (C-C’) Tumor + dsRNAi, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-ds. (D-D’) Tumor + ftRNAi, genotype: ap-Gal4,UAS-psq/+;UAS-EGFR,tub-Gal80/UAS-ft. (TIF) Click here for additional data file. 2 Sep 2019 [EXSCINDED] * Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. * Dear Tom: We finally got the reviews for your Research Article entitled 'Cytoneme-mediated signaling essential for tumorigenesis' to PLOS Genetics. As we only had very partial reviews from PLOS Biology, we had to send the manuscript back for review and we managed to obtain three in depth reviews. As you will see, all three reviewers feel that the work is important and should be published. However, two of them ask for clarifications for several points and I hope that you will be able to answer these points without taking too much time. One of the reviewers asks for further experiments, but hopefully, you should be able to argue the points and explain in a rebuttal how you would like to address this. I hope that you will be able to get back to us very shortly with a revised document. We therefore ask you to modify the manuscript according to the review recommendations before we can consider your manuscript for acceptance. Your revisions should address the specific points made by each reviewer. In addition we ask that you: 1) Provide a detailed list of your responses to the review comments and a description of the changes you have made in the manuscript. 2) Upload a Striking Image with a corresponding caption to accompany your manuscript if one is available (either a new image or an existing one from within your manuscript). If this image is judged to be suitable, it may be featured on our website. Images should ideally be high resolution, eye-catching, single panel square images. For examples, please browse our archive. If your image is from someone other than yourself, please ensure that the artist has read and agreed to the terms and conditions of the Creative Commons Attribution License. Note: we cannot publish copyrighted images. We hope to receive your revised manuscript within the next 30 days. If you anticipate any delay in its return, we would ask you to let us know the expected resubmission date by email to plosgenetics@plos.org. If present, accompanying reviewer attachments should be included with this email; please notify the journal office if any appear to be missing. They will also be available for download from the link below. You can use this link to log into the system when you are ready to submit a revised version, having first consulted our Submission Checklist. While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please be aware that our data availability policy requires that all numerical data underlying graphs or summary statistics are included with the submission, and you will need to provide this upon resubmission if not already present. In addition, we do not permit the inclusion of phrases such as "data not shown" or "unpublished results" in manuscripts. All points should be backed up by data provided with the submission. PLOS has incorporated Similarity Check, powered by iThenticate, into its journal-wide submission system in order to screen submitted content for originality before publication. Each PLOS journal undertakes screening on a proportion of submitted articles. You will be contacted if needed following the screening process. To resubmit, you will need to go to the link below and 'Revise Submission' in the 'Submissions Needing Revision' folder. [LINK] Please let us know if you have any questions while making these revisions. Cordially, Claude Claude Desplan Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics Reviewer's Responses to Questions Comments to the Authors: Reviewer #1: In this revised manuscript, the authors examine the role of cytonemes in two cancer models, EGFR/Perlecan and Ret. This work builds on previous work from the Kornberg laboratory demonstrating the central role of cytonemes in a broad array of cell-cell signaling paradigms. The data is clean and clearly presented, and the authors have addressed the previous reviewers' issues. The impact of demonstrating that cytonemes signal in cancer is potentially large, as the field is seeing an increasing appreciation of the importance of local epithelial biology on tumor progression and therapeutic response. One challenge of this work is cleanly removing cytonemes without affecting other aspect of the cells' biology. The authors argue that showing requirement for a diverse set of six genes linked to cytonemes is the same as demonstrating a requirement for cytonemes in transformation. The problem with this argument is that each of the six loci is important for a central aspect of cell biology, and their requirement for transformation is not surprising. However, the Kornberg laboratory has a long track record of demonstrating a role for cytonemes. Evidence for cytoneme involvement in transformation of these fly cancer models includes: • the authors show extensive cytoneme networks associated with the tumors • the presence of cytonemes is closely correlated with activity of EGFR etc. based on previous work • genes that disrupt cytonemes consistently reduce aspects of transformation; the Kornberg laboratory has previously extensively characterized their partial loss-of-function phenotypes, which is different from aspects of cell transformation • the work demonstrating a role for Bnl provides strong evidence for cytoneme involvement, since the requirement for cytoneme-based signaling by Bnl is well established. The authors have strong evidence for the role of cytonemes in transformation. However, they should note in the manuscript that their data is "consistent with a role for cytonemes in tumor progression" but that they cannot rule out that these six loci also alter tumor progression through their other known cell biology roles. A more conservative description better captures the data. Small points: • The authors use the word “cure” at multiple points throughout the manuscript. A subset of animals are rescued to adulthood by preventing transformation through genetic or drug manipulation prior to transformation. This is not a cure, and is not the same as reversing transformation with a drug, a requirement in clinical studies to claim a cure. • The authors state that emergent Ret adults have no phenotype when the activity of cytoneme regulators is reduced. Given the use of the patched driver, they should show in the wing or elsewhere that, for example, the wing patterning is normal. This would be a rigorous test for the requirement of the different loci or drugs. • Figure 5S should be moved to Supplemental data. Reviewer #2: The manuscript by Fereres et al. examine the role of cytonemes in two Drosophila tumor models. The main conclusion is that cytonemes are necessary for tumor growth as they