Upregulation of SHIP2 participates in the development of breast cancer via promoting Wnt/β-catenin signaling.

PURPOSE: Src homology 2-containing inositol 5-phosphatase 2 (SHIP2) gene is associated with arthrosclerosis, gastric cancer and diabetes. In this study, we revealed that overexpression of SHIP2 is closely implicated with the development of breast cancer (BC).
METHODS: The BC tissue and adjacent cancerous tissue were obtained from BC patients who had underwent mastectomy. BC cells with either overexpression or knockdown of SHIP2 were analyzed to determine cell proliferation, migration, invasion and apoptosis using the CCK-8 assay, colony formation assay, scratch assay, transwell assay and flow cytometry, respectively. A rat BC xenograft model was constructed to explore the role of SHIP2 on tumor growth in vivo.
RESULTS: The expression levels of SHIP2 in BC tissues and cells were significantly higher than those in adjacent tissues and normal breast cells, respectively. Silencing SHIP2 suppressed BC cells proliferation and promoted apoptosis. Overexpression of SHIP2 enhanced the cells migration/invasion in BC. Moreover, SHIP2 participated in the Wnt/β-catenin pathway by regulating GSK-3β and its downstream genes. β-Catenin activator LiCl could significantly eliminate the effect of si-SHIP2 on BC cells. Moreover, overexpression of SHIP2 increased tumor volume and weight in rat model, and Wnt/β-catenin pathway inhibitor ICG001 reversed the promoting effect of SHIP2 on tumorigenesis.
CONCLUSION: Upregulation of SHIP2 could increase the migration, invasion, proliferation, and decrease apoptosis in BC cells. Moreover, SHIP2 participated in the progression of BC via activating the Wnt/β-catenin pathway.

Introduction

Breast cancer (BC) is believed to be the most common cancer in women worldwide.1 The traditional treatment strategies including surgery, radiotherapy or chemotherapy have been widely used for patients with BC.2,3 However, the high clinical motility makes BC the secondary leading cause of tumor-/cancer-associated death.4 Investigations based on molecular mechanisms in the process of BC contribute to the ideal clinical outcome of patients with BC.5,6 Therefore, a deep understanding of molecular mechanism during BC is vital for the investigation of novel therapy strategy.

Src homology 2-containing inositol-phosphatase 2 (SHIP2) is proved to be a negative regulator of the process during the intracellular phosphatidylinositol phosphate.7 A previous study indicates that overexpression of SHIP2 leads to the blockade in signaling and associated biological disorders.8 Overexpression of SHIP2 has been shown to correlate with decreased disease-free survival in BC.9 A previous study shows that SHIP2 plays an oncogenic role in BC stem cells through JNK/vimentin activation and its phosphatase activity.10 Ghosh et al also indicated that suppression of SHIP2 expression prevented cells metastasis in BC progression.11 In addition, SHIP2 is found to play a vital role in breast carcinoma cell.12 SHIP2 phosphoinositol phosphatase is proven to positively migrate in MDA-MB-231 BC cells via a certain biological pathway.13 As one of the important biological pathways, Wnt/β-catenin activation is proved to be related to numerous human cancers.14,15 SHIP1 could regulate mesenchymal stem cell numbers by limiting the induction of the β-catenin-associated pathway.16 However, the detailed molecular mechanism of SHIP2 in the process of BC is still unclear.

In this study, the BC tissue and adjacent cancerous tissue were obtained from BC patients undergo mastectomy, followed by cell culture, transfection and observation. Moreover, detection techniques such as qRT-PCR, scratch assay and transwell assay were used to observe the effect of SHIP2 on proliferation, migration, invasion and apoptosis of BC cells. Furthermore, the association between SHIP2 and Wnt/β-catenin pathway in BC was further investigated based on an animal experiment. We hoped to explore the detailed molecular mechanism of SHIP2 in the progression of BC.

Materials and methods

Patients

From January 1, 2017 to January 1, 2018, a total of 90 female patients (age: 29–59 years) who underwent mastectomy in Second Affiliated Hospital of Medical College of Beijing Jiaotong University were enrolled for the current study. The detailed clinical data of enrolled patients are listed in Table 1. All patients were diagnosed by ultrasound, mammogram and biopsy pathological examination. No local or systemic treatment prior to surgery was performed on these patients. The BC and adjacent cancerous tissue (at least 3 cm from the edge of the tumor) were obtained from all patients. The focus of BC came from the center of BC tissue, and the tissue adjacent to BC was taken from normal tissues surrounding BC. All patients voluntarily signed the informed notice. The current study obtained the approval of Ethics Committee of our hospital (ethic vote 81/85).

