Alexander D Fulford1,2, Maxine V Holder3, David Frith4, Ambrosius P Snijders4, Nicolas Tapon3, Paulo S Ribeiro1. 1. Centre for Tumour Biology, Barts Cancer Institute, Queen Mary University of London, London, United Kingdom. 2. Department of Developmental Biology, Washington University School of Medicine, St. Louis, United States. 3. Apoptosis and Proliferation Control Laboratory, The Francis Crick Institute, London, United Kingdom. 4. Proteomics, The Francis Crick Institute, London, United Kingdom.
Abstract
Hippo signalling integrates diverse stimuli related to epithelial architecture to regulate tissue growth and cell fate decisions. The Hippo kinase cascade represses the growth-promoting transcription co-activator Yorkie. The FERM protein Expanded is one of the main upstream Hippo signalling regulators in Drosophila as it promotes Hippo kinase signalling and directly inhibits Yorkie. To fulfil its function, Expanded is recruited to the plasma membrane by the polarity protein Crumbs. However, Crumbs-mediated recruitment also promotes Expanded turnover via a phosphodegron-mediated interaction with a Slimb/β-TrCP SCF E3 ligase complex. Here, we show that the Casein Kinase 1 (CKI) family is required for Expanded phosphorylation. CKI expression promotes Expanded phosphorylation and interaction with Slimb/β-TrCP. Conversely, CKI depletion in S2 cells impairs Expanded degradation downstream of Crumbs. In wing imaginal discs, CKI loss leads to elevated Expanded and Crumbs levels. Thus, phospho-dependent Expanded turnover ensures a tight coupling of Hippo pathway activity to epithelial architecture.
Hippo signalling integrates diverse stimuli related to epithelial architecture to regulate tissue growth and cell fate decisions. The Hippo kinase cascade represses the growth-promoting transcription co-activator Yorkie. The FERM protein Expanded is one of the main upstream Hippo signalling regulators in Drosophila as it promotes Hippo kinase signalling and directly inhibits Yorkie. To fulfil its function, Expanded is recruited to the plasma membrane by the polarity protein Crumbs. However, Crumbs-mediated recruitment also promotes Expanded turnover via a phosphodegron-mediated interaction with a Slimb/β-TrCP SCF E3 ligase complex. Here, we show that the Casein Kinase 1 (CKI) family is required for Expanded phosphorylation. CKI expression promotes Expanded phosphorylation and interaction with Slimb/β-TrCP. Conversely, CKI depletion in S2 cells impairs Expanded degradation downstream of Crumbs. In wing imaginal discs, CKI loss leads to elevated Expanded and Crumbs levels. Thus, phospho-dependent Expanded turnover ensures a tight coupling of Hippo pathway activity to epithelial architecture.
The maintenance of epithelial tissue architecture through cell-cell and cell-extracellular matrix contacts, as well as cell polarity, is essential for organ function and size control (Genevet and Tapon, 2011; Low et al., 2014). The evolutionarily conserved Hippo (Hpo) pathway, a key signalling module that senses and responds to epithelial organisation, has emerged as a critical regulator of growth and epithelial integrity (Genevet and Tapon, 2011; Schroeder and Halder, 2012; Yu and Guan, 2013). At the core of Hpo signalling is a kinase cascade comprising Hpo and Warts (Wts), which promote the phosphorylation and inactivation of the pro-growth transcriptional co-activator Yorkie (Yki, YAP in mammals), thereby repressing tissue growth (Yu and Guan, 2013; Fulford et al., 2018; Hong and Guan, 2012). When Hpo signalling is inactive, Yki/YAP is able to enter the nucleus, associate with its transcription factor partner Scalloped (TEAD1-4 in mammals) and promote the expression of cell cycle regulators and apoptosis inhibitors, among others (Genevet and Tapon, 2011; Yu and Guan, 2013; Hong and Guan, 2012). To ensure that epithelial homeostasis is maintained, Yki/YAP also control the expression of Hpo pathway upstream regulators that dampen Yki/YAP activity as part of a negative feedback mechanism (Genevet and Tapon, 2011; Halder and Johnson, 2011).Yki/YAP activity responds to epithelial organisation through the actin cytoskeleton (Gaspar and Tapon, 2014), basolateral polarity determinants (Chen et al., 2012; Cordenonsi et al., 2011; Grzeschik et al., 2010), adherens junction components, such as α-catenin (Schlegelmilch et al., 2011), and apical polarity proteins, such as Crumbs (Crb) (Grzeschik et al., 2010; Chen et al., 2010; Hafezi et al., 2012; Ling et al., 2010; Robinson et al., 2010; Varelas et al., 2010). While the vast majority of these inputs act through Hpo and/or Wts, some engage core kinase cascade-independent signalling (Genevet and Tapon, 2011; Yu and Guan, 2013). The FERM domain protein Expanded (Ex) is a key regulator of Yki function (Hamaratoglu et al., 2006), which inhibits tissue growth using both Hpo-dependent and -independent mechanisms, in a manner analogous to mammalian Angiomotins (Moleirinho et al., 2014). Ex is an upstream activator of the Hpo core kinase cassette that forms a complex with Kibra and Merlin (Baumgartner et al., 2010; Genevet et al., 2010; McCartney et al., 2000; Yu et al., 2010). Ex has been proposed to promote core kinase activity by bridging Hpo association with the upstream kinase Tao-1 together with Schip1 (Genevet and Tapon, 2011; Chung et al., 2016), and by recruiting Wts to the apical membrane where it can be activated by Hpo (Sun et al., 2015). Ex also restrains tissue growth in a phosphorylation-independent manner by tethering Yki at the apical membrane via a direct PPxY:WW domain-mediated interaction (Badouel et al., 2009; Oh et al., 2009), a process regulated by Ack-dependent tyrosine phosphorylation of Ex (Hu et al., 2016). Moreover, Ex has also been linked with F-actin-mediated regulation of Yki function, by antagonising the action of Zyxin (Gaspar et al., 2015). Interestingly, ex is a Yki target gene and, therefore, it is a prime candidate to mediate the Hpo pathway feedback regulation that controls tissue homeostasis (Genevet and Tapon, 2011; Halder and Johnson, 2011).Ex is a key link between epithelial polarity and Hpo signalling. This is controlled by the transmembrane protein Crb, which in addition to its recognised role in polarity, also regulates tissue growth by modulating the Notch and Hpo pathways (Grzeschik et al., 2010; Chen et al., 2010; Hafezi et al., 2012; Ling et al., 2010; Robinson et al., 2010; Richardson and Pichaud, 2010). Via its FERM-binding motif (FBM), Crb recruits Ex to the apical membrane, where it can promote inhibition of Yki (Genevet and Tapon, 2011; Chen et al., 2010; Hafezi et al., 2012; Ling et al., 2010; Robinson et al., 2010; Su et al., 2017). However, besides activating Hpo signalling through Ex, Crb also stimulates Ex phosphorylation and turnover of Ex protein (Genevet and Tapon, 2011; Grzeschik et al., 2010; Chen et al., 2010; Ling et al., 2010; Robinson et al., 2010; Ribeiro et al., 2014; Laprise, 2011). We have previously shown that ubiquitylation and degradation of Ex downstream of Crb is mediated by the phospho-dependent SCFSlimb/β-TrCP E3 ligase complex, which is also thought to regulate Ex levels independently of Crb (Ribeiro et al., 2014; Zhang et al., 2015). However, the identity of the kinase(s) that promote Ex degradation downstream of Crb is currently unknown.Here, we identify the Casein Kinase 1 (CKI) family of protein kinases as regulators of Ex stability that function downstream of the polarity protein Crb. Depletion of CKI kinases suppresses Crb-induced Ex phosphorylation, ubiquitylation and degradation. Interestingly, CKI kinases regulate Ex in a partially redundant manner, which suggests that regulation of Ex stability is a key step in the regulation of Yki function and the maintenance of tissue homeostasis.
Results
Crb promotes interaction of Ex with Casein kinase 1 family proteins
We have previously shown that Crb regulates Ex protein stability in a β-TrCP-dependent manner (Ribeiro et al., 2014). The Ex:Slimb (Slmb, Drosophila β-TrCP) interaction is mediated by a β-TrCP consensus sequence immediately following the Ex N-terminal FERM domain (452TSGIVS457). In agreement with the fact that β-TrCP targets substrates for ubiquitylation and degradation through the recognition of a phosphodegron, Ex is phosphorylated in Drosophila S2 cells in the presence of ectopic Crb (full-length or the intracellular domain, Crbintra) (Ling et al., 2010; Robinson et al., 2010; Ribeiro et al., 2014). However, the kinase(s) involved in Ex degradation downstream of Crb are currently unknown. In our previous report, we used affinity purification coupled with mass spectrometry (AP-MS) to identify Slmb as an Ex interacting protein (Ribeiro et al., 2014). Upon re-analysis of our AP-MS data, we observed that Gilgamesh (Gish), the Drosophila orthologue of Casein kinase 1γ, was specifically purified by an Ex truncation that fully recapitulates the Crb-mediated effect on Ex stability (Ex1-468) (Figure 1A) (Ribeiro et al., 2014). Importantly, Gish peptides were detected in the Ex1-468 AP-MS only upon co-expression with wild-type (wt) Crb but not with a FERM-binding motif mutant version of Crb (ΔFBM) that cannot bind Ex or promote its depletion (Figure 1A) (Ling et al., 2010; Robinson et al., 2010; Ribeiro et al., 2014). In contrast, Hpo interacted with Ex regardless of Crb presence, in agreement with previous reports (Figure 1A) (Yu et al., 2010).
Figure 1.
Gish, the Drosophila orthologue of CkIγ interacts with Ex in a Crb-dependent manner.
(A) An AP-MS approach identified Gish as an Ex-interacting protein. Summary table with AP-MS results for Gish and Hpo. CG# denotes Flybase CG number, while unique and total denote the number of peptides detected in the MS analysis. (B) and (C) Crbintra promotes Ex:Gish binding in a FBM-dependent manner. Reciprocal co-IPs were performed with FLAG-tagged NTAN or Ex1-468 and HA-tagged Gish (B), or with FLAG-tagged NTAN or GishisoI and V5-tagged Ex1-468 CAAX (C), in the presence of Myc-tagged GFP, Crbintra or CrbΔFBM. The expression and presence of co-purified proteins were analysed by immunoblotting with the indicated antibodies. Asterisks denote non-specific bands (IgG heavy chain in IP panel and FLAG signal in Tubulin panel). Open and full circles denote absence or presence of the indicated plasmid, respectively. Tubulin was used as loading control. Note that experiments shown in (C) were performed in the presence of proteasome inhibitors.
(A) Phylogenetic relation between human and Drosophila CKI isoforms and other Drosophila kinases with >50% overall similarity to CkIα. (B) Domain structure of isoforms F and I of Gish. Red rectangle depicts putative palmitoylation site present in all Gish isoforms except isoF. (C) and (D) Protein sequence alignments depicting conservation between Drosophila Gish isoforms and human CKIγ isoforms at the level of the kinase domain C-terminus (C) and putative palmitoylation (D). CKI sequences were aligned as indicated in Materials and methods. Numbers in parentheses indicated starting and ending aa residues of the depicted sequences. Blue indicates kinase domain sequence, whereas red denotes putative palmitoylation site.
Gish, the Drosophila orthologue of CkIγ interacts with Ex in a Crb-dependent manner.
(A) An AP-MS approach identified Gish as an Ex-interacting protein. Summary table with AP-MS results for Gish and Hpo. CG# denotes Flybase CG number, while unique and total denote the number of peptides detected in the MS analysis. (B) and (C) Crbintra promotes Ex:Gish binding in a FBM-dependent manner. Reciprocal co-IPs were performed with FLAG-tagged NTAN or Ex1-468 and HA-tagged Gish (B), or with FLAG-tagged NTAN or GishisoI and V5-tagged Ex1-468 CAAX (C), in the presence of Myc-tagged GFP, Crbintra or CrbΔFBM. The expression and presence of co-purified proteins were analysed by immunoblotting with the indicated antibodies. Asterisks denote non-specific bands (IgG heavy chain in IP panel and FLAG signal in Tubulin panel). Open and full circles denote absence or presence of the indicated plasmid, respectively. Tubulin was used as loading control. Note that experiments shown in (C) were performed in the presence of proteasome inhibitors.
Evolutionary conservation of CKIs and features of Gish.
(A) Phylogenetic relation between human and Drosophila CKI isoforms and other Drosophila kinases with >50% overall similarity to CkIα. (B) Domain structure of isoforms F and I of Gish. Red rectangle depicts putative palmitoylation site present in all Gish isoforms except isoF. (C) and (D) Protein sequence alignments depicting conservation between Drosophila Gish isoforms and human CKIγ isoforms at the level of the kinase domain C-terminus (C) and putative palmitoylation (D). CKI sequences were aligned as indicated in Materials and methods. Numbers in parentheses indicated starting and ending aa residues of the depicted sequences. Blue indicates kinase domain sequence, whereas red denotes putative palmitoylation site.We validated our AP-MS data by performing co-immunoprecipitation (co-IP) analyses in S2 cell lysates. In reciprocal co-IP experiments, an interaction between Gish and Ex1-468 was readily detected in S2 cells, specifically in the presence of wt Crb (Figure 1B–C). The Casein kinase 1 (CKI) protein family includes several members (Jiang, 2017), with high homology in their kinase domains (Figure 1—figure supplement 1A–C), which are thought to, at least in part, share consensus sequences and targets (Knippschild et al., 2014; Schittek and Sinnberg, 2014; Venerando et al., 2014). The Drosophila gish (CKIγ) locus produces multiple protein isoforms, one of which, GishisoF, lacks a conserved C-terminal palmitoylation motif (Figure 1—figure supplement 1B,D), which would be predicted to affect its localisation (Davidson et al., 2005; Li et al., 2016). Therefore, we used two different isoforms of Gish that either contain (GishisoI) or lack (GishisoF) this palmitoylation sequence. Interestingly, only GishisoI, but not GishisoF, was able to interact with Ex (Figure 1B) suggesting that CKI sub-cellular localisation may be critical to the regulation of Ex.
Figure 1—figure supplement 1.
Evolutionary conservation of CKIs and features of Gish.
(A) Phylogenetic relation between human and Drosophila CKI isoforms and other Drosophila kinases with >50% overall similarity to CkIα. (B) Domain structure of isoforms F and I of Gish. Red rectangle depicts putative palmitoylation site present in all Gish isoforms except isoF. (C) and (D) Protein sequence alignments depicting conservation between Drosophila Gish isoforms and human CKIγ isoforms at the level of the kinase domain C-terminus (C) and putative palmitoylation (D). CKI sequences were aligned as indicated in Materials and methods. Numbers in parentheses indicated starting and ending aa residues of the depicted sequences. Blue indicates kinase domain sequence, whereas red denotes putative palmitoylation site.
CKI kinases promote Ex phosphorylation and degradation in vitro
The CKI family commonly targets substrates for proteasomal degradation (Knippschild et al., 2014; Schittek and Sinnberg, 2014), prompting us to test if Gish could promote Ex degradation. To this end, we analysed Ex electrophoretic mobility shift and protein levels (indicative of phosphorylation and degradation, respectively) in S2 cells upon expression of different CKI kinases. Co-expression of Ex1-468 and GishisoI in the absence of Crb resulted in a mild depletion of Ex1-468 protein levels (Figure 2A), whereas GishisoF had no effect. We reasoned that the mild effect of GishisoI on Ex stability might be due to relatively low levels of Ex1-468 reaching the membrane in the absence of Crb, which is not endogenously expressed in S2 cells. To mimic the apical membrane localisation of endogenous Ex, we generated an Ex variant containing a C-terminal CAAX sequence (Sotillos et al., 2004), which targets Ex to cellular membranes (Ex1-468 CAAX). Importantly, this variant remains responsive to Crb (Figure 2B), and co-immunoprecipitates with Gish in a Crb-dependent manner (Figure 1C). Ex1-468 CAAX ran mostly as a single band in S2 cells in the presence of the CrbΔFBM mutant and, similar to wt Ex1-468, as a higher mobility band or doublet in the presence of wt Crb (Figure 2A–C). An electrophoretic mobility shift and depletion was also observed when Ex1-468 CAAX was co-expressed with GishisoI, but not with a kinase-dead version of Gish (GishKD) (Figure 2B and Figure 2—figure supplement 1A). Next, we tested whether two other CKI family members, CkIα and Dco (Drosophila CkIδ/ε orthologue), had a similar effect on Ex and whether this effect was dependent on their kinase activity. Indeed, co-expression of Ex1-468 CAAX or full-length (FL) Ex with wt GishisoI, CkIα or Dco led to Ex mobility shift and depletion, although their kinase-deficient (KD) versions did not (Figure 2C and Figure 2—figure supplement 1A–B). Together, these results suggest that multiple CKI family kinases can promote Ex phosphorylation and depletion.
Figure 2.
CKI kinases promote Ex phosphorylation and depletion.
(A) and (B) Gish promotes Ex phosphorylation and depletion in a kinase- and sub-cellular localisation-dependent manner. (A) S2 cells were used to co-transfect V5-tagged Ex1-468 with GFP and Crbintra, CrbΔFBM, GishisoI or GishisoF, for 48 hr before lysis. Lysates were processed for immunoblot analysis using the indicated antibodies. Note that GishisoI caused a more prominent depletion of Ex than GishisoF, the CkIγ isoform lacking a palmitoylation sequence. (B) FLAG-tagged Ex1-468 CAAX was co-transfected with the indicated plasmids for 48 hr and lysates were processed for Western blotting analysis with the indicated antibodies. Kinase-deficient (KD) GishisoI was unable to promote Ex1-468 CAAX phosphorylation and depletion. (C) CKI kinases promote Ex phosphorylation and depletion in a kinase-dependent manner. S2 cells were transfected with the indicated plasmids for 48 hr before lysis. Immunoblot analysis with the indicated antibodies revealed that CkIα and Dco promote Ex phosphorylation and depletion in a kinase-dependent manner, as the kinase-dead (KD) versions did not cause a mobility shift in Ex1-468 CAAX. (D) CKI kinases promote Ex degradation via S453. S2 cells were co-transfected with V5-tagged wt or S453A Ex1-468 CAAX and HA-tagged CkIα, Dco or GishisoI for 48 hr before lysis. Lysates were immunoblotted with the indicated antibodies. Unlike its wt counterpart, Ex1-468 S453A CAAX was refractory to the action of CKI kinases and was not degraded in the presence of the kinases. (E) Gish expression promotes Ex:Slmb binding in the absence of Crbintra. Co-IPs were performed with FLAG-tagged NTAN or Slmb and either V5-tagged Ex1-468 or Ex1-468 CAAX, in the presence of Crbintra, CrbΔFBM, GishisoI or GishisoF. Expression and presence of co-immunoprecipitated proteins was assessed by immunoblotting with the indicated antibodies. Note that, similar to Crbintra, GishisoI expression alone promoted the Ex:Slmb interaction. GFP and tubulin were used as transfection efficiency and loading controls, respectively. Asterisk denotes non-specific band (IgG heavy chain in IP panel).