promote signaling between epithelia cells and mesenchymal cells/myoblasts. The study is of interest to PLoS Genetics readers, however, the model they present is suggestive and not conclusive. More experiments are needed to make the argument more compelling. A key observation is that in the tumor model (overexpression of wild type EGFR and perlecan), Bnl/FGF and its receptor Btl are ectopically expressed, and that blocking Btl RTK signaling in epithelial cells overexpressing EGFR + perlecan suppresses proliferation. The authors conclude, as Bnl/Btl signaling has previously been implicated in cytoneme formation, "that cytonemes traffic the signaling proteins that move between tumor and stromal cells.” An alternative model is that Btl signaling in epithelial cells upregulates ERK signaling (in synergy with overexpressed EGFR) independently of cytonemes. The authors should activate MAPK signaling, which can be done in a number of ways, in the absence of Btl in epithelial cells and examine whether epithelial cells can proliferate and whether they have or do not have cytonemes. If they have cytonemes then they should remove them using DiaRNAi (for example) and test whether cytonemes are required for activated MAPK proliferation. If cytonemes are not required for proliferation then one would conclude that ERK activation is all the epithelial cells need for proliferation which would put in question the conclusion that Btl role in epithelial cells is to build cytonemes that in turn are required to signal to myoblasts to receive in turn growth factors. The authors propose that signaling from myoblasts through myoblast cytonemes is important for proliferation of epithelial tumors. I presume that it is Wnt signaling from the myoblasts that is important. It would be of interest to express Wntless RNAi (with 1151-lex, lexO-Wintless RNAi) in the myoblasts of discs that overexpress EGFR + Pcn in the columnar epithelial cells, to clarify this issue. The authors propose that "These results suggest that tumor growth might be dependent on ectopic tracheation”. There is no data in the manuscript to test the role of trachea on epithelial cells proliferation The only data is the observation that there are more trachea in discs overexpressing wild type EGFR and perlecan, which is not surprising as they produce more Bnl. Data on the Ret tumor model are very preliminary and do not add much to the study. Reviewer #3: In "Cytoneme-mediated signaling essential for tumorigenesis", Fereres et al present the first evidence of the role of signaling specialized cell protrusions (cytonemes) during tumorigenesis. This manuscript approaches the mechanisms for cell-to-cell communication in tumor formation; presenting striking data for the inhibition of tumor growth by the abrogation of cytoneme formation in Drosophila experimental models. To do this, the authors use regulated partial inhibition of proteins required for the formation of cytonemes linked to Dpp and FGF pathways. Cytoneme mediated transport of these signals between wing disc and stroma cells (myoblasts and ASP) seems to be important for tumor development. As a whole I consider that the manuscript presents important results supporting the crucial role of cytoneme-mediated signaling in the intercellular communication during tumor development. It embodies the advances in the application of ground-breaking research regarding cell communication within a disease scenario. Therefore, I recommend its publication, however, there are some important issues that should be addressed first, mainly regarding clarity in the model proposed as well as in the actual experimental evidence for cytoneme-mediated signaling on tumor growth. Major concerns: 1. In general, the manuscript lacks clarity regarding the attempted parallelisms between the Drosophila experimental models used and a classic tumor system. Through the manuscript it would be useful if authors kept defining the signaling of tumor versus stroma tissues. In the current text version is not always clear whether interpretations are refereeing to cytoneme-mediated signaling between wing disc and myoblast (or ASP) cells or among wing disc cells and actual tumor tissue overgrowth. 2. The experiment showing requirement of cytoneme-mediated signaling from myoblasts for wing disc tumor formation is very striking and would imply an absolute requirement of stromal cell-signaling for tumor growth. However, further experimental evidence is necessary regarding the signaling implicated, as rescue of the tumor growth when cytonemes are abrogated in the wing disc epithelium is also presented. In general characterization of cytonemes in tumor, no-tumor and rescued conditions are lacking, and quantifications and/or directionality analysis for the different situations would further support the cytonemes crucial role. 3. There are no experimental evidences showing the possible effect in cell death after the expression of the cytoneme abrogating RNAis. The tumor rescue could be due to tumor cell death induced by the expression of those tools. 4. Although the authors present strong evidence for increased FGF signaling during tumorigenesis, as well as impressive rescue evidence upon its inhibition, no data is presented towards the effects of induced ectopic FGF signaling in the wing disc. Would over-expression of Bnl or Btl in the wing disc be sufficient to induce tumor growth? Would this ectopic expression increase cytoneme occurrence? if there is already published evidence regarding these aspects, authors should at least refer it. In the same line, experimental evidence for FGF signaling effects upon cytoneme abrogation (as presented for Dpp signaling) would further clarify cytoneme function over tumor growth processes. 5. A final schematic model figure could be very useful and further explain data interpretation about stroma and tumor interaction; this figure should also include signal dependence between both tissues for tumor growth. Minor concerns: 1. Methods for imaging analysis and quantifications should be included. 2. Regarding the use of the Dpp-mCherry insertion and as there has been some controversial publications (Entchev et al., 2000) arguing the potential loss of tags upon ligand processing (Harmansa et al., 2015); it would be desirable to include tests proving the tagging of the expressed protein in these flies (for example through an anti-Cherry WB). 3. The presentation of images showing Dpp-Cherry on cytonemes from tumor discs could benefit from the inclusion of information such as moving direction. 4. Figure 5G further labeling would help interpretation. As for the figure presented in between Figure 5 and 6 (Figure 5S) there is no labeling at all at present, and it should at least show the names of markers used. 5. Images presenting Ptc expressing cells in Fig. 6 should be labeled regarding the fluorescent reporter used (CD8GFP?) 6. Quantification of tumor disc area upon conditions that do not ablate cytonemes (Supplementary Figure 3) should be presented. 