Table 1

The clinical data for enrolled patients undergo mastectomy

	Cases (n=90)	SHIP2 protein expression in BC tissue (n)		P-value
Low expression	High expression
Age (years)
<45	41	21	20	>0.05
≥45	49	21	28
T stage
T1	23	10	13	>0.05
T2	15	7	8
T3-4	52	25	27
N stage
N0	25	10	15	>0.05
N1-2	65	32	33
TNM stage
I	24	13	15	<0.0001
II	34	8	22
III–IV	32	21	11
Differentiation
Well/moderate	44	29	15	<0.0001
Poor	46	13	33

Notes: Low/high expression was obtained by the sample median. Pearson χ2 test. P<0.05 was considered statically significant.

Abbreviations: BC, breast cancer; SHIP2, SH2-containing inositol 5′-phosphatase 2.

Cell culture

Human normal breast epithelial cell line (HBL-100) and human BC (MCF-7, MDA-MB-231) cell lines were purchased from American Type Culture Collection ( Manassas, VA, USA). Cells were inoculated in RPMI 1640medium (Thermo, USA) supplemented with 10% FBS, 100 µ/mL penicillin (Thermo, USA), 100 mg/mL streptomycin (Thermo, USA). Then, cells were cultured in a saturated humidity incubator (37°C, 5% CO2). Cells were planted in 6-well plate at logarithmic stage, followed by transfection after 24 hrs of culturing.

Cell transfection

SHIP2 gene silencing (RNA interference) and primer sequence synthesis were provided by Shanghai Sangon Biotech Co., Ltd. All transfections were carried out by Lipofectin 2000 transfection kit (Thermo, USA, 11668030) according to the instructions. The untreated cells were used as blank control group (Mock), while the cells treated with SHIP2 siRNA (Santa Cruz Animal Health, USA) and Lipofectamine 2000 transfection reagent were used as a gene silencing group (si-SHIP2). Meanwhile, cells only treated with Lipofectin 2000 was a negative control group (si-NC). Finally, cells of each group were collected for the following experiments. The gene sequence of SHIP2 was introduced into BC cells using the pcDNA3.1 packaging vector using Lipofectin 2000 as an overexpression group (pcDNA-SHIP2). Meanwhile, the transfected empty vector was used as a negative control (pcDNA-NC). All samples were transfected for 24 hrs for further investigation. Furthermore, to detect the effect of lithium chloride (LiCl, Sigma Aldrich, 30 μmol/L) on BC cells, the BC cells MCF-7 were incubated with LiCl for 6 hrs prior to transfection.

CCK-8 assay

All cells were seeded in 96-well plates (6×103 cells/well, 200 μL/well, repeat 6 wells) and incubated at 37°C with 5% CO2. After being incubated for 24 hrs, 48 hrs and 72 hrs, a total of 20 μL CCK-8 (5 mg/mL, Sigma-Aldrich) was mixed with samples and further cultured for 4 hrs, followed by a total of 150 μL DMSO adjunction. The absorbance values of each well at 0 hr, 24 hrs, 48 hrs and 72 hrs were measured, followed by the MTT curve construction.

Colony formation assay

Cells in each group were cultured for 48 hrs and then washed with PBS and digested with 1% trypsin. All the cells were primarily added into 6-well plates (1000 cells/well) with 2.5 mL medium in each well. Ten days later, residual liquid in each well was discarded. After washed by PBS for twice, cells were fixed with 4% paraformaldehyde solution and then stained with crystal violet for 20 mins. Clones were counted automatically by using ImageJ (1.48 V) software and then photographed with an inverted phase contrast microscope (Olympus Ckx53).

PI staining

The cells transfected for 48 hrs were inoculated into 6-well plates (1×105 cells/well). After being washed with PBS, a total of 200 μL cells were incubated in dark with 2 μl Annexin V-FITC solution (BD Bio., USA) and 1 μL of PI solution (30 mins). Then, the apoptosis was recorded by flow cytometry.

Scratch assay

Simply, after adjusting the cell density of each group, the cells were inoculated into the 6-well plate. After drawing a line across the surface of culture medium, washed by PBS and added fresh culture medium, cells were continuous culture for 24 hrs. Then, these cells were recorded under an inverted microscope (Olympus Ckx53) to calculate the cell migration rate.