(A) Expression of CKIs promotes depletion of Ex protein levels. Graph depicts results of quantification of Ex1-468 protein levels assessed by Western blotting analysis. Ex protein levels were quantified by densitometry analysis using ImageJ. Ex protein levels in all samples were normalised to the average of samples where Ex1-468 was co-expressed with the negative control CrbΔFBM, which does not promote Ex degradation. Box plots depict maximum to minimum values. *p<0.05, **p<0.01 (One-way ANOVA with Dunnett’s post hoc test). n.s. denotes non-significant. (B) Full-length Ex is phosphorylated and depleted in a CKI kinase-dependent manner. S2 cells were transfected with the indicated plasmids for 48 hr before lysis. Western blot analysis with the indicated antibodies revealed that CkIα, Dco and GishisoI promote Ex phosphorylation and depletion in a kinase-dependent manner, as the kinase-dead (KD) versions did not cause depletion of ExFL. (C) CKI kinases promote Ex:Slmb binding. FLAG-tagged GFP or Slmb were used to co-IP V5-tagged Ex1-468 CAAX in the presence of HA-tagged CkIα, Dco or GishisoI. Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. (D) An Ex truncation lacking the Slmb/β-TrCP consensus sequence is refractory to Gish-mediated changes. The electrophoretic mobility of FLAG- and CAAX-tagged Ex1-450 or Ex1-468 was assessed upon co-transfection with Crbintra, CrbΔFBM or GishisoI. Note that while Gish promotes a mobility shift in Ex1-468, the 1–450 construct was not affected. (E) Ectopic Sgg fails to promote the Ex:Slmb interaction. FLAG-tagged NTAN (N) or SlmbΔF-box were used to co-IP V5-tagged Ex1-468 in the presence of Crbintra, CrbΔFBM, and either wt Sgg, activated Sgg (SggAct) and inactive Sgg (SggKD). Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. Note that, unlike Crbintra, Sgg over-expression failed to promote the Ex:Slmb interaction. (F) Efficiency of Sgg RNAi sequences. S2 cells were transfected with the indicated plasmids 24 hr after treatment with lacZ or sgg RNAi. Protein expression was assessed by immunoblotting using the indicated antibodies. Note that sgg efficiently targets all isoforms, while sgg is more active toward SggisoK. (G) RNAi-mediated depletion of sgg does not affect Crb-induced Ex degradation. The levels of Ex1-468 were monitored in S2 cells co-transfected with Crbintra or CrbΔFBM, in the presence of control RNAi (lacZ) or RNAi targeting sgg. Asterisks denote non-specific bands (IgG heavy chain in IP panel, HA signal in Tubulin panel and FLAG signal in Myc panel). Tubulin was used as loading control.
Figure 2—figure supplement 1.
Molecular requirements for the effect of CKIs in the regulation of Ex protein stability.
(A) Expression of CKIs promotes depletion of Ex protein levels. Graph depicts results of quantification of Ex1-468 protein levels assessed by Western blotting analysis. Ex protein levels were quantified by densitometry analysis using ImageJ. Ex protein levels in all samples were normalised to the average of samples where Ex1-468 was co-expressed with the negative control CrbΔFBM, which does not promote Ex degradation. Box plots depict maximum to minimum values. *p<0.05, **p<0.01 (One-way ANOVA with Dunnett’s post hoc test). n.s. denotes non-significant. (B) Full-length Ex is phosphorylated and depleted in a CKI kinase-dependent manner. S2 cells were transfected with the indicated plasmids for 48 hr before lysis. Western blot analysis with the indicated antibodies revealed that CkIα, Dco and GishisoI promote Ex phosphorylation and depletion in a kinase-dependent manner, as the kinase-dead (KD) versions did not cause depletion of ExFL. (C) CKI kinases promote Ex:Slmb binding. FLAG-tagged GFP or Slmb were used to co-IP V5-tagged Ex1-468 CAAX in the presence of HA-tagged CkIα, Dco or GishisoI. Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. (D) An Ex truncation lacking the Slmb/β-TrCP consensus sequence is refractory to Gish-mediated changes. The electrophoretic mobility of FLAG- and CAAX-tagged Ex1-450 or Ex1-468 was assessed upon co-transfection with Crbintra, CrbΔFBM or GishisoI. Note that while Gish promotes a mobility shift in Ex1-468, the 1–450 construct was not affected. (E) Ectopic Sgg fails to promote the Ex:Slmb interaction. FLAG-tagged NTAN (N) or SlmbΔF-box were used to co-IP V5-tagged Ex1-468 in the presence of Crbintra, CrbΔFBM, and either wt Sgg, activated Sgg (SggAct) and inactive Sgg (SggKD). Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. Note that, unlike Crbintra, Sgg over-expression failed to promote the Ex:Slmb interaction. (F) Efficiency of Sgg RNAi sequences. S2 cells were transfected with the indicated plasmids 24 hr after treatment with lacZ or sgg RNAi. Protein expression was assessed by immunoblotting using the indicated antibodies. Note that sgg efficiently targets all isoforms, while sgg is more active toward SggisoK. (G) RNAi-mediated depletion of sgg does not affect Crb-induced Ex degradation. The levels of Ex1-468 were monitored in S2 cells co-transfected with Crbintra or CrbΔFBM, in the presence of control RNAi (lacZ) or RNAi targeting sgg. Asterisks denote non-specific bands (IgG heavy chain in IP panel, HA signal in Tubulin panel and FLAG signal in Myc panel). Tubulin was used as loading control.
CKI kinases promote Ex phosphorylation and depletion.
(A) and (B) Gish promotes Ex phosphorylation and depletion in a kinase- and sub-cellular localisation-dependent manner. (A) S2 cells were used to co-transfect V5-tagged Ex1-468 with GFP and Crbintra, CrbΔFBM, GishisoI or GishisoF, for 48 hr before lysis. Lysates were processed for immunoblot analysis using the indicated antibodies. Note that GishisoI caused a more prominent depletion of Ex than GishisoF, the CkIγ isoform lacking a palmitoylation sequence. (B) FLAG-tagged Ex1-468 CAAX was co-transfected with the indicated plasmids for 48 hr and lysates were processed for Western blotting analysis with the indicated antibodies. Kinase-deficient (KD) GishisoI was unable to promote Ex1-468 CAAX phosphorylation and depletion. (C) CKI kinases promote Ex phosphorylation and depletion in a kinase-dependent manner. S2 cells were transfected with the indicated plasmids for 48 hr before lysis. Immunoblot analysis with the indicated antibodies revealed that CkIα and Dco promote Ex phosphorylation and depletion in a kinase-dependent manner, as the kinase-dead (KD) versions did not cause a mobility shift in Ex1-468 CAAX. (D) CKI kinases promote Ex degradation via S453. S2 cells were co-transfected with V5-tagged wt or S453A Ex1-468 CAAX and HA-tagged CkIα, Dco or GishisoI for 48 hr before lysis. Lysates were immunoblotted with the indicated antibodies. Unlike its wt counterpart, Ex1-468 S453A CAAX was refractory to the action of CKI kinases and was not degraded in the presence of the kinases. (E) Gish expression promotes Ex:Slmb binding in the absence of Crbintra. Co-IPs were performed with FLAG-tagged NTAN or Slmb and either V5-tagged Ex1-468 or Ex1-468 CAAX, in the presence of Crbintra, CrbΔFBM, GishisoI or GishisoF. Expression and presence of co-immunoprecipitated proteins was assessed by immunoblotting with the indicated antibodies. Note that, similar to Crbintra, GishisoI expression alone promoted the Ex:Slmb interaction. GFP and tubulin were used as transfection efficiency and loading controls, respectively. Asterisk denotes non-specific band (IgG heavy chain in IP panel).
Molecular requirements for the effect of CKIs in the regulation of Ex protein stability.
(A) Expression of CKIs promotes depletion of Ex protein levels. Graph depicts results of quantification of Ex1-468 protein levels assessed by Western blotting analysis. Ex protein levels were quantified by densitometry analysis using ImageJ. Ex protein levels in all samples were normalised to the average of samples where Ex1-468 was co-expressed with the negative control CrbΔFBM, which does not promote Ex degradation. Box plots depict maximum to minimum values. *p<0.05, **p<0.01 (One-way ANOVA with Dunnett’s post hoc test). n.s. denotes non-significant. (B) Full-length Ex is phosphorylated and depleted in a CKI kinase-dependent manner. S2 cells were transfected with the indicated plasmids for 48 hr before lysis. Western blot analysis with the indicated antibodies revealed that CkIα, Dco and GishisoI promote Ex phosphorylation and depletion in a kinase-dependent manner, as the kinase-dead (KD) versions did not cause depletion of ExFL. (C) CKI kinases promote Ex:Slmb binding. FLAG-tagged GFP or Slmb were used to co-IP V5-tagged Ex1-468 CAAX in the presence of HA-tagged CkIα, Dco or GishisoI. Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. (D) An Ex truncation lacking the Slmb/β-TrCP consensus sequence is refractory to Gish-mediated changes. The electrophoretic mobility of FLAG- and CAAX-tagged Ex1-450 or Ex1-468 was assessed upon co-transfection with Crbintra, CrbΔFBM or GishisoI. Note that while Gish promotes a mobility shift in Ex1-468, the 1–450 construct was not affected. (E) Ectopic Sgg fails to promote the Ex:Slmb interaction. FLAG-tagged NTAN (N) or SlmbΔF-box were used to co-IP V5-tagged Ex1-468 in the presence of Crbintra, CrbΔFBM, and either wt Sgg, activated Sgg (SggAct) and inactive Sgg (SggKD). Expression and presence of co-purified proteins was detected by immunoblot analysis using the indicated antibodies. Note that, unlike Crbintra, Sgg over-expression failed to promote the Ex:Slmb interaction. (F) Efficiency of Sgg RNAi sequences. S2 cells were transfected with the indicated plasmids 24 hr after treatment with lacZ or sgg RNAi. Protein expression was assessed by immunoblotting using the indicated antibodies. Note that sgg efficiently targets all isoforms, while sgg is more active toward SggisoK. (G) RNAi-mediated depletion of sgg does not affect Crb-induced Ex degradation. The levels of Ex1-468 were monitored in S2 cells co-transfected with Crbintra or CrbΔFBM, in the presence of control RNAi (lacZ) or RNAi targeting sgg. Asterisks denote non-specific bands (IgG heavy chain in IP panel, HA signal in Tubulin panel and FLAG signal in Myc panel). Tubulin was used as loading control.The fact that Ex and Gish interact, and that CKI kinases stimulate Ex degradation in a kinase-dependent manner led us to examine if the CKIs act in the same pathway as Crb and Slmb. To test this, we co-expressed CkIα, Dco or GishisoI in S2 cells with either wt Ex1-468 CAAX or a variant carrying a mutation at S453 (Ex1-468 S453A CAAX), one of the crucial residues that mediates the interaction between Ex and Slmb (Ribeiro et al., 2014). All three kinases readily promoted the degradation of wt Ex1-468 CAAX (Figure 2D). However, the S453A mutant levels were largely unaffected by CKI isoforms, consistent with the notion that the CKI-mediated regulation of Ex stability is dependent on the ability of Ex to interact with Slmb via the phosphodegron surrounding S453. Interestingly, expression of CkIα or GishisoI resulted in the appearance of a slower-migrating Ex1-468 S453A band (Figure 2D). This suggests that, at least for CkIα and Gish, there may be alternative CKI phosphorylation sites in Ex1-468 besides S453.We also assessed whether CKI kinases could promote the Ex:Slmb interaction, which we have previously shown can be triggered by Crb over-expression (Ribeiro et al., 2014). We found that GishisoI, but not GishisoF, promoted the interaction between Ex1-468 CAAX and Slmb in the absence of ectopic Crb (Figure 2E), consistent with its ability to stimulate Ex mobility shift and depletion. CkIα and Dco were also able to induce binding between Ex1-468 CAAX and Slmb in the absence of Crb (Figure 2—figure supplement 1C). Dco consistently showed a weaker effect on Ex phosphorylation than the other two kinases. Our previous findings showed that the Crb-induced Ex:Slmb interaction relies on the region surrounding the β-TrCP consensus motif (aa 450–468 in Ex) (Ribeiro et al., 2014). Interestingly, an Ex truncation mutant lacking this domain (Ex1-450) was refractory to degradation, and did not display a mobility shift following GishisoI expression (Figure 2—figure supplement 1D), suggesting that CKIs act upstream of Slmb to promote Ex phosphorylation and degradation.β-TrCP substrates are often targeted for degradation by the sequential action of GSK3β and CKI kinases (e.g. β-catenin) (Gammons and Bienz, 2018). Thus, we tested if the Drosophila GSK3β orthologue Shaggy (Sgg) was involved in the regulation of Ex phosphorylation (Siegfried et al., 1992). However, we found that over-expression of Sgg did not promote Ex:Slmb binding (Figure 2—figure supplement 1E). Moreover, RNAi-mediated depletion of sgg did not abrogate Crb-induced Ex phosphorylation and degradation (Figure 2—figure supplement 1F–G). Together, our results indicate that the CKI kinases, but not Sgg, regulate Ex phosphorylation and stability, acting upstream of Slmb/β-TrCP.
CKI kinases promote Ex phosphorylation and degradation in vivo
Next, we wanted to validate our observations in developing Drosophila tissues. However, assessing Ex protein stability in vivo is complicated by the fact that ex is a Yki target gene (Hamaratoglu et al., 2006) and, therefore, its steady state protein levels reflect not only direct post-translational effects but also transcriptional inputs via the modulation of Hpo signalling. To directly study Ex stability in the absence of any confounding effects due to Yki-mediated transcriptional feedback, we generated transgenic flies carrying an Ex stability reporter construct consisting of Ex1-468 fused to GFP, whose expression is controlled by the ubiquitin 63E promoter rather than its endogenous promoter (ubi-Ex1-468::GFP). We also generated a mutant version that is refractory to Crb-induced degradation by mutating Ser 453, which mediates binding to Slmb (Ribeiro et al., 2014). As predicted, the ubi-Ex1-468::GFP reporters resemble endogenous Ex in that they are normally localised at the apical cortex of wing imaginal disc cells (Figure 3A,B,D,F and Figure 3—figure supplement 1A–B). Importantly, the in vivo reporters recapitulate the effect of Crb on Ex protein stability and localisation. In agreement with previous observations of ExFL, ubi-Ex1-468::GFP failed to localise to the apical surface in crb mutant tissue (Figure 3A–A’ and Figure 3—figure supplement 1A) and accumulated at the apical cortex in slmb mutant clones (Figure 3B–B’ and Figure 3—figure supplement 1B) (Chen et al., 2010; Hafezi et al., 2012; Ling et al., 2010; Robinson et al., 2010; Ribeiro et al., 2014). Loss of both crb and slmb led to accumulation of Ex1-468::GFP in the cytoplasm (Figure 3C–C’), suggesting that the Ex sensor can be degraded by SCFSlimb/β-TrCP in the cytoplasm, as had been suggested for endogenous Ex (Zhang et al., 2015). When a Crbintra transgene was expressed in the posterior compartment using the hedgehog-Gal4 driver (hh-Gal4), ubi-Ex1-468::GFP was lost from the apical surface and degraded (Figure 3D–E and Figure 3—figure supplement 1C). In contrast, the S453A mutant reporter accumulated upon Crbintra expression, presumably due to the fact that it cannot be recognised by Slmb and degraded (Figure 3F–G and Figure 3—figure supplement 1D). This re-localisation of Ex1-468 S453A mirrored the localisation of over-expressed Crbintra, which localised to the apical cortex as well as basal membranes (Figure 3—figure supplement 1E). It is therefore possible that Ex1-468 S453A is mislocalised to the basolateral membrane by ectopic Crb, where it cannot be degraded. A further advantage of using this N-terminal fragment as a reporter is that our constructs lack the Yki-binding PPxY motifs, and therefore, do not induce cell death and reduced tissue growth, as does full length Ex (Hamaratoglu et al., 2006; Badouel et al., 2009; Oh et al., 2009). Indeed, neither reporter affected wing size when expressed at low levels under the control of the ubi promoter (Figure 3—figure supplement 1F–I). In contrast, expression of full-length Ex under the control of en-Gal4 driver induced a reduction in tissue size (Figure 3—figure supplement 1J,L,P). This phenotype was partially rescued by co-expression of Crbintra, which we expect would promote increased turnover and degradation of Ex (Figure 3—figure supplement 1M,P). Interestingly, expression of the S453A mutant version of Ex resulted in a more severe undergrowth than wt Ex, and this was refractory to Crbintra co-expression, suggesting that Crb fails to regulate the levels of Ex when the residue that is recognised by Slmb/β-TrCP is mutated (Figure 3—figure supplement 1N–P).
Figure 3.
Crb-, Slmb- and CKI-mediated regulation of an in vivo Ex protein stability reporter.
(A–C) Crb and Slmb regulate localisation and in vivo levels of the ubi-Ex reporter. Confocal micrographs of transverse sections of wing imaginal discs from wandering third instar larvae containing clones mutant for crb (A), slmb (B), or doubly mutant for slmb and crb (C). Clones are marked by absence of RFP and highlighted by white dashed lines. The ubi-Ex reporter (green in A-C, grey in A’-C’) is lost from the apical cortex of crb clones, accumulates apically in slmb clones, and accumulates in the cytoplasm of slmb, crb clones. DAPI staining (blue) marks nuclei. (D–G) Effect of Crbintra on the in vivo Ex protein stability reporter. Confocal micrographs of transverse sections of wing discs from wandering third instar larvae expressing a wt (D and E) or a S453A mutant version of the ubi-Ex reporter (F and G) (green in D-G and grey in D’-G’), in the absence (D and F) or presence (E and G) of hh-Gal4-driven Crb over-expression. Ci immunostaining (red) indicates the anterior compartment, where hh is not expressed. DAPI nuclear staining is shown in blue. In the absence of Crbintra, both versions of the reporter localise at the apical surface. Expression of Crbintra causes depletion of the wt reporter, while it promotes mislocalisation of the S453A variant, in agreement with previously published data (Ribeiro et al., 2014). (H–K) Over-expression of CKI kinases promotes depletion of the Ex stability reporter. XY and transverse sections of third instar wing imaginal discs expressing ubi-Ex (green in H-J, grey in H’-J’) and either no transgene (H), UAS-ckIα (I) or UAS-gish (J) under the control of hh-Gal4. Ci immunostaining (anterior compartment, lacking hh expression) is shown in red. Expression of CkIα or Gish reduces the levels of the Ex in vivo stability reporter in vivo. (K) Quantification of the ratio between the levels of the ubi-Ex reporter in the posterior versus the anterior compartment in wing discs of the indicated genotypes (transgene expression driven by hh-Gal4 as in H-J). Data are shown in box (median and 25th-75th percentile) and whiskers (minimum to maximum) plots with all data points represented. n > 18 for all genotypes. Significance was assessed using a one-way ANOVA comparing all genotypes to w, with Dunnett’s multiple comparisons test. **, p<0.01; ***, p<0.001, ****, p<0.0001. n.s. non-significant. In XY sections, ventral is up, whereas apical is up in transverse sections. Scale bars, 10 μm in A-C and 20 μm in D-J.