7. I might have missed something but after careful manuscript reading I found that the only genetic inhibition that rescues to adulthood is that of Dia and not the other cytoneme induced factors. Thus, a brief discussion of author’s interpretation towards this difference should be included. ********** Have all data underlying the figures and results presented in the manuscript been provided? Large-scale datasets should be made available via a public repository as described in the PLOS Genetics data availability policy, and numerical data that underlies graphs or summary statistics should be provided in spreadsheet form as supporting information. Reviewer #1: Yes Reviewer #2: None Reviewer #3: Yes ********** PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Ross Cagan Reviewer #2: No Reviewer #3: No 11 Sep 2019 Dear Tom, We are pleased to inform you that your manuscript entitled "Cytoneme-mediated signaling essential for tumorigenesis" has been editorially accepted for publication in PLOS Genetics. Congratulations! and I hope that the long process was not too painful! Before your submission can be formally accepted and sent to production you will need to complete our formatting changes, which you will receive in a follow up email. Please be aware that it may take several days for you to receive this email; during this time no action is required by you. Please note: the accept date on your published article will reflect the date of this provisional accept, but your manuscript will not be scheduled for publication until the required changes have been made. Once your paper is formally accepted, an uncorrected proof of your manuscript will be published online ahead of the final version, unless you’ve already opted out via the online submission form. If, for any reason, you do not want an earlier version of your manuscript published online or are unsure if you have already indicated as such, please let the journal staff know immediately at plosgenetics@plos.org. In the meantime, please log into Editorial Manager at https://www.editorialmanager.com/pgenetics/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production and billing process. Note that PLOS requires an ORCID iD for all corresponding authors. Therefore, please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field.  This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. If you have a press-related query, or would like to know about one way to make your underlying data available (as you will be aware, this is required for publication), please see the end of this email. If your institution or institutions have a press office, please notify them about your upcoming article at this point, to enable them to help maximise its impact. Inform journal staff as soon as possible if you are preparing a press release for your article and need a publication date. Thank you again for supporting open-access publishing; we are looking forward to publishing your work in PLOS Genetics! Cordially, Claude, Claude Desplan Associate Editor PLOS Genetics Gregory Barsh Editor-in-Chief PLOS Genetics www.plosgenetics.org Twitter: @PLOSGenetics ---------------------------------------------------- Comments from the reviewers (if applicable): ---------------------------------------------------- Data Deposition If you have submitted a Research Article or Front Matter that has associated data that are not suitable for deposition in a subject-specific public repository (such as GenBank or ArrayExpress), one way to make that data available is to deposit it in the Dryad Digital Repository. As you may recall, we ask all authors to agree to make data available; this is one way to achieve that. A full list of recommended repositories can be found on our website. The following link will take you to the Dryad record for your article, so you won't have to re‐enter its bibliographic information, and can upload your files directly: http://datadryad.org/submit?journalID=pgenetics&manu=PGENETICS-D-19-01310R1 More information about depositing data in Dryad is available at http://www.datadryad.org/depositing. If you experience any difficulties in submitting your data, please contact help@datadryad.org for support. Additionally, please be aware that our data availability policy requires that all numerical data underlying display items are included with the submission, and you will need to provide this before we can formally accept your manuscript, if not already present. ---------------------------------------------------- Press Queries If you or your institution will be preparing press materials for this manuscript, or if you need to know your paper's publication date for media purposes, please inform the journal staff as soon as possible so that your submission can be scheduled accordingly. Your manuscript will remain under a strict press embargo until the publication date and time. This means an early version of your manuscript will not be published ahead of your final version. PLOS Genetics may also choose to issue a press release for your article. If there's anything the journal should know or you'd like more information, please get in touch via plosgenetics@plos.org. 23 Sep 2019 PGENETICS-D-19-01310R1 Cytoneme-mediated signaling essential for tumorigenesis Dear Dr Kornberg, We are pleased to inform you that your manuscript entitled "Cytoneme-mediated signaling essential for tumorigenesis" has been formally accepted for publication in PLOS Genetics! Your manuscript is now with our production department and you will be notified of the publication date in due course. The corresponding author will soon be receiving a typeset proof for review, to ensure errors have not been introduced during production. Please review the PDF proof of your manuscript carefully, as this is the last chance to correct any errors. Please note that major changes, or those which affect the scientific understanding of the work, will likely cause delays to the publication date of your manuscript. Soon after your final files are uploaded, unless you have opted out or your manuscript is a front-matter piece, the early version of your manuscript will be published online. The date of the early version will be your article's publication date. The final article will be published to the same URL, and all versions of the paper will be accessible to readers. Thank you again for supporting PLOS Genetics and open-access publishing. We are looking forward to publishing your work! With kind regards, Kaitlin Butler PLOS Genetics On behalf of: The PLOS Genetics Team Carlyle House, Carlyle Road, Cambridge CB4 3DN | United Kingdom plosgenetics@plos.org | +44 (0) 1223-442823 plosgenetics.org | Twitter: @PLOSGenetics
  47 in total