Transwell assay

After transaction for 48 hrs, cells suspension was placed in a transwell chamber (Corning Corporation, Midland, MI, USA). Then, a total of 900 μL the RPMI 1640 medium with 10% serum was added to the lower compartment of the transwell chamber. Meanwhile, a total of 100 μL Matrigel Matrix was added on the PET film of the upper layer of the chamber. Then, after 12 hrs of culture, the upper chamber was removed, fixed by anhydrous methanol as well as stained with 0.1% crystal violet. Finally, a total of 6 visual fields (400×) were randomly selected for observation under an inverted microscope (Olympus Ckx53).

RT-qPCR

Total RNA from the sample of each group was extracted and quantified using TRIzol reagent, and cDNA template was synthesized by reagent kit (Invitrogen, San Diego, USA). GAPDH (forward: 5′- ACTCGTCATACTCCTGCT -3′; reverse: 5′- GAAACTACCTTCAACTCC -3′) was used as reference. The primer of SHIP-2 was forward: 5′- ACGTGACATCCTGGTTCACA -3′ and reverse: 5′- GCGGTAATCCAGATCCGTAA -3′. The reaction conditions of RT-qPCR were 95°C for 3 min, 40 cycles at 95°C for 10 s and finally 55°C for 1 min. Fluorescence signals were collected at the end points of each cycle extension, followed by the amplification curve investigation. Relative expressions of candidate genes were calculated by 2−∆∆CT method.17

Western blot

Mammary cells HBL-100 and BC BT474/MCF-7 cells were added to the pre-chilled cell lysate and centrifuged at 14,000 rpm for 10 min at 4°C, and the supernatant was aspirated to determine the protein content. Briefly, the extracted proteins were separated by 10% polyacrylamide gels and transferred to polyvinylidenefluoride membranes. After being blocked with 5% Skim milk/PBST, the membrane was treated with primary antibodies including SHIP2 (1:1000, CST, USA, #2730), GSK-3β (1:1000, CST, USA, #9315), β-catenin (1:1000, CST, USA, #8480), LEF (1:1000, CST, USA, #2230), Bcl-2 (1:1000, Santa Cruz Biotechnology, USA, #sc-509), Bax (1:1000, Santa Cruz Biotechnology, USA, #sc-20067), Caspase-3 (1:1000, Santa Cruz Biotechnology, USA, #sc-271759), cyclin D1 (1:1000, Santa Cruz Biotechnology, USA, #sc-8396), MMP-7 (1:1000, Sigma Aldrich, USA, #SAB1406133), AXIN2 (1:1000, Sigma Aldrich, USA, #SAB1100676) and CD44 (1:1000, Sigma Aldrich, USA, #SAB1405590) at 4°C overnight. Then, the membrane was treated with secondary antibody including anti-rabbit IgG in goat (1:10,000, CST, USA, #14708) at room temperature for 1 hr. After washing the film, ECL luminescent reagent was added for exposure and color development. GAPDH (#5174, American CST) was used as an internal reference, and the results were expressed as the expression ratio of target protein to internal reference protein.

Detection of β-catenin levels

Cells in each group were cultured in fresh medium for 24 hrs, washed once with PBS, scraped off the cells and centrifuged to obtain a cell pellet. Briefly, the cytoplasmic protein extraction reagent and the cytoplasmic protein extraction reagent were sequentially added, and then the supernatant was taken up to a pre-cooled EP tube to obtain nuclear protein. The expression level of β-catenin in the nucleus was detected by Western blot.

Rats BC xenograft model construction

To detect the involvement of Wnt/β-catenin pathway in the regulatory role of SHIP2 in vivo, the rats BC xenograft model was constructed. A total of 30 SPF female rats (rnu/rnu; 4–5 weeks; 55–77 g) were purchased from the Shanghai Slack Laboratory Animals Co., Ltd. Rats were general anesthetized by sodium pentobarbital (50 mg/kg), and every effort was made to reduce pain during the operation. Rats were randomly divided into 3 groups (10 in each group) including pcDNA-NC Model group, pcDNA-SHIP2 Model group and pcDNA-SHIP2 Model + ICG001 group. MDA-MB-231 cells cultured to overexpressed SHIP2 in logarithmic growth phase were injected into the deep left side of the rat’s left axillary fossa. Rats in pcDNA-SHIP2 Model group and pcDNA-SHIP2 Model + ICG001 group were injected with pcDNA-SHIP2. After modeling, the pcDNA-SHIP2 Model + ICG001 group was intraperitoneally injected with ICG001 (M2008, Abmole) 10 mg/(kg·d) for 30 days. The growth of the transplanted tumor was examined every 5 days after modeling. After the last measurement, rats were sacrificed by neck dislocation, and the tumor weight was weighed after the tumor was removed. The tumor growth curve was drawn by taking the tumor volume as the ordinate and the time as the abscissa. This study was approved by the ethics committee of our hospital, and all experiments were in accordance with the guide for the care and use of laboratory animals established by United States National Institutes of Health (Bethesda, MD, USA).