(A) and (B) Crb and Slmb regulate localisation and levels of the ubi-Ex reporter. XY confocal micrograph of wing imaginal discs from wandering third instar larvae carrying clones mutant for crb (A) or slmb (B). Clones are marked by absence of RFP (grey in A and B). The Ex1-468::GFP in vivo reporter (grey in A’ and B’) is absent from the apical cortex of crb mutant cells and accumulates in slmb clones. Note that XY micrographs correspond to transverse images shown in Figure 3A and B, respectively. (C) and (D) Effect of Crbintra on the in vivo Ex protein stability reporters. XY confocal micrographs of wing discs expressing ubi-Ex (C) or ubi-Ex (D) in the presence of hh-Gal4-driven Crb. Tissues were stained with Ci and DAPI (red and blue, respectively), while green is direct GFP fluorescence. The wt version of the reporter is completely degraded in the presence of Crbintra, whereas the mutant version can still be partially seen at the apical surface but is mostly relocalised to internal membranes. (E) In vivo localisation of ectopic Crbintra. Transverse sections of third instar wing imaginal disc expressing UAS-crb under the control of hh-Gal4, stained for Crb (red in E and grey in E’) and DAPI (blue in E). Note that Crb spreads from the apical surface to internal membranes when Crbintra is over-expressed. (F–I) The Ex protein stability reporter does not overtly affect tissue growth in vivo. Compared with control adult wings (F), constitutive expression of ubi-Ex (G) or ubi-Ex (H) does not affect overall wing size. (I) Quantification of adult wing size. Data are represented as % of the average area of wt adult wings. Box (median and 25th-75th percentile) and whisker (minimum to maximum) plots depict the data, which includes all data points. n.s. denotes non-significant. (J–P) In vivo role of Ex S453 in the regulation of tissue growth. Shown are adult wings from flies raised at 18°C expressing the indicated transgenes in the posterior compartment of the wing under the control of en-Gal4. Compared to control adult wings expressing GFP (J), Crbintra-expressing wings were larger (K). In contrast, expression of full-length ExWT caused a size reduction (L), which was partially rescued by co-expression of Crbintra (M). Interestingly, expression of ExS453A resulted in a further reduction in wing size (N), which was refractory to Crbintra (O). (P) Quantification of adult wing size in flies expressing the indicated transgenes under the control of en-Gal4. Data are represented as % of the average of relative area of the posterior compartment of wt adult wings. Data is shown as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points represented. (Q) and (R) hh-Gal4-mediated over-expression of CKI kinases does not significantly alter apical levels of Crb or Ex1-468 S453A::GFP. Levels of endogenous Crb (Q) or apical Ex1-468 S453A::GFP (R) were quantified in wing imaginal discs expressing CKI kinases under the control of hh-Gal4. Shown are the ratios between the posterior and anterior levels. Data is represented in box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points indicated. n.s. denotes non-significant. Scale bars, 10 μm in A and B, and 20 μm in C-E.
Figure 3—figure supplement 1.
Characterisation of the Ex stability reporter and in vivo regulation of Ex stability and tissue growth.
(A) and (B) Crb and Slmb regulate localisation and levels of the ubi-Ex reporter. XY confocal micrograph of wing imaginal discs from wandering third instar larvae carrying clones mutant for crb (A) or slmb (B). Clones are marked by absence of RFP (grey in A and B). The Ex1-468::GFP in vivo reporter (grey in A’ and B’) is absent from the apical cortex of crb mutant cells and accumulates in slmb clones. Note that XY micrographs correspond to transverse images shown in Figure 3A and B, respectively. (C) and (D) Effect of Crbintra on the in vivo Ex protein stability reporters. XY confocal micrographs of wing discs expressing ubi-Ex (C) or ubi-Ex (D) in the presence of hh-Gal4-driven Crb. Tissues were stained with Ci and DAPI (red and blue, respectively), while green is direct GFP fluorescence. The wt version of the reporter is completely degraded in the presence of Crbintra, whereas the mutant version can still be partially seen at the apical surface but is mostly relocalised to internal membranes. (E) In vivo localisation of ectopic Crbintra. Transverse sections of third instar wing imaginal disc expressing UAS-crb under the control of hh-Gal4, stained for Crb (red in E and grey in E’) and DAPI (blue in E). Note that Crb spreads from the apical surface to internal membranes when Crbintra is over-expressed. (F–I) The Ex protein stability reporter does not overtly affect tissue growth in vivo. Compared with control adult wings (F), constitutive expression of ubi-Ex (G) or ubi-Ex (H) does not affect overall wing size. (I) Quantification of adult wing size. Data are represented as % of the average area of wt adult wings. Box (median and 25th-75th percentile) and whisker (minimum to maximum) plots depict the data, which includes all data points. n.s. denotes non-significant. (J–P) In vivo role of Ex S453 in the regulation of tissue growth. Shown are adult wings from flies raised at 18°C expressing the indicated transgenes in the posterior compartment of the wing under the control of en-Gal4. Compared to control adult wings expressing GFP (J), Crbintra-expressing wings were larger (K). In contrast, expression of full-length ExWT caused a size reduction (L), which was partially rescued by co-expression of Crbintra (M). Interestingly, expression of ExS453A resulted in a further reduction in wing size (N), which was refractory to Crbintra (O). (P) Quantification of adult wing size in flies expressing the indicated transgenes under the control of en-Gal4. Data are represented as % of the average of relative area of the posterior compartment of wt adult wings. Data is shown as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points represented. (Q) and (R) hh-Gal4-mediated over-expression of CKI kinases does not significantly alter apical levels of Crb or Ex1-468 S453A::GFP. Levels of endogenous Crb (Q) or apical Ex1-468 S453A::GFP (R) were quantified in wing imaginal discs expressing CKI kinases under the control of hh-Gal4. Shown are the ratios between the posterior and anterior levels. Data is represented in box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points indicated. n.s. denotes non-significant. Scale bars, 10 μm in A and B, and 20 μm in C-E.
Crb-, Slmb- and CKI-mediated regulation of an in vivo Ex protein stability reporter.
(A–C) Crb and Slmb regulate localisation and in vivo levels of the ubi-Ex reporter. Confocal micrographs of transverse sections of wing imaginal discs from wandering third instar larvae containing clones mutant for crb (A), slmb (B), or doubly mutant for slmb and crb (C). Clones are marked by absence of RFP and highlighted by white dashed lines. The ubi-Ex reporter (green in A-C, grey in A’-C’) is lost from the apical cortex of crb clones, accumulates apically in slmb clones, and accumulates in the cytoplasm of slmb, crb clones. DAPI staining (blue) marks nuclei. (D–G) Effect of Crbintra on the in vivo Ex protein stability reporter. Confocal micrographs of transverse sections of wing discs from wandering third instar larvae expressing a wt (D and E) or a S453A mutant version of the ubi-Ex reporter (F and G) (green in D-G and grey in D’-G’), in the absence (D and F) or presence (E and G) of hh-Gal4-driven Crb over-expression. Ci immunostaining (red) indicates the anterior compartment, where hh is not expressed. DAPI nuclear staining is shown in blue. In the absence of Crbintra, both versions of the reporter localise at the apical surface. Expression of Crbintra causes depletion of the wt reporter, while it promotes mislocalisation of the S453A variant, in agreement with previously published data (Ribeiro et al., 2014). (H–K) Over-expression of CKI kinases promotes depletion of the Ex stability reporter. XY and transverse sections of third instar wing imaginal discs expressing ubi-Ex (green in H-J, grey in H’-J’) and either no transgene (H), UAS-ckIα (I) or UAS-gish (J) under the control of hh-Gal4. Ci immunostaining (anterior compartment, lacking hh expression) is shown in red. Expression of CkIα or Gish reduces the levels of the Ex in vivo stability reporter in vivo. (K) Quantification of the ratio between the levels of the ubi-Ex reporter in the posterior versus the anterior compartment in wing discs of the indicated genotypes (transgene expression driven by hh-Gal4 as in H-J). Data are shown in box (median and 25th-75th percentile) and whiskers (minimum to maximum) plots with all data points represented. n > 18 for all genotypes. Significance was assessed using a one-way ANOVA comparing all genotypes to w, with Dunnett’s multiple comparisons test. **, p<0.01; ***, p<0.001, ****, p<0.0001. n.s. non-significant. In XY sections, ventral is up, whereas apical is up in transverse sections. Scale bars, 10 μm in A-C and 20 μm in D-J.
Characterisation of the Ex stability reporter and in vivo regulation of Ex stability and tissue growth.
(A) and (B) Crb and Slmb regulate localisation and levels of the ubi-Ex reporter. XY confocal micrograph of wing imaginal discs from wandering third instar larvae carrying clones mutant for crb (A) or slmb (B). Clones are marked by absence of RFP (grey in A and B). The Ex1-468::GFP in vivo reporter (grey in A’ and B’) is absent from the apical cortex of crb mutant cells and accumulates in slmb clones. Note that XY micrographs correspond to transverse images shown in Figure 3A and B, respectively. (C) and (D) Effect of Crbintra on the in vivo Ex protein stability reporters. XY confocal micrographs of wing discs expressing ubi-Ex (C) or ubi-Ex (D) in the presence of hh-Gal4-driven Crb. Tissues were stained with Ci and DAPI (red and blue, respectively), while green is direct GFP fluorescence. The wt version of the reporter is completely degraded in the presence of Crbintra, whereas the mutant version can still be partially seen at the apical surface but is mostly relocalised to internal membranes. (E) In vivo localisation of ectopic Crbintra. Transverse sections of third instar wing imaginal disc expressing UAS-crb under the control of hh-Gal4, stained for Crb (red in E and grey in E’) and DAPI (blue in E). Note that Crb spreads from the apical surface to internal membranes when Crbintra is over-expressed. (F–I) The Ex protein stability reporter does not overtly affect tissue growth in vivo. Compared with control adult wings (F), constitutive expression of ubi-Ex (G) or ubi-Ex (H) does not affect overall wing size. (I) Quantification of adult wing size. Data are represented as % of the average area of wt adult wings. Box (median and 25th-75th percentile) and whisker (minimum to maximum) plots depict the data, which includes all data points. n.s. denotes non-significant. (J–P) In vivo role of Ex S453 in the regulation of tissue growth. Shown are adult wings from flies raised at 18°C expressing the indicated transgenes in the posterior compartment of the wing under the control of en-Gal4. Compared to control adult wings expressing GFP (J), Crbintra-expressing wings were larger (K). In contrast, expression of full-length ExWT caused a size reduction (L), which was partially rescued by co-expression of Crbintra (M). Interestingly, expression of ExS453A resulted in a further reduction in wing size (N), which was refractory to Crbintra (O). (P) Quantification of adult wing size in flies expressing the indicated transgenes under the control of en-Gal4. Data are represented as % of the average of relative area of the posterior compartment of wt adult wings. Data is shown as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points represented. (Q) and (R) hh-Gal4-mediated over-expression of CKI kinases does not significantly alter apical levels of Crb or Ex1-468 S453A::GFP. Levels of endogenous Crb (Q) or apical Ex1-468 S453A::GFP (R) were quantified in wing imaginal discs expressing CKI kinases under the control of hh-Gal4. Shown are the ratios between the posterior and anterior levels. Data is represented in box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots, with all data points indicated. n.s. denotes non-significant. Scale bars, 10 μm in A and B, and 20 μm in C-E.We then analysed whether CKI over-expression could modulate levels of the Ex reporter. Indeed, when compared to control wing discs, expression of CkIα or Gish using hh-Gal4 resulted in a significant decrease in the levels of the reporter in the posterior compartment (Figure 3H–3K). This is consistent with our S2 cell results, and suggests that the CKI family kinases regulate Ex stability in vivo. However, this effect on Ex levels was not seen upon over-expression of either Dco or the poorly characterised CKI family member CG7094 (Figure 3K), indicating that not all CKIs modulate Ex stability in vivo. Importantly, the effect of CKIs on Ex is not due to changes in Crb levels (Figure 3—figure supplement 1Q), and is dependent on kinase activity, since a GishisoI kinase-deficient construct could not alter reporter levels (Figure 3K). In contrast, over-expression of CKIs did not alter the levels of the S453A mutant reporter (Figure 3—figure supplement 1R), providing further evidence that CKIs regulate Ex in a Slmb/β-TrCP-dependent manner.
CKI loss-of-function promotes stabilisation of Ex in vitro
Next, we sought to analyse loss-of-function phenotypes of the CKI kinases. Upon treatment of S2 cells with gish RNAi, Crbintra-mediated depletion of both Ex1-468 and ExFL was strongly reduced (Figure 4A–B and Figure 4—figure supplement 1A). We also attempted to deplete the other CKI kinases by RNAi. However, we were unable to generate a dsRNA that specifically targeted dco (Figure 4—figure supplement 1B). To overcome this, we used RNAi sequences that targeted only ckIα ("ckIα”) or all CKIs (ckIα, dco and gish, termed "ckI", previously used in Liu et al. (2002) (Figure 4—figure supplement 1B). In line with our previous data, knockdown of ckIα or gish alone resulted in robust stabilisation of Ex1-468 in the presence of Crbintra (Figure 4C). It is noteworthy that depleting all CKIs resulted in a more prominent stabilisation of Ex1-468, suggesting that CkIα and Gish work together to regulate Ex stability (Figure 4C).
Figure 4.
CkIα and Gish are required for Crb-induced Ex degradation.
(A) and (B) RNAi-mediated depletion of gish abrogates Crb-induced Ex degradation. FLAG-tagged Ex1-468 (A) or V5-tagged ExFL (B) were co-expressed with Crbintra or CrbΔFBM, in the presence of dsRNA targeting lacZ (control) or gish. Lysates were processed for immunoblot analysis using the indicated antibodies. In both cases, gish depletion blocked Ex degradation induced by Crbintra expression. (C) CKI kinase knockdown blocks Ex degradation induced by expression of Crbintra. S2 cells treated with dsRNA targeting lacZ or CKI kinases were co-transfected with FLAG-tagged Ex1-468 and GFP, Crbintra or CrbΔFBM. Immunoblot analysis of lysates using the indicated antibodies revealed that depleting ckIα and gish alone or all CKIs (ckI) dramatically impaired the ability of Crbintra to promote Ex1-468 degradation. (D) Crb requires CKI kinase function to promote Ex:Slmb binding. Co-IPs were performed between FLAG-tagged GFP or SlmbΔF-box and V5-tagged Ex1-468 in the presence of Crbintra or CrbΔFBM and depletion of lacZ or CKI kinases. Lysates were analysed by immunoblot using the indicated antibodies for detection of protein expression and co-purification. Note that depletion of all CKIs or gish prevented the Ex:Slmb interaction induced by Crbintra. (E) and (F) CKI kinases are required for Crbintra-induced Ex ubiquitylation. S2 cells were treated with the indicated dsRNAs for 24 hr before transfection with the indicated constructs. Following lysis under denaturing conditions, ubiquitylated proteins were isolated using anti-HA antibodies. The presence of Ex and Crbintra was assessed with the indicated antibodies. Knockdown of gish (E and F) or of all CKIs with ckI RNAi (F) significantly reduced Ex ubiquitylation, similar to depletion of slmb. GFP was used as transfection efficiency control. Tubulin was used as loading control. Open and full circles denote absence or presence of the indicated plasmid, respectively. Asterisks denote non-specific bands (IgG heavy chain in IP panels).
(A) Validation of gish RNAi tools. S2 cells were treated with the indicated dsRNA 24 hr before transfection with the indicated constructs. Expression of FLAG-tagged Gish and RNAi efficiency were assessed by immunoblot analysis of lysates using the indicated antibodies. Note that gish RNAi efficiently targets all tested isoforms. (B) Validation of CKI kinase RNAi efficiency. S2 cells were treated with dsRNAs 24 hr before co-transfection with the indicated constructs. RNAi specificity and efficiency were analysed by Western blotting using the indicated antibodies. Note that both ckIα and gish dsRNA were specific for their respective targets, while dco RNAi was unable to target dco. Treating cells with the ckI dsRNA revealed that this RNAi targets all CKI kinases. (C) aPKC-mediated phosphorylation of Crb does not modulate the ability of Crb to promote Ex degradation. The stability of FLAG-tagged Ex1-468 (wt or S453A mutant) was assessed by Western blotting with the indicated antibodies in lysates from cells co-transfected with CrbFL or Crb4A mut (which carries mutations in putative aPKC phosphorylation sites). Crb plasmids were under the control of a UAS promoter and, therefore, expression was controlled by Gal4. Note that Crb4A mut is equally adept in promoting Ex1-468 degradation as wt CrbFL. (D) Crb-mediated degradation of Ex supersedes Wts-mediated regulation of a C-terminal Slmb/β-TrCP phosphodegron. The protein stability of V5-tagged full-length Ex (ExFL) was monitored after co-transfection with FLAG-tagged Wts, in the presence or absence of CrbFL or Crbintra. S2 cells were lysed 48 hr after transfection and lysates were processed for immunoblot analysis using the indicated antibodies. In agreement with previous results (Zhang et al., 2015), expression of Wts resulted in the stabilisation of ExFL. However, when ExFL was co-expressed with both Wts and either CrbFL or Crbintra, it was efficiently degraded, and levels were indistinguishable from those seen when ExFL was co-expressed with CrbFL or Crbintra alone. GFP was used as transfection efficiency control. Asterisk denotes non-specific band (FLAG non-specific band present in S2 cell lysates). Tubulin was used as loading control. Open and full circles denote the absence and presence of the indicated plasmid, respectively.
Figure 4—figure supplement 1.
Role of CKI kinases and alternative kinases in the regulation of Ex stability.
(A) Validation of gish RNAi tools. S2 cells were treated with the indicated dsRNA 24 hr before transfection with the indicated constructs. Expression of FLAG-tagged Gish and RNAi efficiency were assessed by immunoblot analysis of lysates using the indicated antibodies. Note that gish RNAi efficiently targets all tested isoforms. (B) Validation of CKI kinase RNAi efficiency. S2 cells were treated with dsRNAs 24 hr before co-transfection with the indicated constructs. RNAi specificity and efficiency were analysed by Western blotting using the indicated antibodies. Note that both ckIα and gish dsRNA were specific for their respective targets, while dco RNAi was unable to target dco. Treating cells with the ckI dsRNA revealed that this RNAi targets all CKI kinases. (C) aPKC-mediated phosphorylation of Crb does not modulate the ability of Crb to promote Ex degradation. The stability of FLAG-tagged Ex1-468 (wt or S453A mutant) was assessed by Western blotting with the indicated antibodies in lysates from cells co-transfected with CrbFL or Crb4A mut (which carries mutations in putative aPKC phosphorylation sites). Crb plasmids were under the control of a UAS promoter and, therefore, expression was controlled by Gal4. Note that Crb4A mut is equally adept in promoting Ex1-468 degradation as wt CrbFL. (D) Crb-mediated degradation of Ex supersedes Wts-mediated regulation of a C-terminal Slmb/β-TrCP phosphodegron. The protein stability of V5-tagged full-length Ex (ExFL) was monitored after co-transfection with FLAG-tagged Wts, in the presence or absence of CrbFL or Crbintra. S2 cells were lysed 48 hr after transfection and lysates were processed for immunoblot analysis using the indicated antibodies. In agreement with previous results (Zhang et al., 2015), expression of Wts resulted in the stabilisation of ExFL. However, when ExFL was co-expressed with both Wts and either CrbFL or Crbintra, it was efficiently degraded, and levels were indistinguishable from those seen when ExFL was co-expressed with CrbFL or Crbintra alone. GFP was used as transfection efficiency control. Asterisk denotes non-specific band (FLAG non-specific band present in S2 cell lysates). Tubulin was used as loading control. Open and full circles denote the absence and presence of the indicated plasmid, respectively.
CkIα and Gish are required for Crb-induced Ex degradation.