1.  Gradient formation of the TGF-beta homolog Dpp.

Authors:  E V Entchev; A Schwabedissen; M González-Gaitán
Journal:  Cell       Date:  2000-12-08       Impact factor: 41.582

Review 2.  The cytoneme connection: direct long-distance signal transfer during development.

Authors:  Laura González-Méndez; Ana-Citlali Gradilla; Isabel Guerrero
Journal:  Development       Date:  2019-05-08       Impact factor: 6.868

Review 3.  Fat and Dachsous cadherins.

Authors:  Praveer Sharma; Helen McNeill
Journal:  Prog Mol Biol Transl Sci       Date:  2013       Impact factor: 3.622

4.  Glutamate signaling at cytoneme synapses.

Authors:  Hai Huang; Songmei Liu; Thomas B Kornberg
Journal:  Science       Date:  2019-03-01       Impact factor: 47.728

5.  Cytoneme-mediated contact-dependent transport of the Drosophila decapentaplegic signaling protein.

Authors:  Sougata Roy; Hai Huang; Songmei Liu; Thomas B Kornberg
Journal:  Science       Date:  2014-01-02       Impact factor: 47.728

6.  Feedback regulation of cytoneme-mediated transport shapes a tissue-specific FGF morphogen gradient.

Authors:  Lijuan Du; Alex Sohr; Ge Yan; Sougata Roy
Journal:  Elife       Date:  2018-10-17       Impact factor: 8.140

Review 7.  Tumour-stroma interactions in pancreatic ductal adenocarcinoma: rationale and current evidence for new therapeutic strategies.

Authors:  V Heinemann; M Reni; M Ychou; D J Richel; T Macarulla; M Ducreux
Journal:  Cancer Treat Rev       Date:  2013-07-09       Impact factor: 12.111

8.  Specialized filopodia direct long-range transport of SHH during vertebrate tissue patterning.

Authors:  Timothy A Sanders; Esther Llagostera; Maria Barna
Journal:  Nature       Date:  2013-04-28       Impact factor: 49.962

9.  Microenvironmental control of breast cancer subtype elicited through paracrine platelet-derived growth factor-CC signaling.