Statistical analysis

Data were analyzed using version 17.0 (SPSS, Chicago, IL, USA) and GraphPad Prism 5.0. All data were represented as the mean ± SD. Significant differences between two groups were assessed using Student's t-test. One-way analysis of variance followed by Tukey’s multiple comparison test was processed for comparison more than two groups. P<0.05 was considered as statistically significant.

Results

SHIP was upregulated in BC cells

To investigate the biological function of SHIP2 in BC cells, RT-qPCR and Western blot were performed, and the results showed that the expression of SHIP2 in BC tissues was significantly higher than that in adjacent tissues (P<0.05) (Figure 1A). Moreover, the mRNA expression levels of SHIP2 (Figure 1B) and protein expression levels of SHIP2 (Figure 1C) in MCF-7 and MDA-MB-231 cell lines were significantly higher than those in HBL-100 cells (all P<0.05).

Figure 1

SHIP2 expression in human BC tissues and cells. (A) The expression of SHIP2 in BC tissues and adjacent tissues; *P<0.05 when compared with adjacent tissues using paired t-test. (B) The mRNA expression level of SHIP2 in human normal breast cells HBL-100 and BC cell lines MCF-7/MDA-MB-231; *P<0.05 when compared with HBL-100 group. (C) The protein expression level of SHIP2 in human normal breast cells HBL-100 and BC cell lines MCF-7/MDA-MB-231; *P<0.05 when compared with HBL-100 group. One-way ANOVA followed by Tukey’s multiple comparison test were used for the current study.

Effect of SHIP2 on proliferation and apoptosis of BC cells

The result showed that compared with the Mock group, the expression of SHIP2 in the si-SHIP2 group was significantly downregulated (P<0.05), and the expression level in the pcDNA-SHIP2 group was significantly upregulated (P<0.05) (Figure 2A). Compared with the Mock group, the cell proliferation ability in si-SHIP2 group was significantly decreased (P<0.05), while the proliferation ability of cells in pcDNA-SHIP2 group was significantly increased (P<0.05) (Figure 2B and C). The proliferation-related protein assay showed that the expression levels of cyclin D1 and AXIN2 were significantly downregulated in the si-SHIP2 group compared with the Mock group (all P<0.05). Meanwhile, compared with Mock group, the expression levels of cyclin D1 and AXIN2 in the pcDNA-SHIP2 group were significantly upregulated (all P<0.05) (Figure 2D). Compared with the Mock group, the apoptosis rate of the si-SHIP2 group was significantly increased (P<0.05), while the apoptosis rate of the pcDNA-SHIP2 group was significantly decreased (P<0.05) (Figure 2E). Compared with the Mock group, Bcl-2 protein was significantly downregulated, while Bax and Caspase-3 were significantly upregulated in the si-SHIP2 group (all P<0.05). Meanwhile, compared with the Mock group, Bcl-2 was significantly upregulated, while Bax and Caspase-3 were significantly downregulated in the pcDNA-SHIP2 group (all P<0.05) (Figure 2F). These results indicated that silencing SHIP2 inhibited the proliferation of BC cells and promoted apoptosis, while overexpression SHIP2 induced BC cell proliferation and reduced apoptosis.

Figure 2

Effect of silencing and overexpression of SHIP2 on proliferation and apoptosis of BC cells. (A) qRT-PCR was used to detect the expression of SHIP2 after silencing and overexpression. (B) Proliferation of individual cells of BT474 and MCF-7 BC cell lines. (C) Proliferation detected by the colony formation assay. (D) Cyclin D1 and AXIN2 expression in BC cells. (E) PI double staining was used to detect apoptosis of BC cells in each group. (F) The expression of apoptosis-related gene/proteins in BC cells. One-way ANOVA followed by Tukey’s multiple comparison test were used for the current study. *P<0.05 when compared with Mock group and si-NC group; #P<0.05 when compared with Mock group and pcDNA-NC group.