(A) and (B) RNAi-mediated depletion of gish abrogates Crb-induced Ex degradation. FLAG-tagged Ex1-468 (A) or V5-tagged ExFL (B) were co-expressed with Crbintra or CrbΔFBM, in the presence of dsRNA targeting lacZ (control) or gish. Lysates were processed for immunoblot analysis using the indicated antibodies. In both cases, gish depletion blocked Ex degradation induced by Crbintra expression. (C) CKI kinase knockdown blocks Ex degradation induced by expression of Crbintra. S2 cells treated with dsRNA targeting lacZ or CKI kinases were co-transfected with FLAG-tagged Ex1-468 and GFP, Crbintra or CrbΔFBM. Immunoblot analysis of lysates using the indicated antibodies revealed that depleting ckIα and gish alone or all CKIs (ckI) dramatically impaired the ability of Crbintra to promote Ex1-468 degradation. (D) Crb requires CKI kinase function to promote Ex:Slmb binding. Co-IPs were performed between FLAG-tagged GFP or SlmbΔF-box and V5-tagged Ex1-468 in the presence of Crbintra or CrbΔFBM and depletion of lacZ or CKI kinases. Lysates were analysed by immunoblot using the indicated antibodies for detection of protein expression and co-purification. Note that depletion of all CKIs or gish prevented the Ex:Slmb interaction induced by Crbintra. (E) and (F) CKI kinases are required for Crbintra-induced Ex ubiquitylation. S2 cells were treated with the indicated dsRNAs for 24 hr before transfection with the indicated constructs. Following lysis under denaturing conditions, ubiquitylated proteins were isolated using anti-HA antibodies. The presence of Ex and Crbintra was assessed with the indicated antibodies. Knockdown of gish (E and F) or of all CKIs with ckI RNAi (F) significantly reduced Ex ubiquitylation, similar to depletion of slmb. GFP was used as transfection efficiency control. Tubulin was used as loading control. Open and full circles denote absence or presence of the indicated plasmid, respectively. Asterisks denote non-specific bands (IgG heavy chain in IP panels).
Role of CKI kinases and alternative kinases in the regulation of Ex stability.
(A) Validation of gish RNAi tools. S2 cells were treated with the indicated dsRNA 24 hr before transfection with the indicated constructs. Expression of FLAG-tagged Gish and RNAi efficiency were assessed by immunoblot analysis of lysates using the indicated antibodies. Note that gish RNAi efficiently targets all tested isoforms. (B) Validation of CKI kinase RNAi efficiency. S2 cells were treated with dsRNAs 24 hr before co-transfection with the indicated constructs. RNAi specificity and efficiency were analysed by Western blotting using the indicated antibodies. Note that both ckIα and gish dsRNA were specific for their respective targets, while dco RNAi was unable to target dco. Treating cells with the ckI dsRNA revealed that this RNAi targets all CKI kinases. (C) aPKC-mediated phosphorylation of Crb does not modulate the ability of Crb to promote Ex degradation. The stability of FLAG-tagged Ex1-468 (wt or S453A mutant) was assessed by Western blotting with the indicated antibodies in lysates from cells co-transfected with CrbFL or Crb4A mut (which carries mutations in putative aPKC phosphorylation sites). Crb plasmids were under the control of a UAS promoter and, therefore, expression was controlled by Gal4. Note that Crb4A mut is equally adept in promoting Ex1-468 degradation as wt CrbFL. (D) Crb-mediated degradation of Ex supersedes Wts-mediated regulation of a C-terminal Slmb/β-TrCP phosphodegron. The protein stability of V5-tagged full-length Ex (ExFL) was monitored after co-transfection with FLAG-tagged Wts, in the presence or absence of CrbFL or Crbintra. S2 cells were lysed 48 hr after transfection and lysates were processed for immunoblot analysis using the indicated antibodies. In agreement with previous results (Zhang et al., 2015), expression of Wts resulted in the stabilisation of ExFL. However, when ExFL was co-expressed with both Wts and either CrbFL or Crbintra, it was efficiently degraded, and levels were indistinguishable from those seen when ExFL was co-expressed with CrbFL or Crbintra alone. GFP was used as transfection efficiency control. Asterisk denotes non-specific band (FLAG non-specific band present in S2 cell lysates). Tubulin was used as loading control. Open and full circles denote the absence and presence of the indicated plasmid, respectively.As the CKI kinases appear to act downstream of Crb to regulate Ex stability, we also assessed if their depletion could affect the ability of Crb to promote Ex:Slmb binding and, consequently, Slmb-mediated Ex ubiquitylation and degradation. Indeed, the interaction between Ex and Slmb was abolished when gish or when all CKIs were depleted by RNAi (Figure 4D). When we monitored Crb-induced Ex ubiquitylation, we observed that this was dramatically reduced when gish or all CKIs were depleted by RNAi (Figure 4E–F). Indeed, knocking-down CKIs had a similar effect to depletion of slmb, part of the Ex E3 ligase complex activated downstream of Crb (Figure 4E). These data suggest that CKI kinases act downstream of Crb to promote the interaction of Ex with Slmb, thereby stimulating Ex ubiquitylation and degradation.Phosphorylation of Crb by aPKC has been proposed to influence its function and, therefore might contribute to the regulation of Ex (Ribeiro et al., 2014; Sotillos et al., 2004). To test this, we compared the effect of wt Crb to that of a variant of Crb containing point mutations in the putative aPKC phosphorylation sites (Crb4A mut). Similar to wt Crb, Crb4A mut efficiently promoted Ex degradation (Figure 4—figure supplement 1C), suggesting that aPKC phosphorylation is not required for the regulation of Ex downstream of Crb. A previous report has shown that, in addition to the N-terminal Slmb/β-TrCP degron, there is a C-terminal degron in Ex, which is inhibited by Wts-mediated phosphorylation (Zhang et al., 2015). To investigate whether Wts plays a role in Crb-mediated Ex degradation, we co-expressed ExFL with either CrbFL or Crbintra, in the presence or absence of ectopic Wts (Figure 4—figure supplement 1D). Though our data confirm that Wts can stabilise ExFL, we observed that the presence of Wts did not prevent the degradation of Ex mediated by the expression of Crb, indicating that the N-terminal degron supersedes the C-terminal one when Crb triggers Ex degradation (Figure 4—figure supplement 1D).
Clonal analysis of CKI mutants
As CKI loss-of-function in S2 cells resulted in Ex stabilisation, we next aimed to validate these observations in vivo. When we assessed the levels of the ubi-Ex1-468::GFP reporter in third instar wing imaginal discs carrying clones mutant for existing gish (gish) or dco (dco) alleles, we observed no differences from control cells, suggesting that these kinases are not essential for maintaining Ex levels at steady state in vivo (Figure 5A and Figure 5—figure supplement 1A). We observed occasional gish adult escapers, leading us to hypothesise that this allele is hypomorphic. Therefore, we generated a new gish mutant (bearing a premature termination codon at the N-terminal part of the kinase domain), as well as a mutant for the poorly characterised CKI family member CG7094, which is also expressed in imaginal discs (Brown et al., 2014) using CRISPR/Cas9 gene editing (Figure 5—figure supplement 1B–C). However, when we generated FRT clones for these new alleles, neither caused a change in ubi-Ex1-468::GFP levels compared to wt tissue (Figure 5B and Figure 5—figure supplement 1D). In contrast, we observed that the ubi-Ex1-468::GFP reporter was elevated in ckIα clones (Figure 5C). We noticed that apical levels of Crb were also increased in ckIα clones (Figure 5—figure supplement 1E). This was not due to a general increase in apical domain size, since levels of another apical protein, aPKC, did not increase in ckIα clones (Figure 5—figure supplement 1F–G).
Figure 5.
Loss of function of ckIα, but not gish or dco, modulates levels of an Ex protein stability reporter in vivo.
(A) dco mutant clones do not affect the Ex in vivo stability reporter. XY (A, A’) and transverse sections (A’’, A’’’) of ubi-Ex-expressing third instar wing imaginal discs containing dco mutant clones (marked by absence of RFP and highlighted by white dashed lines), showing direct fluorescence from GFP (green in A’’ and grey in A’ and A’’’) or RFP (red in A’’ and grey in A), and DAPI staining (blue). (B) gish mutant clones do not affect Ex1-468::GFP levels. XY (B, B’) and transverse sections (B’’, B’’’) of a third instar wing imaginal disc expressing ubi-Ex (green in B’’ and grey in B’ and B’’’) and carrying gish mutant clones (marked by absence of RFP and highlighted by white dashed lines) stained with DAPI (blue). (C) ckIα loss-of-function induces higher levels of Ex1-468::GFP. XY (C, C’) and transverse sections (C’’, C’’’) of third instar wing imaginal discs expressing ubi-Ex and carrying ckIα mutant clones (marked by absence of RFP and highlighted by white dashed lines). GFP reporter is shown in green (C’’) or grey (C’, C’’’). RFP fluorescence is shown in red (C’’) or grey (C) and the nuclear marker DAPI is shown in blue. (D–F) Over-expression of Ex1-468 or loss of slmb function induce higher apical levels of endogenous Crb. Shown are XY (D, D’) and transverse sections (D’’, D’’’, E, E’, F and F’) of third instar wing imaginal discs expressing UAS-Ex under the control of hh-Gal4 (D), or carrying loss-of-function clones for the β-TrCP alleles slmb (E) or slmb (F). GFP marks hh-Gal4-expressing domain in D, while absence of GFP expression marks slmb mutant clones in E and F (both highlighted by white dashed lines). Crb staining is shown in red (D–F and D’’) or grey (D’–F’ and D’’’) and the nuclear marker DAPI is shown in blue. Dorsal and apical are up in XY and transverse sections, respectively. Scale bars, 20 μm.
(A) gish mutant clones do not affect Ex1-468::GFP levels. XY (A and A’) and transverse (A’’ and A’’’) confocal micrographs of third instar wing discs carrying gish mutant clones (marked by absence of RFP). GFP fluorescence is shown as grey (A’ and A’’’) or green (A’’), RFP is shown as grey (A) or red (A’’), and DAPI staining is shown in blue. (B) and (C) Schematic representation of CRISPR/Cas9-mediated strategies used to generate novel mutant alleles for gish (B) and CG7094 (C). Shown are the gene structures for each gene (coding sequence is depicted by grey rectangles, while white rectangles depict 5’ and 3’ UTR sequences), the targets for CRISPR gRNA sequences (indicated by red arrows), the sequencing results from mutant alleles confirming the mutation generated (large truncation for gish and early frameshift and truncation for CG7094) and a schematic depiction of the wt and predicted protein in the respective mutants. (D) CG7094 mutant clones do not affect Ex1-468::GFP levels. XY (D and D’) and transverse (D’’ and D’’’) confocal micrographs of third instar wing discs carrying CG7094 mutant clones (marked by absence of RFP). GFP reporter is shown in grey (D’ and D’’’) or green (D’’), RFP fluorescence is shown in grey (D) or red (D’’) and DAPI staining is shown in blue. (E) ckIα mutant clones have increased apical levels of Crb. XY (E and E’) and transverse (E’’ and E’’’) confocal micrographs of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines) and immunostained for Crb (grey in E’ and E’’’ and green in E’’). RFP is in grey (E) or red (E’’) and DAPI is shown in blue. (F) Apical levels of aPKC are unchanged in ckIα mutant clones. XY (F–F’’) and transverse (Ff-Ff’’) sections of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines, (F and Ff) showing ubi-Ex1-468::GFP direct fluorescence (F’ and Ff’) and stained for aPKC (F’’ and Ff’’). (G) Quantification of aPKC levels in discs carrying ckIα mutant clones. aPKC levels are not significantly different between ckIα mutant clones and surrounding wt tissue. Data are represented as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plot, with all data points shown. (H) Combined loss-of-function of CG7094, gish and dco does not affect the levels of the in vivo Ex protein stability reporter. XY (H and H’) and transverse (H’’ and H’’’) confocal micrographs of third instar wing discs carrying CG7094, gish and dco triple mutant clones (marked by absence of RFP, grey in H and red in H’’) and stained for DAPI (blue). GFP reporter fluorescence is shown in grey (H’ and H’’’) or green (H’’). (I) Combined loss-of-function of ckIα, gish and dco increases Ex1-468::GFP and Crb levels. Transverse confocal micrographs of third instar wing discs containing ckIα, gish and dco triple mutant clones (marked by absence of RFP; red in I) and stained for Crb (grey in I’’) and DAPI (blue in I). Shown are images of direct fluorescence of GFP (green in I and grey in I’). n.s. denotes non-significant. Scale bars, 20 μm in E, F, H and I, and 10 μm in A and D.
(A–F) Slmb and CkIα regulate levels of the ubi-Ex reporter in leg and haltere discs, but not eye discs. Confocal micrographs of transverse sections of eye (posterior to the morphogenetic furrow, (A and D), leg (B and E) and haltere (C and F) discs from wandering third instar larvae containing clones mutant for slmb (A–C) or ckIα (D–F). The ubi-Ex reporter is shown in green (A–F) or grey (A’–F’). Clones are marked by absence of RFP (red) and highlighted by white dashed lines, and DAPI staining (blue) marks nuclei. Loss of slmb or ckIα in eye discs results in clone extrusion (A and D), and accumulation of the ubi-Ex reporter at the apical cortex in leg (B and E) and haltere (C and F) discs. Scale bars, 20 μm.
Figure 5—figure supplement 1.
In vivo clonal analysis of the role of CKI kinases in the regulation of the Ex stability reporter.
(A) gish mutant clones do not affect Ex1-468::GFP levels. XY (A and A’) and transverse (A’’ and A’’’) confocal micrographs of third instar wing discs carrying gish mutant clones (marked by absence of RFP). GFP fluorescence is shown as grey (A’ and A’’’) or green (A’’), RFP is shown as grey (A) or red (A’’), and DAPI staining is shown in blue. (B) and (C) Schematic representation of CRISPR/Cas9-mediated strategies used to generate novel mutant alleles for gish (B) and CG7094 (C). Shown are the gene structures for each gene (coding sequence is depicted by grey rectangles, while white rectangles depict 5’ and 3’ UTR sequences), the targets for CRISPR gRNA sequences (indicated by red arrows), the sequencing results from mutant alleles confirming the mutation generated (large truncation for gish and early frameshift and truncation for CG7094) and a schematic depiction of the wt and predicted protein in the respective mutants. (D) CG7094 mutant clones do not affect Ex1-468::GFP levels. XY (D and D’) and transverse (D’’ and D’’’) confocal micrographs of third instar wing discs carrying CG7094 mutant clones (marked by absence of RFP). GFP reporter is shown in grey (D’ and D’’’) or green (D’’), RFP fluorescence is shown in grey (D) or red (D’’) and DAPI staining is shown in blue. (E) ckIα mutant clones have increased apical levels of Crb. XY (E and E’) and transverse (E’’ and E’’’) confocal micrographs of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines) and immunostained for Crb (grey in E’ and E’’’ and green in E’’). RFP is in grey (E) or red (E’’) and DAPI is shown in blue. (F) Apical levels of aPKC are unchanged in ckIα mutant clones. XY (F–F’’) and transverse (Ff-Ff’’) sections of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines, (F and Ff) showing ubi-Ex1-468::GFP direct fluorescence (F’ and Ff’) and stained for aPKC (F’’ and Ff’’). (G) Quantification of aPKC levels in discs carrying ckIα mutant clones. aPKC levels are not significantly different between ckIα mutant clones and surrounding wt tissue. Data are represented as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plot, with all data points shown. (H) Combined loss-of-function of CG7094, gish and dco does not affect the levels of the in vivo Ex protein stability reporter. XY (H and H’) and transverse (H’’ and H’’’) confocal micrographs of third instar wing discs carrying CG7094, gish and dco triple mutant clones (marked by absence of RFP, grey in H and red in H’’) and stained for DAPI (blue). GFP reporter fluorescence is shown in grey (H’ and H’’’) or green (H’’). (I) Combined loss-of-function of ckIα, gish and dco increases Ex1-468::GFP and Crb levels. Transverse confocal micrographs of third instar wing discs containing ckIα, gish and dco triple mutant clones (marked by absence of RFP; red in I) and stained for Crb (grey in I’’) and DAPI (blue in I). Shown are images of direct fluorescence of GFP (green in I and grey in I’). n.s. denotes non-significant. Scale bars, 20 μm in E, F, H and I, and 10 μm in A and D.
Loss of function of ckIα, but not gish or dco, modulates levels of an Ex protein stability reporter in vivo.
(A) dco mutant clones do not affect the Ex in vivo stability reporter. XY (A, A’) and transverse sections (A’’, A’’’) of ubi-Ex-expressing third instar wing imaginal discs containing dco mutant clones (marked by absence of RFP and highlighted by white dashed lines), showing direct fluorescence from GFP (green in A’’ and grey in A’ and A’’’) or RFP (red in A’’ and grey in A), and DAPI staining (blue). (B) gish mutant clones do not affect Ex1-468::GFP levels. XY (B, B’) and transverse sections (B’’, B’’’) of a third instar wing imaginal disc expressing ubi-Ex (green in B’’ and grey in B’ and B’’’) and carrying gish mutant clones (marked by absence of RFP and highlighted by white dashed lines) stained with DAPI (blue). (C) ckIα loss-of-function induces higher levels of Ex1-468::GFP. XY (C, C’) and transverse sections (C’’, C’’’) of third instar wing imaginal discs expressing ubi-Ex and carrying ckIα mutant clones (marked by absence of RFP and highlighted by white dashed lines). GFP reporter is shown in green (C’’) or grey (C’, C’’’). RFP fluorescence is shown in red (C’’) or grey (C) and the nuclear marker DAPI is shown in blue. (D–F) Over-expression of Ex1-468 or loss of slmb function induce higher apical levels of endogenous Crb. Shown are XY (D, D’) and transverse sections (D’’, D’’’, E, E’, F and F’) of third instar wing imaginal discs expressing UAS-Ex under the control of hh-Gal4 (D), or carrying loss-of-function clones for the β-TrCP alleles slmb (E) or slmb (F). GFP marks hh-Gal4-expressing domain in D, while absence of GFP expression marks slmb mutant clones in E and F (both highlighted by white dashed lines). Crb staining is shown in red (D–F and D’’) or grey (D’–F’ and D’’’) and the nuclear marker DAPI is shown in blue. Dorsal and apical are up in XY and transverse sections, respectively. Scale bars, 20 μm.
In vivo clonal analysis of the role of CKI kinases in the regulation of the Ex stability reporter.