Authors:  Pernilla Roswall; Matteo Bocci; Michael Bartoschek; Hong Li; Glen Kristiansen; Sara Jansson; Sophie Lehn; Jonas Sjölund; Steven Reid; Christer Larsson; Pontus Eriksson; Charlotte Anderberg; Eliane Cortez; Lao H Saal; Christina Orsmark-Pietras; Eugenia Cordero; Bengt Kristian Haller; Jari Häkkinen; Ingrid J G Burvenich; Elgene Lim; Akira Orimo; Mattias Höglund; Lisa Rydén; Holger Moch; Andrew M Scott; Ulf Eriksson; Kristian Pietras
Journal:  Nat Med       Date:  2018-03-12       Impact factor: 53.440

10.  Physical nanoscale conduit-mediated communication between tumour cells and the endothelium modulates endothelial phenotype.

Authors:  Yamicia Connor; Sarah Tekleab; Shyama Nandakumar; Cherelle Walls; Yonatan Tekleab; Amjad Husain; Or Gadish; Venkata Sabbisetti; Shelly Kaushik; Seema Sehrawat; Ashish Kulkarni; Harold Dvorak; Bruce Zetter; Elazer R Edelman; Shiladitya Sengupta
Journal:  Nat Commun       Date:  2015-12-16       Impact factor: 14.919

View more
  16 in total

Review 1.  TGFβ biology in cancer progression and immunotherapy.

Authors:  Rik Derynck; Shannon J Turley; Rosemary J Akhurst
Journal:  Nat Rev Clin Oncol       Date:  2020-07-24       Impact factor: 66.675

2.  Elimination of nurse cell nuclei that shuttle into oocytes during oogenesis.

Authors:  Zehra Ali-Murthy; Richard D Fetter; Wanpeng Wang; Bin Yang; Loic A Royer; Thomas B Kornberg
Journal:  J Cell Biol       Date:  2021-05-05       Impact factor: 10.539

3.  Modeling of Wnt-mediated tissue patterning in vertebrate embryogenesis.

Authors:  Jakob Rosenbauer; Chengting Zhang; Benjamin Mattes; Ines Reinartz; Kyle Wedgwood; Simone Schindler; Claude Sinner; Steffen Scholpp; Alexander Schug
Journal:  PLoS Comput Biol       Date:  2020-06-24       Impact factor: 4.475

Review 4.  Cytonemes in development.

Authors:  Chengting Zhang; Steffen Scholpp
Journal:  Curr Opin Genet Dev       Date:  2019-08-09       Impact factor: 5.578

5.  Self-limiting stem-cell niche signaling through degradation of a stem-cell receptor.

Authors:  Sophia Ladyzhets; Matthew Antel; Taylor Simao; Nathan Gasek; Ann E Cowan; Mayu Inaba
Journal:  PLoS Biol       Date:  2020-12-14       Impact factor: 8.029

6.  Somatic CG6015 mediates cyst stem cell maintenance and germline stem cell differentiation via EGFR signaling in Drosophila testes.

Authors:  Qianwen Zheng; Xia Chen; Chen Qiao; Min Wang; Wanyin Chen; Xiaojin Luan; Yidan Yan; Cong Shen; Jie Fang; Xing Hu; Bo Zheng; Yibo Wu; Jun Yu
Journal:  Cell Death Discov       Date:  2021-04-06

7.  CG6015 controls spermatogonia transit-amplifying divisions by epidermal growth factor receptor signaling in Drosophila testes.

Authors:  Jun Yu; Qianwen Zheng; Zhiran Li; Yunhao Wu; Yangbo Fu; Xiaolong Wu; Dengfeng Lin; Cong Shen; Bo Zheng; Fei Sun
Journal:  Cell Death Dis       Date:  2021-05-14       Impact factor: 8.469

8.  Hedgehog produced by the Drosophila wing imaginal disc induces distinct responses in three target tissues.

Authors:  Ryo Hatori; Thomas B Kornberg
Journal:  Development       Date:  2020-11-17       Impact factor: 6.862

9.  New Cellular Dimensions on Glioblastoma Progression.

Authors:  Marta Portela; Sergio Casas-Tintó
Journal:  Neurosci Insights       Date:  2020-05-22

Review 10.  Cytonemes, Their Formation, Regulation, and Roles in Signaling and Communication in Tumorigenesis.

Authors:  Sergio Casas-Tintó; Marta Portela
Journal:  Int J Mol Sci       Date:  2019-11-11       Impact factor: 5.923

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.