Effects of SHIP2 silencing and overexpression on BC cells

The effects of SHIP2 silencing and overexpression on migration and invasion of BC cells (BT474 and MCF-7) were investigated using a scratch assay and a transwell assay (Figure 3A and B). Compared with the Mock group, BC cells migration/invasion of the si-SHIP2 group were inhibited (all P<0.05), while the cell migration rate and invasion rate of the pcDNA-SHIP2 group were increased (all P<0.05). Furthermore, RT-qPCR and Western blot were used to detect the expression of CD44 and MMP-7 protein in BC cells after SHIP2 silencing and overexpression (Figure 3C). The results showed that compared with the Mock group, CD44 and MMP-7 expressions were significantly downregulated and upregulated in the si-SHIP2 group and pcDNA-SHIP2 group, respectively (all P<0.05).

Figure 3

Effects of silencing and overexpression of SHIP2 on migration and invasion of BC cells. (A) Migration ability of BC cell detected by scratch assay (200×). (B) Invasive ability of BC cells detected by transwell assay (200×). (C) Western blot was used to detect the expression of CD44 and MMP proteins in BC cells. One-way ANOVA followed by Tukey’s multiple comparison test were used for the current study. *P<0.05 when compared with Mock group and si-NC group; #P<0.05 when compared with Mock group.

Effect of SHIP2 on Wnt/β-catenin pathway in BC cells

After SHP2 gene silencing and overexpression of BC cells, the expressions of Wnt-β-catenin pathway key factors GSK-3β and β-catenin were detected (Figure 4). Compared with the Mock group, GSK-3βprotein expression was significantly upregulated, while β-catenin and LEF were downregulated in the si-SHIP2 group (all P<0.05). Meanwhile, compared with the Mock group, the expression of GSK-3β protein was significantly downregulated, while β-catenin and LEF expression were significantly upregulated in the pcDNA-SHIP2 group (P<0.05). These results indicated that SHIP2 participated in the Wnt/β-catenin pathway by regulating GSK-3β and its downstream genes, which further affected the expression of Wnt/β-catenin pathway target genes.

Figure 4

Effect of SHIP2 on Wnt/β-catenin pathway in BC cells. The results showed the expression of Wnt/β-catenin pathway-related protein in BC cells after SHIP2 silencing and overexpression of SHIP2. One-way ANOVA followed by Tukey’s multiple comparison test were used for current study. *P<0.05 when compared with Mock group and si-NC group; #P<0.05 when compared with Mock group and pcDNA-NC group.

LiCl removed the effect of si-SHIP2 on BC cells

In order to determine whether the role of Wnt/β-catenin pathway is involved in the BC cell activity, proliferation and migration, MCF-7 cells that treated with β-catenin activator LiCl were detected. The results showed that the cell viability (Figure 5A) of si-SHIP2 BC cells were significantly increased after LiCl treatment (all P<0.05). Meanwhile, the apoptosis of si-SHIP2 BC cells was significantly decreased after LiCl treatment (P<0.05) (Figure 5B). In addition, LiCl could increase the migratory and invasive capacities of MCF-7 cells in the si-SHIP2 group compared with the si-SHIP2 group (Figure 5C and D). These results indicated that LiCl could significantly eliminate the effect of si-SHIP2 on BC cells.

Figure 5

Rats transplanted β-catenin activator LiCl eliminated the effect of si-SHIP2 on BC cells. (A) The cell proliferation detected by CCK-8 assay. (B) PI double staining for detection of BC cell apoptosis. (C) Migration ability of BC cell detected by scratch assay (200×). (D) The invasive ability of BC cells detected by transwell assay (200×). *P<0.05, **P<0.01 when compared with si-NC group; #P<0.05, ##P<0.01 when compared with si-SHIP2 group.

Effect of SHIP2 expression on rat BC xenografts

To investigate the functional role of SHIP2 on BC growth in vivo, rats were subcutaneously implanted MDA-MB-231 cells carrying SHIP2 and its corresponding counterparts’ vectors. Overexpression of SHIP2 significantly increased tumor weight and tumor volume (Figure 6A–C, P<0.05). For the role of Wnt/β-catenin pathway, tumor growth was carried out and the results showed that tumor weight and tumor volume were significantly decreased in the pcDNA-SHIP2 Model + ICG001KDM1B group compared with the pcDNA-SHIP2 Model group (Figure 6A–C, P<0.05), suggesting that ICG001KDM1B partly eliminate tumor growth. Furthermore, the expression of Wnt/β-catenin pathway was detected by Western blot (Figure 6D). The results showed that the expression of β-catenin and LEF protein was significantly upregulated in the pcDNA-SHIP2 Model group compared with the pcDNA-NC Model group (P<0.05) and this upregulation expression was hugely counteracted ICG001.