(A) gish mutant clones do not affect Ex1-468::GFP levels. XY (A and A’) and transverse (A’’ and A’’’) confocal micrographs of third instar wing discs carrying gish mutant clones (marked by absence of RFP). GFP fluorescence is shown as grey (A’ and A’’’) or green (A’’), RFP is shown as grey (A) or red (A’’), and DAPI staining is shown in blue. (B) and (C) Schematic representation of CRISPR/Cas9-mediated strategies used to generate novel mutant alleles for gish (B) and CG7094 (C). Shown are the gene structures for each gene (coding sequence is depicted by grey rectangles, while white rectangles depict 5’ and 3’ UTR sequences), the targets for CRISPR gRNA sequences (indicated by red arrows), the sequencing results from mutant alleles confirming the mutation generated (large truncation for gish and early frameshift and truncation for CG7094) and a schematic depiction of the wt and predicted protein in the respective mutants. (D) CG7094 mutant clones do not affect Ex1-468::GFP levels. XY (D and D’) and transverse (D’’ and D’’’) confocal micrographs of third instar wing discs carrying CG7094 mutant clones (marked by absence of RFP). GFP reporter is shown in grey (D’ and D’’’) or green (D’’), RFP fluorescence is shown in grey (D) or red (D’’) and DAPI staining is shown in blue. (E) ckIα mutant clones have increased apical levels of Crb. XY (E and E’) and transverse (E’’ and E’’’) confocal micrographs of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines) and immunostained for Crb (grey in E’ and E’’’ and green in E’’). RFP is in grey (E) or red (E’’) and DAPI is shown in blue. (F) Apical levels of aPKC are unchanged in ckIα mutant clones. XY (F–F’’) and transverse (Ff-Ff’’) sections of third instar wing discs containing ckIα mutant clones (marked by absence of RFP and outlined with dashed lines, (F and Ff) showing ubi-Ex1-468::GFP direct fluorescence (F’ and Ff’) and stained for aPKC (F’’ and Ff’’). (G) Quantification of aPKC levels in discs carrying ckIα mutant clones. aPKC levels are not significantly different between ckIα mutant clones and surrounding wt tissue. Data are represented as box (median, 25th-75th percentile) and whiskers (minimum to maximum) plot, with all data points shown. (H) Combined loss-of-function of CG7094, gish and dco does not affect the levels of the in vivo Ex protein stability reporter. XY (H and H’) and transverse (H’’ and H’’’) confocal micrographs of third instar wing discs carrying CG7094, gish and dco triple mutant clones (marked by absence of RFP, grey in H and red in H’’) and stained for DAPI (blue). GFP reporter fluorescence is shown in grey (H’ and H’’’) or green (H’’). (I) Combined loss-of-function of ckIα, gish and dco increases Ex1-468::GFP and Crb levels. Transverse confocal micrographs of third instar wing discs containing ckIα, gish and dco triple mutant clones (marked by absence of RFP; red in I) and stained for Crb (grey in I’’) and DAPI (blue in I). Shown are images of direct fluorescence of GFP (green in I and grey in I’). n.s. denotes non-significant. Scale bars, 20 μm in E, F, H and I, and 10 μm in A and D.
Role of Slmb and CkIα in regulating an in vivo Ex protein stability reporter in eye, leg and haltere discs.
(A–F) Slmb and CkIα regulate levels of the ubi-Ex reporter in leg and haltere discs, but not eye discs. Confocal micrographs of transverse sections of eye (posterior to the morphogenetic furrow, (A and D), leg (B and E) and haltere (C and F) discs from wandering third instar larvae containing clones mutant for slmb (A–C) or ckIα (D–F). The ubi-Ex reporter is shown in green (A–F) or grey (A’–F’). Clones are marked by absence of RFP (red) and highlighted by white dashed lines, and DAPI staining (blue) marks nuclei. Loss of slmb or ckIα in eye discs results in clone extrusion (A and D), and accumulation of the ubi-Ex reporter at the apical cortex in leg (B and E) and haltere (C and F) discs. Scale bars, 20 μm.It is possible that the increase in Ex levels in ckIα clones is the result of an increase in Crb within the clones, causing enhanced recruitment of Ex to the apical cortex, rather than an effect on Ex stability. Alternatively, increased Ex levels as a result of its stabilisation in ckIα clones might in turn lead to increased membrane retention or stabilisation of Crb. If this were the case, increasing Ex dosage should increase Crb levels. Indeed, over-expression of UAS-Ex1-468 led to a robust increase in endogenous Crb at the apical membrane (Figure 5D). We had previously reported that clones mutant for the hypomorphic allele slmb showed elevated levels of Ex, but not Crb (Ribeiro et al., 2014). However, upon careful examination, we were able to detect increased Crb levels in slmb clones, albeit mainly when these clones were large (Figure 5E). Furthermore, mutant clones for a null allele, slmb, displayed a clear increase in Crb levels (Figure 5F). Thus, both slmb and ckIα mutant clones display elevated levels of Ex and Crb.Since our S2 cell data suggested that several members of the CKI family may regulate Ex redundantly (Figure 4C), we generated triple mutant clones lacking CG7094, gish and dco, but these did not have altered levels of the Ex1-468::GFP reporter (Figure 5—figure supplement 1H). Triple mutant clones for ckIα, gish and dco had elevated Ex and Crb levels (Figure 5—figure supplement 1I), but these were comparable to ckIα clones alone (Figure 5C and Figure 5—figure supplement 1E–F). Thus, in vivo, it does not appear that CKI family members function redundantly to control Ex levels, at least in wing discs under normal developmental conditions. To test whether the regulation of Ex levels by Slmb and CkIα occurs in tissues other than the wing disc, we generated mutant clones in the eye, leg and haltere imaginal discs (Figure 5—figure supplement 2). In the eye disc, loss of either slmb (Figure 5—figure supplement 2A–A’) or ckIα (Figure 5—figure supplement 2D–D’) led to a strong clone extrusion phenotype and a loss of ommatidial differentiation posterior to the morphogenetic furrow. We did not observe a strong elevation of the Ex::GFP reporter in these mutant clones. However, as the Ex::GFP signal was most prominent in the apical domain of the ommatidial units, it is difficult to conclude if Slmb and CkIα regulate Ex stability in the absence of differentiated ommatidia in the mutant tissue. In contrast, Ex::GFP levels were elevated in both slmb (Figure 5—figure supplement 2B–C’) or ckIα (Figure 6E–6F’) mutant clones in the leg and haltere discs. The requirement for Slmb and CkIα to regulate Ex levels therefore varies according to the tissue.
Figure 5—figure supplement 2.
Role of Slmb and CkIα in regulating an in vivo Ex protein stability reporter in eye, leg and haltere discs.
(A–F) Slmb and CkIα regulate levels of the ubi-Ex reporter in leg and haltere discs, but not eye discs. Confocal micrographs of transverse sections of eye (posterior to the morphogenetic furrow, (A and D), leg (B and E) and haltere (C and F) discs from wandering third instar larvae containing clones mutant for slmb (A–C) or ckIα (D–F). The ubi-Ex reporter is shown in green (A–F) or grey (A’–F’). Clones are marked by absence of RFP (red) and highlighted by white dashed lines, and DAPI staining (blue) marks nuclei. Loss of slmb or ckIα in eye discs results in clone extrusion (A and D), and accumulation of the ubi-Ex reporter at the apical cortex in leg (B and E) and haltere (C and F) discs. Scale bars, 20 μm.
Figure 6.
RNAi-mediated depletion of ckIα, but not gish, suppresses Crbintra-induced degradation of an in vivo Ex protein stability reporter.
(A) and (B) ckIα knockdown has a minimal effect on Ex levels.(C) and (D) ckIα RNAi blocks Crbintra-mediated depletion of Ex. (E–H) gish RNAi-mediated depletion does not significantly affect in vivo Ex1-468::GFP levels in the absence or presence of Crbintra. XY and transverse sections of third instar wing imaginal discs containing ubi-Ex, in which hh-Gal4 was used to drive expression of UAS-ckIα alone (A and B), UAS-ckIα and UAS-Crb (C and D), UAS-gish alone (E and F) or UAS-gish and UAS-Crb (G and H). Temporal control of Gal4 activity was achieved with a tub-Gal80 transgene, raising the larvae at 25°C and shifting them to 29°C for the indicated times. ubi-Ex is shown in green (A–H and A’’–H’’) or grey (A’–H’ and A’’’–H’’’). Ci immunostaining (red) indicates anterior compartment where transgenes are not expressed. DAPI (blue) stains nuclei. Ventral and apical are up in XY and transverse sections, respectively. Scale bars, 20 μm.
(A) Temporally-controlled expression of Crbintra promotes Ex1-468::GFP degradation in vivo. XY (A, A’, Aa and Aa’) and transverse sections (A’’, A’’’, Aa’’ and Aa’’’) of third instar wing imaginal discs expressing ubi-Ex and UAS-Crb for 24 hr (A) or 48 hr (Aa) under the control of hh-Gal4 and tub-Gal80. The reporter is shown in green (A, A’’, Aa and Aa’’) or grey (A’, A’’’, Aa’ and Aa’’’). Discs were stained for Ci (red) and DAPI (blue). Note that Ex1-468::GFP is lost from the hh-Gal4-expressing compartment (marked by absence of Ci expression) within 24 hr. (B) Quantification of ratio between the levels of Ex1-468::GFP in the posterior versus anterior compartment. Data for 0 hr, 24 hr and 48 hr after Gal80 inactivation are represented in blue, yellow and red, respectively. Data are shown as interleaved box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots. *, p<0.05; ****, p<0.0001. n.s. denotes non-significant. (C) and (D) In vivo depletion of dco does not modulate Ex1-468::GFP levels in the absence or presence or Crbintra. Confocal micrographs of third instar wing discs expressing ubi-Ex and UAS-dco alone (C) or in combination with UAS-Crb (D), under the control of hh-Gal4. Tissues were stained with Ci (red). Note that there are no differences in Ex1-468::GFP levels when dco was depleted by RNAi (C) and that dco was not sufficient to block Crbintra-mediated Ex degradation (D). (E–H) MARCM clone analysis of the effect of loss-of-function of CKI kinases on Crb-mediated Ex degradation. XY (E–H and E’–H’) and transverse confocal micrograph sections (E’’–H’’ and E’’’–H’’’) of wing imaginal discs expressing ubi-Ex and carrying MARCM clones expressing Crb in FRT82B blank clones (E), gish mutant clones (F), FRT19A blank clones (G) or ckIα mutant clones. Clones are marked by the presence of GFP (grey in E-H and green in E’’-H’’). mScarlet fluorescence is shown in grey (E’–H’) or red (E’’–H’’), whereas DAPI nuclear staining is shown in blue. Note that loss of ckIα partially rescues the apical levels of Ex in the presence of Crbintra. Scale bars, 20 μm.
RNAi-mediated depletion of ckIα, but not gish, suppresses Crbintra-induced degradation of an in vivo Ex protein stability reporter.
(A) and (B) ckIα knockdown has a minimal effect on Ex levels.(C) and (D) ckIα RNAi blocks Crbintra-mediated depletion of Ex. (E–H) gish RNAi-mediated depletion does not significantly affect in vivo Ex1-468::GFP levels in the absence or presence of Crbintra. XY and transverse sections of third instar wing imaginal discs containing ubi-Ex, in which hh-Gal4 was used to drive expression of UAS-ckIα alone (A and B), UAS-ckIα and UAS-Crb (C and D), UAS-gish alone (E and F) or UAS-gish and UAS-Crb (G and H). Temporal control of Gal4 activity was achieved with a tub-Gal80 transgene, raising the larvae at 25°C and shifting them to 29°C for the indicated times. ubi-Ex is shown in green (A–H and A’’–H’’) or grey (A’–H’ and A’’’–H’’’). Ci immunostaining (red) indicates anterior compartment where transgenes are not expressed. DAPI (blue) stains nuclei. Ventral and apical are up in XY and transverse sections, respectively. Scale bars, 20 μm.
Analysis of the effect of RNAi-mediated depletion and clonal mutation of CKI kinases in the regulation of Crbintra-induced Ex degradation.
(A) Temporally-controlled expression of Crbintra promotes Ex1-468::GFP degradation in vivo. XY (A, A’, Aa and Aa’) and transverse sections (A’’, A’’’, Aa’’ and Aa’’’) of third instar wing imaginal discs expressing ubi-Ex and UAS-Crb for 24 hr (A) or 48 hr (Aa) under the control of hh-Gal4 and tub-Gal80. The reporter is shown in green (A, A’’, Aa and Aa’’) or grey (A’, A’’’, Aa’ and Aa’’’). Discs were stained for Ci (red) and DAPI (blue). Note that Ex1-468::GFP is lost from the hh-Gal4-expressing compartment (marked by absence of Ci expression) within 24 hr. (B) Quantification of ratio between the levels of Ex1-468::GFP in the posterior versus anterior compartment. Data for 0 hr, 24 hr and 48 hr after Gal80 inactivation are represented in blue, yellow and red, respectively. Data are shown as interleaved box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots. *, p<0.05; ****, p<0.0001. n.s. denotes non-significant. (C) and (D) In vivo depletion of dco does not modulate Ex1-468::GFP levels in the absence or presence or Crbintra. Confocal micrographs of third instar wing discs expressing ubi-Ex and UAS-dco alone (C) or in combination with UAS-Crb (D), under the control of hh-Gal4. Tissues were stained with Ci (red). Note that there are no differences in Ex1-468::GFP levels when dco was depleted by RNAi (C) and that dco was not sufficient to block Crbintra-mediated Ex degradation (D). (E–H) MARCM clone analysis of the effect of loss-of-function of CKI kinases on Crb-mediated Ex degradation. XY (E–H and E’–H’) and transverse confocal micrograph sections (E’’–H’’ and E’’’–H’’’) of wing imaginal discs expressing ubi-Ex and carrying MARCM clones expressing Crb in FRT82B blank clones (E), gish mutant clones (F), FRT19A blank clones (G) or ckIα mutant clones. Clones are marked by the presence of GFP (grey in E-H and green in E’’-H’’). mScarlet fluorescence is shown in grey (E’–H’) or red (E’’–H’’), whereas DAPI nuclear staining is shown in blue. Note that loss of ckIα partially rescues the apical levels of Ex in the presence of Crbintra. Scale bars, 20 μm.In S2 cells, depletion of gish or ckIα resulted in Ex stabilisation in the presence of Crb (Figure 4A–C). We hypothesised that over-expressing Crb in vivo would accelerate Ex turnover, thereby providing a sensitised background to examine the effects of CKI depletion. To circumvent the pleiotropic effects of long-term knockdown in imaginal disc epithelial cells, we expressed ckIα or gish in the absence or presence of Crbintra using hh-Gal4, and controlled the expression temporally (for 24 hr or 48 hr) using tub-Gal80 (Figure 6). Quantifications for these data are presented in Figure 6—figure supplement 1B. Expression of Crbintra caused depletion of all apical ubi-Ex1-468::GFP in the posterior compartment within 24 hr (Figure 6—figure supplement 1A). Expression of either ckIα (Figure 6A–B) or gish (Figure 6E–F) alone had little effect on ubi-Ex1-468::GFP expression in the posterior compartment (Figure 6—figure supplement 1B). However, co-expression of ckIα (Figure 6C–D), but not gish (Figure 6G–H), with Crbintra resulted in a significant rescue of levels and localisation of the ubi-Ex1-468::GFP reporter compared to Crbintra alone (Figure 6—figure supplement 1A–B). Thus, ckIα knockdown, but not gish knockdown, is able to inhibit Crb-mediated Ex degradation in vivo. dco had no effect on Ex::GFP reporter levels in the absence (Figure 6—figure supplement 1C), or presence of Crbintra (Figure 6—figure supplement 1D). We confirmed these findings using the MARCM technique, and observed that Crbintra-expressing, GFP-marked MARCM clones caused complete loss of apical ubi-Ex1-468::mScarlet (Figure 6—figure supplement 1E,G). gish MARCM clones expressing Crbintra resembled Crbintra MARCM clones alone (loss of the apical Ex reporter) (Figure 6—figure supplement 1F). In contrast, removing ckIα resulted in a partial rescue of Crb-induced Ex degradation, with a proportion of mutant cells retaining ubi-Ex1-468::mScarlet apically (Figure 6—figure supplement 1H). Together, these results suggest that, in vivo, CkIα regulates Ex stability by promoting Crb-induced turnover.
Figure 6—figure supplement 1.
Analysis of the effect of RNAi-mediated depletion and clonal mutation of CKI kinases in the regulation of Crbintra-induced Ex degradation.
(A) Temporally-controlled expression of Crbintra promotes Ex1-468::GFP degradation in vivo. XY (A, A’, Aa and Aa’) and transverse sections (A’’, A’’’, Aa’’ and Aa’’’) of third instar wing imaginal discs expressing ubi-Ex and UAS-Crb for 24 hr (A) or 48 hr (Aa) under the control of hh-Gal4 and tub-Gal80. The reporter is shown in green (A, A’’, Aa and Aa’’) or grey (A’, A’’’, Aa’ and Aa’’’). Discs were stained for Ci (red) and DAPI (blue). Note that Ex1-468::GFP is lost from the hh-Gal4-expressing compartment (marked by absence of Ci expression) within 24 hr. (B) Quantification of ratio between the levels of Ex1-468::GFP in the posterior versus anterior compartment. Data for 0 hr, 24 hr and 48 hr after Gal80 inactivation are represented in blue, yellow and red, respectively. Data are shown as interleaved box (median, 25th-75th percentile) and whiskers (minimum to maximum) plots. *, p<0.05; ****, p<0.0001. n.s. denotes non-significant. (C) and (D) In vivo depletion of dco does not modulate Ex1-468::GFP levels in the absence or presence or Crbintra. Confocal micrographs of third instar wing discs expressing ubi-Ex and UAS-dco alone (C) or in combination with UAS-Crb (D), under the control of hh-Gal4. Tissues were stained with Ci (red). Note that there are no differences in Ex1-468::GFP levels when dco was depleted by RNAi (C) and that dco was not sufficient to block Crbintra-mediated Ex degradation (D). (E–H) MARCM clone analysis of the effect of loss-of-function of CKI kinases on Crb-mediated Ex degradation. XY (E–H and E’–H’) and transverse confocal micrograph sections (E’’–H’’ and E’’’–H’’’) of wing imaginal discs expressing ubi-Ex and carrying MARCM clones expressing Crb in FRT82B blank clones (E), gish mutant clones (F), FRT19A blank clones (G) or ckIα mutant clones. Clones are marked by the presence of GFP (grey in E-H and green in E’’-H’’). mScarlet fluorescence is shown in grey (E’–H’) or red (E’’–H’’), whereas DAPI nuclear staining is shown in blue. Note that loss of ckIα partially rescues the apical levels of Ex in the presence of Crbintra. Scale bars, 20 μm.
An increase in Ex stability at the apical plasma membrane would be expected to lead to decreased Yki activity upon ckIα loss (Fulford et al., 2018). In fact, slmb depletion in the posterior wing disc leads to downregulation of the Yki transcriptional reporter ex-lacZ and increased Yki nuclear exclusion (Zhang et al., 2015). Levels of both ex-lacZ and diap1-GFP3.5, a Yki-responsive fragment of the diap1 promoter (Zhang et al., 2008) were markedly decreased in ckIα mutant wing disc clones (Figure 7A,C), while ex-lacZ was not affected in gish mutant tissue (Figure 7B). Furthermore, we used a Yki-GFP knock-in line (Fletcher et al., 2018) to show that Yki is excluded from the nucleus in ckIα mutant cells compared with neighbouring wild type tissue (Figure 7D). Finally, overexpression of CkIα, but not Gish, in the posterior compartment of the wing disc increased Yki activity as measured by ex-lacZ levels (Figure 7E–H). Thus, loss of ckIα leads to Ex stabilisation correlated with decreased Yki activity, while its overexpression has the opposite effect, consistent with a role for CkIα in promoting Yki activity via the control of Ex stability.
Figure 7.
Effect of CkIα and Gish loss- and gain-of-function on Yki target gene expression.
(A–D) Yki transcriptional activity is reduced by loss of ckIα, but unaffected by loss of gish. XY and XZ confocal images of third instar wing imaginal discs bearing clones mutant for ckIα (A, C, D), or gish (B), co-expressing the Yki transcriptional reporter genes ex-lacZ (A, B), diap1-GFP3.5 (C), or a Yki::GFP fusion protein (a knock-in at the endogenous locus, (D). ex-lacZ is visualised by immunostaining for β-galactosidase (green in A, A’’, B and B’’, grey in A’, (A’’’, B’ and B’’’); diap1-GFP and Yki::GFP are visualised by direct GFP fluorescence (green in C, C’’ and D, grey in C’, (C’’’ and D’). Clones are marked by absence of RFP (red) and highlighted by white dashed lines; DAPI (blue) stains nuclei. Reporter gene expression is drastically reduced in ckIα (A, C), but not gish (B), mutant clones. Yki::GFP appears excluded from the nucleus of ckIα mutant cells (D). Scale bars 20 μm. (E–H) Overexpression of CkIα, but not GishisoI, results in upregulation of ex-lacZ. Maximum intensity projections of z-stacks of the pouch region of wing imaginal discs from third instar larvae overexpressing no transgene (E), UAS-CkIα (F), or UAS-Gish (G) under the control of hh-Gal4. Crosses were raised at 25 °C and larvae were dissected at wandering L3 stage. ex-lacZ expression was detected by immunostaining for β-galactosidase (red in E-G, grey in E’-G’); the posterior compartment is marked by expression of GFP (green); DAPI (blue) stains nuclei. (H) Quantification of the posterior to anterior ratio of ex-lacZ signal intensity in the pouch region; CkIα expression significantly upregulates this Yki target gene (p=0.0001, one-way ANOVA comparing all means to hh >control, with correction for multiple comparisons; n ≥ 8 for all genotypes), while GishisoI does not (p=0.4808). Scale bars 20 μm.
Effect of CkIα and Gish loss- and gain-of-function on Yki target gene expression.
(A–D) Yki transcriptional activity is reduced by loss of ckIα, but unaffected by loss of gish. XY and XZ confocal images of third instar wing imaginal discs bearing clones mutant for ckIα (A, C, D), or gish (B), co-expressing the Yki transcriptional reporter genes ex-lacZ (A, B), diap1-GFP3.5 (C), or a Yki::GFP fusion protein (a knock-in at the endogenous locus, (D). ex-lacZ is visualised by immunostaining for β-galactosidase (green in A, A’’, B and B’’, grey in A’, (A’’’, B’ and B’’’); diap1-GFP and Yki::GFP are visualised by direct GFP fluorescence (green in C, C’’ and D, grey in C’, (C’’’ and D’). Clones are marked by absence of RFP (red) and highlighted by white dashed lines; DAPI (blue) stains nuclei. Reporter gene expression is drastically reduced in ckIα (A, C), but not gish (B), mutant clones. Yki::GFP appears excluded from the nucleus of ckIα mutant cells (D). Scale bars 20 μm. (E–H) Overexpression of CkIα, but not GishisoI, results in upregulation of ex-lacZ. Maximum intensity projections of z-stacks of the pouch region of wing imaginal discs from third instar larvae overexpressing no transgene (E), UAS-CkIα (F), or UAS-Gish (G) under the control of hh-Gal4. Crosses were raised at 25 °C and larvae were dissected at wandering L3 stage. ex-lacZ expression was detected by immunostaining for β-galactosidase (red in E-G, grey in E’-G’); the posterior compartment is marked by expression of GFP (green); DAPI (blue) stains nuclei. (H) Quantification of the posterior to anterior ratio of ex-lacZ signal intensity in the pouch region; CkIα expression significantly upregulates this Yki target gene (p=0.0001, one-way ANOVA comparing all means to hh >control, with correction for multiple comparisons; n ≥ 8 for all genotypes), while GishisoI does not (p=0.4808). Scale bars 20 μm.
Discussion
Ex was one of the first identified upstream regulators of the Hippo pathway (Hamaratoglu et al., 2006) and functions as a growth suppressor in Drosophila (Fulford et al., 2018). In agreement with its key role in growth control, it is increasingly evident that Ex is tightly regulated, both at the transcriptional level via Yki itself (Hamaratoglu et al., 2006) and through its subcellular localisation and stability (Chen et al., 2010; Ling et al., 2010; Robinson et al., 2010; Su et al., 2017; Ribeiro et al., 2014; Zhang et al., 2015; Ma et al., 2017). Crb recruits Ex to its site of activity at the apical plasma membrane, but also limits its apical levels by triggering Ex turnover via Slmb/β-TrCP, ensuring the fine-tuning of Yki activity (Chen et al., 2010; Ling et al., 2010; Robinson et al., 2010; Ribeiro et al., 2014; Zhang et al., 2015). Slmb can also promote the degradation of Ex in the cytoplasm in a Crb-independent manner (Zhang et al., 2015, Figure 3C and C’). Another ubiquitin ligase, Plenty of SH3s (POSH) has also been implicated in Ex degradation in parallel to Slmb (Ma et al., 2018). Since our data indicate that Ex levels are not sensitive to Slmb in the eye imaginal disc (Figure 5—figure supplement 2), it is possible POSH is the dominant Ex regulator in this tissue. Interestingly, recent work indicates that the Fat atypical cadherin, a major upstream branch of Hippo signalling (Bennett and Harvey, 2006; Cho et al., 2006; Silva et al., 2006; Willecke et al., 2006) also influences Ex stability by apically recruiting the adaptor Dlish/Vamana (Misra and Irvine, 2016; Wang et al., 2019; Zhang et al., 2016). Dlish binds the Ex C-terminus via its SH3 domain and promotes the Slmb:Ex association, thereby increasing Ex turnover (Wang et al., 2019). Thus, Ex functions as a hub in Hippo signalling that receives input from both the Crb and the Fat branches of upstream signalling.However, recognition by Slmb/β-TrCP requires substrate phosphorylation, which had remained an unexplored aspect of Ex regulation. Here, we provide evidence that the CKI family of kinases and, in particular, CkIα and Gish, act downstream of Crb to promote phosphorylation of Ex, in turn allowing binding to Slmb/β-TrCP and Ex ubiquitylation and degradation. In conditions whereby Crb-mediated turnover of Ex is active, such as through Crbintra expression, loss of ckIα (and gish in cell culture) inhibited Ex degradation (Figure 4A–C and Figure 6C–D). In the absence of CKI function, Crb is unable to trigger Ex:Slmb binding and thus can no longer induce Ex degradation (Figure 4D–F). In agreement with the requirement for Slmb/β-TrCP function, Ex degradation is dependent on phosphorylation and the presence of a β-TrCP consensus site (452TSGIVS457), which is phosphorylated to allow the interaction to occur (Ribeiro et al., 2014). Our data indicate that CKIs mediate Ex phosphorylation downstream of Crb, as the effect of CKIs on Ex stability is dependent on their kinase activity (Figure 2B–C, Figure 2—figure supplement 1A–B and Figure 3K) and mutation of a conserved residue in the Slmb/β-TrCP consensus (S453A) rendered Ex insensitive to degradation induced by Crb, CKIs or Slmb (Ribeiro et al., 2014) (Figures 3G and 2D). Interestingly, CkIα and Gish were still able to induce a mobility shift in Ex when the S453 residue was mutated (Figure 2D), suggesting that other residues besides S453 may be targets of CKI-mediated phosphorylation. An Ex truncation lacking residues 450–468 (Ex1-450) fails to undergo a mobility shift in the presence of Crbintra or Gish (Figure 2—figure supplement 1D). This may indicate that the additional residues targeted by CKI are in this region, or simply that CKI needs these residues to dock onto Ex.It remains to be determined whether phosphorylation at additional sites besides S453 is required to promote Ex:Slmb binding, and whether CKIs are part of a phospho-priming mechanism that involves additional kinases, as commonly seen for other CKI targets, such as β-catenin downstream of Wnt signalling (Liu et al., 2002; Amit et al., 2002; Jiang and Struhl, 1998; Stamos and Weis, 2013; Winston et al., 1999). In the case of β-catenin, CK1α acts as a priming kinase for GSK3β/Sgg; however, our data suggest that Sgg does not affect Ex stability (Figure 2—figure supplement 1E–G). Wts/LATS is another candidate, since mammalian LATS1/2 act as priming kinases for CK1δ/ε to target YAP for degradation by SCFβ-TrCP(Zhao et al., 2010). However, Wts has been suggested to stabilise Ex through phosphorylation at S1116, rather than promote its degradation (Zhang et al., 2015). Furthermore, Crb-dependent Ex degradation appears to override Wts-mediated stabilisation (Zhang et al., 2015 and Figure 4—figure supplement 1D). The potential involvement of other kinases in Ex/Slmb binding therefore remains an open question.An unexpected aspect of our results is the fact that, in cultured S2 cells, Gish (CKIγ) depletion has a strong effect on Ex stability (Figure 4A–C), while CkIα appears to be the dominant player in the wing imaginal disc, both in the presence (Figure 6C–D) and absence (Figure 5C) of Crbintra expression. This is surprising, since Crb-induced Ex phosphorylation and ubiquitylation presumably occurs at the apical plasma membrane, where Gish is known to be localised (Morin et al., 2001). This is unlikely to be due to a lack of Gish activity, since it is implicated in several signalling pathways in the wing disc (Li et al., 2016; Gault et al., 2012). However, CKI isoforms are known to exist in distinct subcellular pools associated with components of the signalling pathways they regulate (Jiang, 2017; Knippschild et al., 2014). It is therefore possible that recruitment of CkIα to Crb/Ex may involve an adaptor protein expressed in the wing disc, as is the case for CkIε, which requires the DEAD-box RNA helicase DDX3 to phosphorylate Dishevelled2 in the mammalian Wnt pathway (Cruciat et al., 2013).As Ex apical accumulation is predicted to antagonise Yki, we measured several readouts of Yki-dependent transcription and found that Yki activity is indeed decreased upon ckIα depletion and increased by CkIα overexpression, while Gish manipulations had no such effect (Figure 7A–C,E–H). ckIα mutations would therefore be predicted to reduce tissue growth by reducing Yki activity. However, we observed that ckIα mutant clones are generally overgrown, round, and tend to delaminate from the wing disc epithelium, so that they often do not contribute to the adult wing (Figure 5C and Figure 7A,C). This overgrowth phenotype is due to a strong elevation of Wingless (Wg) signalling in ckIα mutant tissue (Legent et al., 2012) and is very similar to the loss of two Wg antagonists, axin and APC1/2 (Adenomatous Polyposis Coli) (Muñoz-Descalzo et al., 2011). Thus, it is likely that the decreased growth occurring as a result of partial loss of Yki activity in ckIα mutant clones is compensated by a strong increase in Wg signalling.Our data also revealed that loss of either ckIα or slmb function results in an increase in the apical levels of Crb as well as Ex (Figure 5E–F and Figure 5—figure supplement 1E). This is not due to a general increase in apical domain size, since aPKC is not affected (Figure 5—figure supplement 1F–G). These observations raise two possibilities; either that Crb stability is regulated by the same mechanism as Ex, or that Crb and Ex can affect each other’s apical localisation. It seems unlikely that Crb is co-degraded with Ex in a Slmb/β-TrCP-dependent manner, since Crb lacks clear β-TrCP and CKI consensus sequences in its intracellular domain. Moreover, it has been previously shown that Crb levels increase in ex mutant clones (Chen et al., 2010), a result not easily reconcilable with co-degradation. Instead, we favour the second possibility, in which excess Ex accumulation leads to increased Crb apical levels. Consistent with this idea, over-expression of Ex1-468 leads to a robust increase in apical Crb (Figure 5D). Apical Crb endocytosis occurs through docking of the AP-2 (adaptor-protein 2) complex member α-adaptin, which competes with Stardust to bind the Crb intracellular domain (Lin et al., 2015). It is therefore possible that excess Ex interferes with Crb recognition by α-adaptin, thereby decreasing Crb internalisation rates in ckIα or slmb mutant clones.CRB3, the mammalian orthologue of Crb, can regulate Hippo signalling by mechanisms analogous to those described in Drosophila. CRB3 interacts with two proposed orthologues of Ex, Angiomotin (AMOT), and FRMD6, in a density-dependent manner (Varelas et al., 2010; Angus et al., 2012; Mao et al., 2018; Moleirinho et al., 2013). It would therefore be interesting to test if the stability of either AMOT or FRMD6 is regulated by CRB3, CKI and β-TrCP. In summary, our data support a model whereby the apical polarity determinant Crb promotes Ex phosphorylation by CKI family kinases, which in turn stimulates Slmb/β-TrCP-mediated ubiquitylation and degradation. We propose that this mechanism facilitates precise and dynamic control of Ex protein levels at the apical membrane, which is crucial for the regulation of Hippo signalling.
Materials and methods
Drosophila cell culture, expression constructs and chemical treatments
Work involved the use of the Drosophila cell line Schneider S2 (RRID:CVCL_Z232). Cells were obtained from the ATCC and mycoplasma testing revealed no contaminations. Drosophila S2 cells were grown in Drosophila Schneider’s medium (Thermo Fisher Scientific) supplemented with 10% (v/v) FBS, 50 μg/mL penicillin and 50 μg/mL streptomycin. Expression plasmids were transfected using Effectene transfection reagent (QIAGEN). Expression plasmids were generated using Gateway technology (Thermo Fisher Scientific). ORFs were PCR amplified from cDNA clones obtained from the Drosophila Genomics Resource Center (DGRC, https://dgrc.cgb.indiana.edu/vectors/Overview) and cloned into Entry vectors (pDONR207, pDONR-Zeo). Vectors from the Drosophila Gateway Vector Collection and an in-house V5 tag expression vector were used as destination vectors (Ribeiro et al., 2014). All Entry vectors were verified by sequencing. Point mutations were generated using the Quikchange Site-Directed Mutagenesis kit (Agilent). The Ex full length, Ex1-468 and Crbintra plasmids were previously described (Ling et al., 2010; Genevet et al., 2010; Ribeiro et al., 2014). The WT and mutant versions of Crb differ by specific amino acid substitutions in its intracellular portion (Y10P12E16 to A10A12A16) (Ling et al., 2010). The NTAN-FLAG (N-terminal amidohydrolase 1, an enzyme from the N-end rule pathway that associates with a small number of proteins in Drosophila S2 cells), HA-ubiquitin and Crb4A mut plasmids were kind gifts from M. Ditzel (University of Edinburgh, Edinburgh), P. Meier (Institute for Cancer Research, London) and B. Thompson (Francis Crick Institute, London), respectively. mScarlet (85042; RRID:Addgene_85042) and pCFD3 (49410; RRID:Addgene_49410) plasmids were obtained from Addgene. Where indicated, proteasome inhibition was achieved by treating cells with 50 μM MG132 (Cambridge Bioscience) and 50 μM calpain inhibitor I (Ac-LLnL-CHO or LLnL) (Sigma) for 4 hr before cell lysis or with 5 μM MG132 overnight.RNAi production and treatment dsRNAs were synthesised using the Megascript T7 kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. DNA templates for dsRNA synthesis were PCR amplified from genomic DNA or plasmids encoding the respective genes using primers containing the 5’ T7 RNA polymerase-binding site sequence. dsRNA primers were designed using the DKFZ RNAi design tool (http://www.dkfz.de/signaling2/e-rnai/). The following primers were used: lacZ (Fwd –TTGCCGGGAAGCTAGAGTAA and Rev – GCCTTCCTGTTTTTGCTCAC); gish (Fwd – TGGCCAAAGAATACATTGATTTAGA and Rev – GGCAGTGAACCCCTTAAGAAATAC); ckIα (Fwd – GGAGTGCATCAGAGAAGGAGAAC and Rev – GTGGGTGTGTTATGCAAGTATGTT); ckI (Fwd – GAATTAATACGACTCACTATAGGGAGAGGCCATCAAGATGGAGAGC and Rev – GAATTAATAC GACTCACTATAGGGAGACATGTAATCTGGCTGCTCC) (Liu et al., 2002); dco (Fwd – ACGCAGGCATTTAATTCTGTTT and Rev – GGTGTCCTTTGTTTCTTTTACACA); slmb (Fwd – TGTACTGTAGGCAGGCGATG and Rev – AGGTGATCATCAGTGGCTCC); sgg (Fwd – AGCTCTCAATACAGCCCAGC and Rev – CGGTTCCTGCTGTTGCTC); sgg (Fwd – CCGCAATTTCAAAAGAACTC and Rev – AAAATGACAATCGATCAGCG). After cell seeding, S2 cells were incubated with 15–20 μg dsRNA for 1 hr in serum-free medium, before complete medium was added. 72 hr after dsRNA treatment, cells were lysed and processed as detailed below.
Immunoprecipitation and immunoblot analysis
For purification of FLAG-tagged proteins, cells were lysed in lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% (v/v) glycerol, and 1 mM EDTA), to which 0.1M NaF, phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete, Roche) were added. Cell extracts were spun at 17,000 g for 10 min at 4°C. FLAG-tagged proteins were purified using anti-FLAG M2 Affinity agarose gel (Sigma) for >1 hr at 4°C. FLAG immunoprecipitates were then washed four times with lysis buffer before elution using 150 ng/μl 3x FLAG peptide for 15–30 min at 4°C. For isolation of ubiquitylated proteins, cells were collected by centrifugation and washed with cold PBS. 10% of cell material was lysed as described above. The remaining 90% was lysed with boiling 1% SDS-PBS for 5 min. Following quick vortexing, samples were incubated for 5 min at 100°C before 5-fold dilution using 0.5% BSA-1% Triton X-100-PBS. DNA was sheared by sonication and cell extracts were cleared by centrifugation at 17,000 g for 10 min at 4°C. Samples were diluted 2-fold with 0.5% BSA-1% Triton-X-100-PBS and incubated overnight at 4°C with monoclonal anti-HA agarose beads (Sigma) using Bio-Spin Columns (Bio-Rad). Following incubation, samples were washed with 0.5% BSA-1% Triton-X-100-PBS and 1% Triton X-100-PBS before elution. HA immunoprecipitates were eluted from HA beads using 0.2 M glycine pH 2.5 for 30 min at room temperature and eluted samples were equilibrated with 1 M NH4HCO3. Detection of purified proteins and associated complexes was performed by immunoblot analysis using chemiluminescence (Thermo Fisher Scientific). Western blots were probed with mouse anti-FLAG (M2; Sigma; RRID:AB_262044), mouse anti-Myc (9E10; Santa Cruz Biotechnology; RRID:AB_262044), rat anti-HA (3F10; Roche Applied Science; RRID:AB_2314622), mouse anti-V5 (Thermo Fisher Scientific; RRID:AB_2556564), mouse anti-Crb (Cq4; Developmental Studies Hybridoma Bank, DSHB; RRID:AB_528181), or mouse anti-tubulin (E7; DSHB; RRID:AB_528499). For densitometry analysis of immunoblots, X-ray blots were scanned using an Epson Perfection V700 flatbed scanner and further analysed with the Gel Analyzer function on ImageJ (RRID:SCR_003070). Relative Ex protein levels (normalised to the respective tubulin loading control) were represented as a ratio to the average of the Ex levels in the CrbΔFBM negative control samples.
Immunostaining
Larval tissues were processed as previously described (Genevet et al., 2010). Primary antibodies were incubated overnight at 4°C unless otherwise stated. Rat anti-Ci155 antibody (2A1; DSHB; RRID:AB_2109711) was used at 1:50 or 1:100, chicken anti-GFP (ab13970; Abcam; RRID:AB_300798) was used at 1:1000, rat anti-Crb-ICD (a kind gift from F. Pichaud) was used at 1:200, rabbit anti-aPKC (sc-216, Santa Cruz; RRID:AB_2300359) was used at 1:500, and mouse anti-β-galactosidase (Z3781, Promega; RRID:AB_430877) was used at 1:500. Anti-mouse, anti-rat and anti-rabbit Rhodamine Red-X-, FITC-, or Cy5-conjugated (Jackson ImmunoResearch) secondary antibodies were used at 1:400 or 1:500. Anti-rat Alexa Fluor 488-conjugated secondary antibody (Thermo Fisher) was used at 1:500. Anti-rat Alexa Fluor 568-conjugated (Abcam), anti-chicken Alexa Fluor 488-conjugated (Abcam) or anti-mouse Alexa Fluor 647-conjugated (Jackson ImmunoResearch) secondary antibodies were used at 1:1000. Secondary antibodies were incubated for at least 2 hr at room temperature. After washes, tissues were mounted in Vectashield (with or without DAPI) (H-1000 or H-1200, Vector Labs; RRID:AB_2336789 and RRID:AB_2336790, respectively), or stained with DAPI (1 μg/mL) for 10 min before mounting with Mowiol 40–88 (Sigma). Fluorescence images were acquired on Zeiss LSM510 Meta, Zeiss LSM710 or Zeiss LSM880 confocal laser scanning microscopes (40x objective lens).