Figure 6

Effect of silencing and overexpression of SHIP2 on BC xenografts of rats. (A) Rat xenografts tumor observed at 30 days MCF-7 xenograft model. (B) Tumor weight. (C) The growth curve of rat BC xenografts. (D) Western blot was used to detect the expression of Wnt/β-catenin pathway. One-way ANOVA followed by Tukey’s multiple comparison test was used for the current study. *P<0.05 when compared with pcDNA-NC model group; #P<0.05 when compared with pcDNA-SHIP2 model group.

Discussion

SHIP2 has been found to be expressed widely and is associated with many human diseases including non-small cell lung cancer,18 BC13 and gastric cancer,19 but its role in BC and the detailed molecular mechanism remains to be not fully reported. In this study, we investigated the role of SHIP2 as an oncogene and potential treatment target in BC. We found that the expression of SHIP2 is increased in BC tissue as compared to (adjacent) noncancerous samples. Our results also revealed that SHIP2 overexpression increases cell proliferation, promotes cell migration and invasiveness, and inhibits cell apoptosis. Meanwhile, our findings demonstrated that the regulatory effect of SHIP2 on BC progress was, at least in part, mediated through Wnt/β-catenin pathway.

The special role of certain gene or molecular in cancer progression is commonly evaluated by the influence on cell proliferation, migration, invasion and apoptosis.20,21 A previous study shows that the SHIP2 aggravates apoptosis in D2-associated protein-deficient podocytes.22 In gastric cancer cell, the downregulation of SHIP2 is proven to participate in the tumorigenesis and proliferation.23 In HepG2 cells, the inhabitation of palmitate-induced apoptosis can be reversed by suppression of SHIP2 expression.24 This promoting effect of SHIP2 on the apoptosis has also been proved in erythroid AS-E2 cells.25 Overexpression of SHIP2 is also found to be closely related to migration, further indicating a oncogenic role of SHIP2 in BC.26 In addition, upregulation of obesity-associated phosphatase SHIP2 contributed to the cell invasion and migration in BC.9,11 Interestingly, the upregulation of SHIP2 directly leads to the poor survival of patients with cancer.27 In this study, the RT-qPCR and Western blot analysis showed that the expression levels of SHIP2 in BC tissues (or BC cells) were significantly higher than that in adjacent tissues (or normal breast cells). Meanwhile, silencing SHIP2 inhibited the proliferation of BC cells and promoted apoptosis, while upregulation of SHIP2 enhanced the migration/invasion of BC cells. Thus, we speculated that the overexpression of SHIP2 might promote the migration, invasion, and proliferation, as well as inhibit apoptosis in BC.

Wnt/β-catenin signal transduction cascade controls myriad biological phenomena.14 Wnt/β-catenin has been found to participant in the mediates resistance based on an animal model.28 Upregulation of genes in Wnt/β-catenin pathway redirect mammary tumor phenotype.29 In addition, suppression of Nitro-aspirin in MCF-7 BC cell growth is visualized by Wnt/β-catenin/TCF-4 signaling pathway.30 By suppressing the expression of Wnt/β-catenin pathway, Fucoidan can inhibit mouse BC cell growth in vivo and in vitro.31 Actually, some genes such as SOX9 and Med12 can promote tumor metastasis and proliferation by upregulation of Wnt/β-catenin signaling.32,33 In this study, the expression detection of Wnt/β-catenin after SHIP2 silencing and overexpression showed that SHIP2 participated in the Wnt/β-catenin pathway by regulating GSK-3β and its downstream genes. Meanwhile, the β-catenin activator LiCl eliminated the effect of si-SHIP2 on BC cells. Thus, we speculated that SHIP2 might promote the development of BC via activating the Wnt/β-catenin pathway.

Conclusion

In conclusion, overexpression of SHIP2 might promote the migration, invasion, and proliferation, as well as inhibit apoptosis in BC. Furthermore, SHIP2 might promote the development of BC via activating the Wnt/β-catenin pathway.