Protein sequence alignments
CKI kinases were compiled with BLAST (NCBI; RRID:SCR_004870) using the full-length Drosophila CkIα sequence as query. Sequence alignments were performed using MUSCLE (RRID:SCR_011812) (Edgar, 2004) and CKI kinase phylogeny was designed using the PhyML (RRID:SCR_014629) and DrawTree tools in the Phylogeny online tool (http://www.phylogeny.fr/simple_phylogeny.cgi) (Dereeper et al., 2008). Protein sequence accession numbers were as follows: NP_727631 (D. melanogaster CkIα); NP_001020276.1 (H. sapiens CKIα); NP_733414 (D. melanogaster Dco); NP_001884.2 (H. sapiens CKIδ); NP_001885.1 (H. sapiens CKIε); NP_001163628 (D. melanogaster Gish isoform I); NP_001014628 (D. melanogaster Gish isoform F); NP_071331.2 (H. sapiens CKIγ isoform 1); NP_001310.3 (H. sapiens CKIγ isoform 2); NP_004375.2 (H. sapiens CKIγ isoform 3); NP_572794 (D. melanogaster CG2577); NP_609851 (D. melanogaster CG7094); NP_608697 (D. melanogaster CG9962); NP_649536 (D. melanogaster CG12147).
Drosophila genetics and genotypes
Transgenic RNAi stocks were obtained from the Vienna Drosophila Resource Center (VDRC; RRID:SCR_013805) (ckIα). ubi-Ex (wt or S453A) transgenes were cloned using Gateway technology into a modified pKC26-pUbiq plasmid (Gaspar et al., 2015). UAS-CKI transgenes were cloned using Gateway technology into the pUASg-HA(N)-attB vector. UAS-Ex (wt or S453A) transgenes were cloned into the pUAST-attB plasmid (Bischof et al., 2007) and generation of transgenic flies was performed by BestGene (RRID:SCR_012605). UAS-Ex (wt or S453A) transgenes were cloned into the pUASg-attB plasmid (Bischof et al., 2013) and transgenic flies were generated in the Crick Fly Facility. Transgenes were inserted at 62E1 (BL-9748) or 28E7 (BL-9723) using ΦC31-mediated integration. gish and CG7094 mutants were generated by CRISPR-mediated gene editing. gRNA plasmids were injected by the Fly Facility of the Department of Genetics, University of Cambridge. crb was obtained from Duojia Pan (UT Southwestern). slmb was obtained from Daniel St Johnston (Gurdon Institute, UK). slmb was obtained from Daniel Kalderon (Columbia University). dco was obtained from Tomas Dolezal (University of South Bohemia). ckIα was obtained from Jessica Treisman (NYU Skirball Institute). gish was obtained from Bloomington (BL-13263).All crosses were raised at 25°C unless otherwise stated. Genotypes were as follows:Figure 3A, Figure 3—figure supplement 1A: hsFLP;; FRT82B ubi-RFP, ubi-ExFigure 3B, Figure 3—figure supplement 1B, Figure 5—figure supplement 2A–C: hsFLP;; FRT82B ubi-RFP, ubi-ExFigure 3C: hsFLP/+; ; FRT82B slmbFigure 3D, H: w;; hh-Gal4, ubi-ExFigure 3E, Figure 3—figure supplement 1C: w;; hh-Gal4, ubi-ExFigure 3F: w;; hh-Gal4, ubi-ExFigure 3G, Figure 3—figure supplement 1D: w;; hh-Gal4, ubi-ExFigure 3I: w;; hh-Gal4, ubi-ExFigure 3J: w;; hh-Gal4, ubi-ExFigure 3—figure supplement 1E: w; Act > yFigure 3—figure supplement 1F: w; UAS-lacZFigure 3—figure supplement 1G: w; UAS-lacZFigure 3—figure supplement 1H: w; UAS-lacZFigure 3—figure supplement 1J: w; en-Gal4, UAS-CD8::GFP/UAS-CD8::GFP (18°C cross)Figure 3—figure supplement 1K: w; en-Gal4, UAS-CD8::GFP / +; UAS-crb (18°C cross)Figure 3—figure supplement 1L: w; en-Gal4, UAS-CD8::GFP/UAS Ex (18°C cross)Figure 3—figure supplement 1M: w; en-Gal4, UAS-CD8::GFP, UAS-Ex (18°C cross)Figure 3—figure supplement 1N: w; en-Gal4, UAS-CD8::GFP/UAS-Ex (18°C cross)Figure 3—figure supplement 1O: w; en-Gal4, UAS-CD8::GFP, UAS-Ex (18°C cross)Figure 5A: hsFLP;; FRT82B ubi-RFP, ubi-ExFigure 5B: hsFLP;; FRT82B ubi-RFP, ubi-ExFigure 5C: hsFLP, FRT19A ubi-RFP/FRT19A ckIαFigure 5D: w;; hh-Gal4, UAS-CD8::GFP/UAS-ExFigure 5E: hsFLP;; FRT82B ubi-GFP/FRT82B slmbFigure 5F: hsFLP;; FRT82B ubi-GFP/FRT82B slmbFigure 5—figure supplement 1A: hsFLP;; FRT82B ubi-RFP, ubi-ExFigure 5—figure supplement 1D: hsFLP; FRT40A ubi-RFP/FRT40A CG7094Figure 5—figure supplement 1E: hsFLP, FRT19A ubi-RFP/FRT19A ckIαFigure 5—figure supplement 1F:, Figure 5—figure supplement 2D–F: hsFLP, FRT19A ubi-RFP/FRT19A ckIαFigure 5—figure supplement 1H: hsFLP; FRT40A CG7094Figure 5—figure supplement 1I: hsFLP, FRT19A ubi-RFP/FRT19A ckIαFigure 6A, B: w; UAS-ckIαFigure 6C, D: w; UAS-ckIαFigure 6E, F: w; UAS-gishFigure 6G, H: w; UAS-gishFigure 6—figure supplement 1A: w;; hh-Gal4, ubi-ExFigure 6—figure supplement 1C: UAS-dcoFigure 6—figure supplement 1D: UAS-dcoFigure 6—figure supplement 1E: tub-Gal4, hs-FLP, UAS-nucGFP::myc / + or Y; UAS-CrbFigure 6—figure supplement 1F: tub-Gal4, hs-FLP, UAS-nucGFP::myc / + or Y; UAS-CrbFigure 6—figure supplement 1G: FRT19A blank/tub-Gal80, hs-FLP, FRT19A; UAS-nls-lacZ, UAS-CD8::GFP / +; ubi-Ex Gal4Figure 6—figure supplement 1H: ckIα Gal4Figure 7A: ckIαFigure 7B: hsFLP / +; exFigure 7C: ckIαFigure 7D: ckIαFigure 7E: w;; hh-Gal4, UAS-CD8::GFP / +Figure 7F: w;; hh-Gal4, UAS-CD8::GFP/UAS-ckIαFigure 7G: w;; hh-Gal4, UAS-CD8::GFP/UAS-gish
Immunofluorescence quantification and statistical analyses
For quantification of Ex1-468::GFP (wt or S453A) (Figure 3J, Figure 3—figure supplement 1R) or Crb (Figure 3—figure supplement 1Q) ratios in posterior versus anterior compartment, two transverse sections were acquired per disc (A-P; mid-dorsal and mid-ventral pouch) and the pixel intensity of the GFP (Ex) or Cy5 (Crb) signal along the apical region of the cells was measured in the two compartments using Fiji (RRID:SCR_002285). n ≥ 14 for all genotypes; one-way ANOVA with Dunnett’s multiple comparisons test. Quantification of aPKC levels (Figure 5—figure supplement 1G) were performed as above but using transverse sections spanning mutant clones. Data represents 42 clones from 11 wing discs (Figure 5—figure supplement 1G). Significance was calculated by unpaired t-test. For Figure 6—figure supplement 1B, Ex1-468::GFP ratio was calculated as aforementioned and significance was calculated using a two-way ANOVA (comparing all genotypes to Crbintra within each timepoint) with Dunnett’s multiple comparisons test. For Figure 7H, P/A ratio of ex-lacZ intensity was calculated by manually drawing around each compartment of the pouch in maximum intensity projections, then measuring the mean grey pixel value in Fiji. Significance was calculated using a one-way ANOVA comparing all means to hh >control, with correction for multiple comparisons; n ≥ 8 for all genotypes.
Generation of CRISPR/Cas9 mutants
gRNA sequences were as follows: gish AATGGAGCCTATGAAGTCAA; CG7094-up ATATCTCGGACTAAGCATCA; CG7094-down ACGGGGTTGTGAGCCTCAGC. gRNA expression plasmids were created by ligation of annealed oligos into pCFD3 (Addgene 49410) (Port et al., 2014), diluted to 100 ng/μl and injected into nos-Cas9 Drosophila embryos (stock CFD-2; Fly Facility, Department of Genetics, University of Cambridge). Progeny of injected animals were screened for homozygous lethality (gish) or PCR screened to identify a deletion (CG7094; primers F1 tcgtgtgaacatcgtggtcgt and R2 ctttcggttggcagctttgtc). The gish mutation was genotyped using primers Gish_PCR_F1 GCGAATGTGTTGCTTTGGTG and Gish_M17_mut2 GTGTAGTTGCGGAGCCTTTC (318 bp amplicon was obtained specifically from mutant allele).
Analysis of genetic interactions in Drosophila adult wings
For analysis of genetic interactions in the Drosophila wing, flies with the genotypes of interest were collected and preserved in 70% EtOH for at least 24 hr. Wings were removed in 100% isopropanol, mounted in microscope slides using Euparal (Anglian Lepidopterist Supplies) as mounting medium and baked at 65°C for at least 5 hr. Adult wing images were captured using a Pannoramic 250 Flash High Throughput Scanner (3DHISTECH) and extracted using the Pannoramic Viewer software (3DHISTECH). Wing area was quantified using ImageJ (the alula and costal cell of the wing were both excluded from the analysis). Images were processed using Adobe Photoshop (RRID:SCR_014199).
Mass spectrometry analysis
AP-MS experiments followed a GeLC MS/MS approach. Gel lanes were fragmented into eight equally sized pieces and subjected to in-gel trypsin digestion using a Perkin Elmer Janus Automated Workstation. Peptide mixtures were acidified to 0.1% TFA and injected onto a nanoACQUITY UPLC (Waters Corporation) coupled to an LTQ-Orbitap XL (Thermo Fisher Scientific) via an Advion Biosciences Nanomate. Peptides were eluted over a 30 min gradient (5–40% ACN). Mascot distiller was used to extract peak lists, which were searched with Mascot v.2.4.1 (Matrix Science; RRID:SCR_014322) against the Drosophila melanogaster Uniprot reference proteome. Methionine oxidation was entered as a variable modification and search tolerances were 5 ppm and 0.8 Da for peptides and fragments, respectively. Individual lane searches were combined and results compiled in Scaffold 4.0.3 (RRID:SCR_014345).In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Casein kinase 1 family proteins promote Slimb-dependent expanded degradation" for consideration by eLife. Your article has been reviewed by two peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Utpal Banerjee as the Senior Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor. They have agreed that, in principle your manuscript is appropriate for eLife, but that a number of revisions including new experimental data would be required to bring it to the standards of the journal. The full comments of the reviewers are appended below. Although you are not obligated to provide new data relevant to every point, several important points have been raised that definitely require attention. In particular, point #1 from reviewer 1, and major points 1 and 5 from reviewer 2 (relating to organ growth) require clear conclusions.Reviewer #1:The work of Fulford et al. fills the gap in knowledge of the kinase that phosphorylates Ex and targets it for degradation, downstream of Crb overexpression. The authors provide sufficient in vivo and biochemical data to support their conclusions. Overall, the data are of high quality and well controlled; I recommend publication in eLife after revisions.1) My major concern/confusion is the lack of any discussion about the seeming contradiction that both loss of Crb and excess Crb leads to Ex degradation. How can Crb be necessary for Ex stabilization at the membrane and at the same time target it for degradation? What is it about suboptimal Crb levels that triggers Ex degradation? Are Slimb and CK1 proteins required for Ex degradation upon Crb loss as well? The authors could check this by generating double loss-of-function clones for Crb and Slimb or CK1 proteins, and assaying Ex levels.2) in vivo, at least in wing discs, CK1α seems to be the major kinase. Is this also true in other imaginal discs? They could extend their results to other discs by analyzing slimb and CK1α mutant clones with and without Crb overexpression.3) The authors state: "When a Crbintra transgene was expressed in the posterior compartment using the hedgehog-Gal4 driver (hh-Gal4), ubi-Ex1-468::GFP was lost from the apical surface and degraded (Figure 3C-D and Figure 3—figure supplement 1C). In contrast, the S453A mutant reporter accumulated all over the cell upon Crbintra expression, presumably due to the fact that it cannot be recognised by Slmb and degraded (Figure 3E-F and Figure 3—figure supplement 1D). "I disagree with the conclusion that ExS453A mutant accumulates all over the cell, it does not accumulate at the apical membrane. Therefore, it seems to be still degraded at the membrane suggesting involvement of other residues. Alternatively, it is mislocalized to the basolateral membrane by ectopic Crb and cannot be degraded there.Reviewer #2:It has been demonstrated in previous papers that Crb triggers Ex turnover in a Slmb/β-TrCP-dependent manner. However, recognition by Slmb/β-TrCP requires substrate phosphorylation, which had remained an unexplored aspect of Ex regulation. In this paper, Fulford et al. provide evidence that the CKI family kinases, CkIα and Gish, act downstream of Crb to promote phosphorylation of Ex, in turn promoting Ex degradation. The paper comprises a large amount of supporting data, which is generally of very good quality and consistent with the authors' interpretations. The strong points of this manuscript are the thoroughness of the biochemistry assays although it is still unclear about the phosphorylation site(s) of CKI on Ex. Overall, this paper gave me a feeling that the authors described a quite simple biological context using a very complicated way. I would suggest the authors simplify this paper. In addition, the major weakness of this paper is that it doesn't show any biological function of CKI in regulating organ size and Yki activity, which dramatically reduced the significance of this work. My concerns listed below should be addressed in revision.1) To assess the functional significance of CKI kinases in controlling Hippo pathway activation, it will be important to examine whether CKI controls organ growth. CkIα (and/or Gish) mutant- or overexpression- MARCM clone assays would be required.2) Following the above question, the authors need to examine Yki activity in CkIα (and/or Gish) mutant/overexpression background using Diap1-lacZ or ex-lacZ reporter.3) The authors showed that CKI phosphorylates Ex in vitro, however, it is important to identify the phosphorylation site(s) of Ex and generate the phosphor-specific antibody to examine the endogenous Ex phosphorylation. Alternatively, the phosphor-tag gel or pan-phosphor S/T antibody could be used for the phosphorylation detection.4) All biochemistry assays were using overexpression system. They should detect endogenous Ex expression and degradation. For example, CHX treatment could be used to avoid gish-mediated transcriptional regulation of endogenous Ex expression.5) Although the biochemistry assays have shown that CKI kinase Gish is required for Crb-mediated Ex turnover, the genetic epistasis between Crb and CkIα in controlling Yki activation and organ growth is still needed to be tested. I would suggest the authors perform the following experiments "hh> Crbintra vs. hh>Crbintra + CkIαRNAi", then compare the Yki reporter induction (e.g. Diap1-LacZ) and P-compartment size.Reviewer #1:[…] 1) My major concern/confusion is the lack of any discussion about the seeming contradiction that both loss of Crb and excess Crb leads to Ex degradation. How can Crb be necessary for Ex stabilization at the membrane and at the same time target it for degradation? What is it about suboptimal Crb levels that triggers Ex degradation? Are Slimb and CK1 proteins required for Ex degradation upon Crb loss as well? The authors could check this by generating double loss-of-function clones for Crb and Slimb or CK1 proteins, and assaying Ex levels.We apologise for not being sufficiently clear in our description of previous data regarding the effect of Crb on Ex protein levels. Previous work from ourselves and others had indeed shown that Crb is required to recruit Ex to the apical plasma membrane (Ling et al., 2010, Chen et al., 2010, Hafezi et al., 2012, Ribeiro et al., 2014). However, as well as promoting Ex activation by membrane recruitment, Crb also brings Ex into proximity with CKI family members and the SCFSlimb complex, as shown by our Affinity Purification/Mass Spectrometry analysis (Figure 1A and Ribeiro et al., 2014). Thus, we believe Crb is both responsible for Ex recruitment to its site of activity and also for ensuring its fast turnover through degradation in order to fine-tune Yki regulation. We have clarified this issue in the first paragraph of the Discussion.The reviewer raises in interesting point in enquiring about the fate of Ex in the cytoplasm upon loss of Crb. Previously published data indicated that endogenous Ex accumulates in the cytoplasm upon Crb loss (Ribeiro et al., 2014, Robinson et al., 2010, Ling et al., 2010), which had been interpreted as meaning that Ex is mainly degraded at the apical plasma membrane, and failure of apical recruitment leads to stabilisation and cytoplasmic accumulation. However, our Ex::GFP reporter does not accumulate in the cytoplasm in Crb clones (Figure 4A, A’), suggesting a different possibility: that endogenous Ex cytoplasmic accumulation is primarily due to ex transcriptional upregulation in crb mutant clones. Indeed, work published by the Jiao lab suggests SCFSlimb can also degrade Ex in the cytoplasm (Zhang et al., 2015). To directly test this possibility and as requested by the reviewer, we examined the Ex::GFP sensor in crb, slmb double mutant clones (new Figure 3C, C’). We observed that, as anticipated, loss of slmb leads to Ex sensor cytoplasmic accumulation in crb mutant clones, confirming the finding from the Jiao lab that Ex can be degraded in the cytoplasm and supporting the idea that transcriptional elevation of ex plays a role in cytoplasmic accumulation of Ex protein in Crb clones. Thus, although Crb promotes Ex degradation by SCFSlimb at the plasma membrane, there is also a Crb-independent Slimb-dependent cytoplasmic Ex degradation pathway, though the relative turnover rate of these mechanisms is not clear. Since Ex activity in growth control is thought to occur at the apical plasma membrane (Fulford et al., 2018), it is likely that the Crb-dependent mechanism is key in determining Ex functional levels. We discuss this new result in the first paragraph of the Discussion.2) in vivo, at least in wing discs, CK1α seems to be the major kinase. Is this also true in other imaginal discs? They could extend their results to other discs by analyzing slimb and CK1α mutant clones with and without Crb overexpression.As requested by the reviewer, we examined the levels of the Ex::GFP reporter in haltere, leg and eye imaginal discs. In the haltere and leg disc, the levels of the Ex reporter were elevated in both ckIα and slmb clones, suggesting a similar mechanism operates as in the wing disc. Interestingly, we did not see a clear increase in the eye disc. However, ckIα and slmb loss in these tissues elicited a very strong clone extrusion phenotype, and a complete loss of ommatidial differentiation, making the analysis difficult, especially since the most prominent Ex localisation in the eye disc is at the apical side of the emerging ommatidial clusters. These new data are presented in Figure 5—figure supplement 2.3) The authors state: "When a Crbintra transgene was expressed in the posterior compartment using the hedgehog-Gal4 driver (hh-Gal4), ubi-Ex1-468::GFP was lost from the apical surface and degraded (Figure 3C-D and Figure 3—figure supplement 1C). In contrast, the S453A mutant reporter accumulated all over the cell upon Crbintra expression, presumably due to the fact that it cannot be recognised by Slmb and degraded (Figure 3E-F and Figure 3—figure supplement 1D). "I disagree with the conclusion that Ex-S453A mutant accumulates all over the cell, it does not accumulate at the apical membrane. Therefore, it seems to be still degraded at the membrane suggesting involvement of other residues. Alternatively, it is mislocalized to the basolateral membrane by ectopic Crb and cannot be degraded there.We agree with the reviewer that it is possible that the ExS453 reporter is mislocalised to the basolateral membrane by ectopic Crb and is refractory to degradation there. We have changed the manuscript text to reflect this possibility. “It is therefore possible that Ex1-468 S453A is mislocalised to the basolateral membrane by ectopic Crb, where it cannot be degraded”.Reviewer #2:[…] Overall, this paper gave me a feeling that the authors described a quite simple biological context using a very complicated way. I would suggest the authors simplify this paper. In addition, the major weakness of this paper is that it doesn't show any biological function of CKI in regulating organ size and Yki activity, which dramatically reduced the significance of this work. My concerns listed below should be addressed in revision.We thank the reviewer for the insightful comments and suggestions, which have helped us improve the manuscript. We believe that whilst it is tempting to consider that Expanded regulation by Crb is a simple biological process, the reality is that the existence of multiple layers of regulation and the fact that there is Yki-dependent feedback regulation of transcriptional levels of ex make these studies challenging to perform and to explain in a simple manner. Nevertheless, based on the reviewer’s comments, we have endeavoured to highlight the relevance of the biological phenomenon studied and to clarify our arguments in the manuscript accordingly. We believe that our revised manuscript and new data significantly improve the quality and strength of our findings.1) To assess the functional significance of CKI kinases in controlling Hippo pathway activation, it will be important to examine whether CKI controls organ growth. CkIα (and/or Gish) mutant- or overexpression- MARCM clone assays would be required.2) Following the above question, the authors need to examine Yki activity in CkIα (and/or Gish) mutant/overexpression background using Diap1-lacZ or ex-lacZ reporter.We agree with the reviewer that it is important to correlate the stabilisation of Ex in ckIα mutant clones with Yki activity. To address this, we examined two transcriptional readouts of Yki activity: ex-lacZ, an enhancer trap in the ex locus (Hamaratoglu et al., 2006), and diap1-GFP3.5, a fragment of the diap1 promoter driving a GFP reporter (Zhang et al., 2008), both of which are widely used in the field. Results of this analysis are shown in the new Figure 7. In accordance with our model, while gish mutant clones had wild type levels of ex-lacZ (Figure 7B), both diap1-GFP3.5 and ex-lacZ levels were markedly reduced in ckIα clones (Figure 7A and 7C). In addition, we used a Yki-GFP knock-in fly line (Fletcher et al., 2018) to show that Yki is excluded from the nucleus in ckIα mutant cells compared with control (Figure 7D). Thus, decreased Yki activity is correlated with increased Ex stability upon CkIα disruption, while Gish loss has no effect. We then examined the effect of CKI overexpression on ex-lacZ. In further support of our model, CkIα overexpression increased ex-lacZ expression, while Gish expression had no effect (Figure 7E-H).The effect on growth is more complicated to address because, like many kinases, CkIα likely regulates a number of substrates. In fact, rather than being smaller as expected from decreased Yki activity, ckIα clones are larger than control clones and are often excluded from the disc epithelium once they reach a certain size. This overgrowth phenotype is due to excess Wingless (Wg) signalling, and can be suppressed by expression of dominant negative TCF (Legent et al., 2012). In fact, the clonal overgrowth and exclusion phenotype of ckIα mutants closely resembles that of the Wg signalling negative regulators axin and APC1/2 (see for example Munoz-Descalzo et al., 2011). Thus, it is likely that the undergrowth induced by Ex stability and consequent Yki downregulation is masked by the very strong overgrowth due to Wg signalling upregulation upon ckIα loss. We now consider these points in the Discussion. In the case of CkIα overexpression, we do observe a mild overgrowth phenotype (Author response image 1), which correlates with increased Yki activity (as measured by ex-lacZ expression, shown in Figure 7). As expected, Gish overexpression causes neither ex-lacZ expression (Figure 7) nor overgrowth (Author response image 1). It is possible that this overgrowth is observed because Wg and Hippo signalling are sensitive to a different threshold of CkIα activity, so that mild gain of CkIα increases Yki activity without strongly impairing Wg. However, as it is difficult to verify this interpretation, we have not included the effect of CKI overexpression on wing size in the manuscript, though we are happy to include it if the reviewer so requires.
Author response image 1.
Overexpression of CkIα, but not GishisoI, causes a mild overgrowth of the posterior compartment of the wing.
(A-C) Adult wings from female flies overexpressing no transgene (A), UAS-CkIα (B), or UAS-GishisoI (C), in the posterior compartment of the developing wing under the control of hhGal4. Crosses were raised at 25 °C. (D) Quantification of the ratio of the area of the posterior compartment to total wing area in adult wings. Overexpression of CkIα causes a significant overgrowth (p=0.0001, one way ANOVA comparing all means to hh> controls, with correction for multiple comparisons). GishisoI overexpressing wings tend to be slightly smaller than controls, though this is not statistically significant (p=0.0547), and sometimes exhibit blisters. N≥14 for all genotypes.
Overexpression of CkIα, but not GishisoI, causes a mild overgrowth of the posterior compartment of the wing.
(A-C) Adult wings from female flies overexpressing no transgene (A), UAS-CkIα (B), or UAS-GishisoI (C), in the posterior compartment of the developing wing under the control of hhGal4. Crosses were raised at 25 °C. (D) Quantification of the ratio of the area of the posterior compartment to total wing area in adult wings. Overexpression of CkIα causes a significant overgrowth (p=0.0001, one way ANOVA comparing all means to hh> controls, with correction for multiple comparisons). GishisoI overexpressing wings tend to be slightly smaller than controls, though this is not statistically significant (p=0.0547), and sometimes exhibit blisters. N≥14 for all genotypes.3) The authors showed that CKI phosphorylates Ex in vitro, however, it is important to identify the phosphorylation site(s) of Ex and generate the phosphor-specific antibody to examine the endogenous Ex phosphorylation. Alternatively, the phosphor-tag gel or pan-phosphor S/T antibody could be used for the phosphorylation detection.We performed several experiments to address this point but, unfortunately, we were unable to unequivocally identify the CKI phosphorylation site(s). As suggested by the reviewer, we attempted to raise antibodies that recognise a peptide phosphorylated at S453. We reasoned that since S453 is essential for the Ex:Slmb interaction, it is likely to be phosphorylated in response to Crbintra expression, potentially directly by CKIs. Unfortunately, we were unable to validate the p-S453 antibodies we generated in both rabbits and sheep, in any system we tested (e.g. Western blot; see Author response images 2 and 3) and the antibody failed to recognise Ex. Even in conditions where Ex should be extensively phosphorylated, we failed to detect a band recognising either endogenous or exogenous Ex.
Evaluation of rabbit Ex phospho-S453 antibody in Drosophila S2 cells.
S2 cells were transfected with the indicated plasmids 48h prior to lysis and processing for Western blot analysis. Note that the phospho-S453 Ex antibody does not recognise any protein in the vicinity of the predicted sizes of full-length Ex or Ex1468. ø denotes empty vector. GFP and tubulin were used as transfection and protein loading control, respectively.
Evaluation of sheep Ex phospho-S453 antibody in Drosophila S2 cells.
S2 cells were transfected with the indicated plasmids 48h prior to lysis and processing for immunoblotting. Note that the phospho-S453 Ex antibody does not seem to specifically recognise full length Ex or Ex1-468. Open and closed circles denote absence or presence of MG132 treatment, respectively. GFP and tubulin were used as transfection and protein loading control, respectively.We also attempted to monitor the levels of endogenous Ex in Drosophila S2 cells. However, we found that the widely used anti-Ex antibody was not sufficiently specific (see Author response image 4). Even though we can detect a band that is likely to represent endogenous Ex, this is extremely weak and would not allow us to generate conclusive data.
Author response image 4.
Evaluation of Ex antibody in the recognition of endogenous Ex protein.
S2 cells were transfected with the indicated plasmids 48h prior to lysis and dsRNA treatment was performed 24h before transfection. Note that there are several bands recognised by the Ex antibody. One of the weaker slow migrating bands is consistent with it being endogenous Ex since it is increased when exogenous Ex was transfected and when wts was depleted by RNAi. ø denotes empty vector; * indicate non-specific bands recognised by the Ex antibody. Tubulin was used as loading control.
Evaluation of Ex antibody in the recognition of endogenous Ex protein.
S2 cells were transfected with the indicated plasmids 48h prior to lysis and dsRNA treatment was performed 24h before transfection. Note that there are several bands recognised by the Ex antibody. One of the weaker slow migrating bands is consistent with it being endogenous Ex since it is increased when exogenous Ex was transfected and when wts was depleted by RNAi. ø denotes empty vector; * indicate non-specific bands recognised by the Ex antibody. Tubulin was used as loading control.As suggested by the reviewer, we also used Phos-tag gels to examine point mutants of Ex1-468 phosphorylatable residues, some of which we had previously shown to be involved in the interaction with Slmb/bTrCP (Ribeiro et al., 2014). Shown in Author response image 5 are the results of this analysis, where Ex1-468 was coexpressed with either WT or mutant Crbintra and the lysates were assessed by Phos-tag gel electrophoresis followed by Western blot analysis.
Author response image 5.
Evaluation of Ex electrophoretic mobility shift using Phos-tag gels.
S2 cells were transfected with the indicated plasmids 48h prior to lysis. Lysates were run in Phos-tag gels to assess phosphorylation pattern of Ex1-468 (WT, S453A, S457A or S462A) in the presence of Crbintra WT or a variant carrying a mutated FERM-binding motif (DFBM). Immunoblot analysis was performed using the indicated antibodies. Open circle indicates empty vector. Tubulin was used as loading control.
Co-expression of Ex1-468 with Crbintra WT, but not DFBM, resulted in a shift in Ex mobility in Phos-tag gels, consistent with our previous results on standard PAGE gels. Our analysis of the Ex mutants confirmed our previous observations regarding their effect on the stability of Ex and their ability to interact with Slmb/b-TrCP. We have previously shown that S453 is crucial for Slmb/b-TrCP recognition and Ex degradation. When S453A is mutated, Ex fails to bind to Slmb/b-TrCP and is therefore more stable. We had previously observed that S453A mutation does not abrogate the Ex mobility shift and this is confirmed with the Phos-tag analysis. Ex1-468 is still shifted and it is significantly more stable. Interestingly, unmodified Ex S453A is also seen in the Phos-tag gel, perhaps indicating that, indeed, this residue is phosphorylated in response to expression of Crb. However, it is clear that even if that is the case, it is not the only phosphorylation event triggered by Crb expression.The other mutations tested (S457A and S462A) behaved very similarly to WT Ex, showing only a slight increase in Ex stability. In the case of S457A, the Ex detected is nearly completely modified, suggesting that this residue may not be phosphorylated in response to Crb expression. In the case of S462A, we could detect some unmodified Ex, again perhaps suggesting that it may be phosphorylated but, like S453, it is not the only residue involved. What is clear from the modest band shifts we observed is that Phos-tag gels do not allow us to readily separate different individual phosphorylated species of Ex any better than standard PAGE gels. Therefore, given the fact that the sequence surrounding the Slmb/b-TrCP consensus site is extremely rich in Ser and Thr residues, this approach is very unlikely to allow us to identify the (potentially multiple) CKI phosphorylation sites.
Evaluation of Ex electrophoretic mobility shift using Phos-tag gels.
S2 cells were transfected with the indicated plasmids 48h prior to lysis. Lysates were run in Phos-tag gels to assess phosphorylation pattern of Ex1-468 (WT, S453A, S457A or S462A) in the presence of Crbintra WT or a variant carrying a mutated FERM-binding motif (DFBM). Immunoblot analysis was performed using the indicated antibodies. Open circle indicates empty vector. Tubulin was used as loading control.Finally, we attempted to immunoprecipitate CkIα from S2 cell lysates to perform in vitro kinase assays on bacterially expressed Ex followed by Mass Spectrometry analysis. Unfortunately, we could not find conditions where the purified CkIα was active in the in vitro setting and had no time to extensively troubleshoot the experiment given the time constraints on the revision.4) All biochemistry assays were using overexpression system. They should detect endogenous Ex expression and degradation. For example, CHX treatment could be used to avoid gish-mediated transcriptional regulation of endogenous Ex expression.As mentioned above, we attempted to monitor the levels of endogenous Ex in Drosophila S2 cells. However, we found that the Ex antibody was not sufficiently specific (see Author response image 4) and, unfortunately, this precludes the analysis suggested by the reviewer. As shown in vivo and mentioned by the reviewer, the use of endogenous Ex is complicated by transcriptional feedback, making the use of CHX, which has pleiotropic effects on many signalling pathways, necessary. We therefore believe that use of exogenous Ex allows us to dissect Ex stability in a cleaner experimental setup.5) Although the biochemistry assays have shown that CKI kinase Gish is required for Crb-mediated Ex turnover, the genetic epistasis between Crb and CkIα in controlling Yki activation and organ growth is still needed to be tested. I would suggest the authors perform the following experiments "hh> Crbintra vs. hh>Crbintra + CkIαRNAi", then compare the Yki reporter induction (e.g. Diap1-LacZ) and P-compartment size.As requested by the reviewer, we examined the effect of CkIα depletion on the Crbintra phenotype (overgrowth and Yki activity using ex-lacZ) in the posterior compartment of the wing disc (Author response image 6). We observed that, consistent with our model, both the overgrowth phenotype and the ex-lacZ increase elicited by Crbintra expression are suppressed by CkIα depletion. However, the discs combining Crbintra and CkIα depletion appear heavily disrupted and, therefore, we want to be cautious about the interpretation of this experiment. In particular, it is possible that the suppressed growth is due to toxicity of combining Crbintra with CkIα depletion rather than specifically lowering Yki activity. Nevertheless, we are happy to include the data as supplementary material if required by the reviewer.
Author response image 6.
ckIα partially reverts Crbintra-induced upregulation of Yki target genes and overgrowth.
(A-E) ckIα partially reverts Crbintra-induced upregulation of the Yki activity reporter ex-lacZ. Sum slices projections of z-stacks of the pouch region of third instar wing imaginal discs expressing ex-lacZ and either no transgene (A), UAS-ckIα (B), UAS-Crb (C), or UASckIαplus UAS-Crb (D). Transgene expression was driven by hh-Gal4, and the time of onset of expression was controlled using tub-Gal80; crosses were raised at 25 °C then shifted to 29 °C 48 h prior to dissection as wandering L3 larvae. The posterior compartment is marked by CD8::GFP (green); DAPI (blue) stains nuclei. Scale bars 20 μm. (A’-D’) ex-lacZ channels alone. (E) Quantification of posterior to anterior ratio of nuclear ex-lacZ intensity in sum slices projections. Expression of Crbintra for 48 h induces a significant increase in ex-lacZ expression levels, which is partially reverted by co-expression of ckIα (p=0.7240, one way ANOVA comparing all means to hh>GFP control, with correction for multiple comparisons, n≥11 for all genotypes) (F-I) ckIα partially reverts Crbintra-induced overgrowth of wing imaginal discs. XY sections of whole wing imaginal discs from third instar larvae, which have expressed the indicated transgenes under the control of hh-Gal4 for 48 h prior to dissection. The posterior compartment is marked by CD8::GFP (green); DAPI (blue) stained nuclei. hh>Crb discs tend to be larger overall, and the posterior compartment of the pouch develops ectopic folds as the disc attempts to accommodate the additional cells. Coexpression of ckIα results in less severe overgrowth, and less pronounced ectopic folding of the pouch region. Scale bars 100 μm. Genotypes for Rebuttal Figure 8: (A, A’, F) w; ex-lacZ/+; hh-Gal4, UAS-CD8::GFP/+; (B, B’, G) w; UAS-ckIα; (C, C’, H) w; ex-lacZ/+; hh-Gal4, UAS-CD8::GFP/ UAS-Crb; (D, D’, I) w; UASckIα
ckIα partially reverts Crbintra-induced upregulation of Yki target genes and overgrowth.
(A-E) ckIα partially reverts Crbintra-induced upregulation of the Yki activity reporter ex-lacZ. Sum slices projections of z-stacks of the pouch region of third instar wing imaginal discs expressing ex-lacZ and either no transgene (A), UAS-ckIα (B), UAS-Crb (C), or UASckIαplus UAS-Crb (D). Transgene expression was driven by hh-Gal4, and the time of onset of expression was controlled using tub-Gal80; crosses were raised at 25 °C then shifted to 29 °C 48 h prior to dissection as wandering L3 larvae. The posterior compartment is marked by CD8::GFP (green); DAPI (blue) stains nuclei. Scale bars 20 μm. (A’-D’) ex-lacZ channels alone. (E) Quantification of posterior to anterior ratio of nuclear ex-lacZ intensity in sum slices projections. Expression of Crbintra for 48 h induces a significant increase in ex-lacZ expression levels, which is partially reverted by co-expression of ckIα (p=0.7240, one way ANOVA comparing all means to hh>GFP control, with correction for multiple comparisons, n≥11 for all genotypes) (F-I) ckIα partially reverts Crbintra-induced overgrowth of wing imaginal discs. XY sections of whole wing imaginal discs from third instar larvae, which have expressed the indicated transgenes under the control of hh-Gal4 for 48 h prior to dissection. The posterior compartment is marked by CD8::GFP (green); DAPI (blue) stained nuclei. hh>Crb discs tend to be larger overall, and the posterior compartment of the pouch develops ectopic folds as the disc attempts to accommodate the additional cells. Coexpression of ckIα results in less severe overgrowth, and less pronounced ectopic folding of the pouch region. Scale bars 100 μm. Genotypes for Rebuttal Figure 8: (A, A’, F) w; ex-lacZ/+; hh-Gal4, UAS-CD8::GFP/+; (B, B’, G) w; UAS-ckIα; (C, C’, H) w; ex-lacZ/+; hh-Gal4, UAS-CD8::GFP/ UAS-Crb; (D, D’, I) w; UASckIα
Authors: Chiao-Lin Chen; Molly C Schroeder; Madhuri Kango-Singh; Chunyao Tao; Georg Halder Journal: Proc Natl Acad Sci U S A Date: 2011-12-21 Impact factor: 11.205
Authors: Chen Ling; Yonggang Zheng; Feng Yin; Jianzhong Yu; Juan Huang; Yang Hong; Shian Wu; Duojia Pan Journal: Proc Natl Acad Sci U S A Date: 2010-05-24 Impact factor: 11.205
Authors: Paulo Ribeiro; Maxine Holder; David Frith; Ambrosius P Snijders; Nicolas Tapon Journal: Proc Natl Acad Sci U S A Date: 2014-04-28 Impact factor: 11.205