Genetic characterization of Angiostrongylus larvae and their intermediate host, Achatina fulica, in Thailand.

Angiostrongyliasis is a parasitic disease caused by nematodes of the genus Angiostrongylus. Distribution of this worm corresponds to the dispersal of its main intermediate host, the giant African land snail Achatina fulica. Genetic characterization can help identify parasitic pathogens and control the spreading of disease. The present study describes infection of A. fulica by Angiostrongylus, and provides a genetic outlook based on sequencing of specific regions. We collected 343 land snails from 22 provinces across six regions of Thailand between May 2017 and July 2018. Artificial digestion and Baermann's technique were employed to isolate Angiostrongylus larvae. The worm and its intermediate host were identified by sequencing with specific nucleotide regions. Phylogenetic tree was constructed to evaluate the relationship with other isolates. A. fulica from Chaiyaphum province was infected with A. cantonensis, whereas snails collected from Phrae and Chiang Rai provinces were infected with A. malaysiensis. The maximum likelihood tree based on 74 A. fulica COI sequences revealed monophyletic groups and identified two haplotypes: AF1 and AF2. Only AF1, which is distributed in all regions of Thailand, harbored the larvae of A. cantonensis and A. malaysiensis. Two mitochondrial genes (COI and cytb) and two nuclear regions (ITS2 and SSU rRNA) were sequenced in 41 Angiostrongylus specimens. The COI gene indicated that A. cantonensis was closely related to the AC10 haplotype; whereas the cytb gene revealed two new haplotypes: AC19 and AC20. SSU rRNA was useful for the identification of A. cantonensis; whereas ITS2 was a good genetic marker for differentiating between A. cantonensis and A. malaysiensis. This study provides genetic information about the parasite Angiostrongylus and its snail intermediate host. The data in this work may be useful for further study on the identification of Angiostrongylus spp., the genetic relationship between intermediate host and parasite, and control of parasites.

Introduction

Angiostrongylus is a parasitic nematode from the superfamily Metastrongyloidea [1]. To date, 21 species of this genus have been reported around the world, with A. cantonensis and A. costaricensis being the most notable [2]. A. cantonensis is the causative agent of human angiostrongyliasis associated with eosinophilic meningitis or meningoencephalitis. Ocular and neuro-angiostrongyliasis are reported as sporadic in Asian counties [3-5]. A. costaricensis causes abdominal angiostrongyliasis and most cases are reported in South America [6,7]. Other veterinary-relevant species include A. malaysiensis, A. mackerrasae, and A. vasorum, which act as animal pathogens [2,8]; although, A. malaysiensis, which is epidemic in Asian countries, may cause also human angiostrongyliasis [9]. In Thailand, A. cantonensis, A. siamensis, A. malaysiensis, and Thaistrongylus harinasuti have been recorded in several hosts [8,10]. A. cantonensis is the main causative agent of human angiostrongyliasis in Thailand, whereas A. malaysiensis is reported with increasing extent in the Greater Mekong area. To complete the life cycle, A. cantonensis and A. malaysiensis use snails and terrestrial slugs as intermediate hosts, and rodents as their final hosts [11]. Humans are an accidental host, and become infected by ingesting Angiostrongylus larvae present in snails, slugs, paratenic hosts or on contaminated vegetables [12-14]. Clinical manifestations of human angiostrongyliasis include severe headache, and neck stiffness with eosinophilic meningitis or meningoencephalitis. Most cases of the disease are reported in Thailand, Taiwan, and southern China [1].

The giant African land snail Achatina fulica is an important intermediate host for A. cantonensis [15]. In the 19th Century, this land snail was dispersed by humans across the Indian Ocean from Africa to India, Sri Lanka, and Southeast Asia [16]. In Thailand, most snails were accidentally moved across geographic locations on agricultural products or transportation containers. A. fulica is abundant in tropical climates with warm, mild year-round temperatures and high humidity [17]. The snail causes damage to vegetables and other food crops [18,19]. The spreading of A. fulica was affected also by dispersal of the rat lungworm, particularly in the Pacific [20]. Not surprisingly, the giant African land snail has been listed among the 100 worst invasive species and is considered the most damaging land snail in the world [17]. However, only a few genetic studies of A. fulica have been reported to date and none of them in Thailand.

Genetic characterization is important for the identification of parasitic pathogens, as well as to control the spreading of disease. Sequencing and phylogenetic studies of A. cantonensis based on mitochondrial or ribosomal genes have been used to identify and study the evolution and distribution of this species. Several genes or nucleotide regions from A. cantonensis have been used in genetic studies so far: 66-kDa protein [21], ribosomal transcribed spacer (ITS) regions [22,23], small subunit (SSU) ribosomal RNA (18S rRNA) [22,24,25], cytochrome c oxidase subunit I (COI) [9,26], and cytochrome b (cytb) [27,28]. In comparison, only a few studies have tried to characterize A. malaysiensis in Thailand [9]. Therefore, to gain further knowledge about the genetic make-up of Angiostrongylus spp. and its natural intermediate host, A. fulica, in Thailand, the present study sought to observe larval infection by Angiostrongylus in A. fulica. Analysis of A. cantonensis COI, SSU rRNA, ITS2, and cytb gene sequences and the ITS2 region of A. malaysiensis enabled construction of a phylogenetic tree. Finally, sequencing of the A. fulica COI gene, allowed for haplotype analysis and genetic structure characterization of this snail species.

Methods

Ethics statement

The experimental protocol for the use of animals (snail intermediate host) in this study was approved by the Center for Animal Research of Naresuan University (Project Ethics Approval No: NU-AQ610711). The biosafety protocol was approved by the Naresuan University Institutional Biosafety Committee (Project Approval No: NUIBC MI 61-08-50).

Collection of Achatina fulica

Achatina fulica was randomly collected between May 2017 and July 2018 from 22 provinces across Thailand (Uttaradit, Chiang Rai, Chiang Mai, Nan, Phrae, Phitsanulok, Phetchabun, Bangkok, Lop Buri, Phra Nakhon Si Ayutthaya, Nakhon Sawan, Rayong, Nakhon Ratchasima, Buri Ram, Maha Sarakham, Chaiyaphum, Udon Thani, Nakhon Phanom, Prachuap Khiri Khan, Pattani, Chumphon, and Surat Thani) (and . No specific permission was required for sampling snail in public locations. The snails were collected from several habitats (e.g., under leaf litter and under or above dried trees) by hand picking and were placed in a plastic box with air ventilation. The snails were then transported at ambient temperature to the Department of Microbiology and Parasitology, Faculty of Medical Science, Naresuan University, Phitsanulok, Thailand. All specimens were identified through comparison of shell morphology according to previous studies [29,30] Schotman (1989) and Jena et al. (2017); the conical shell of A. fulica was identified as wider at its operculum and tapering at its apex. The size of the shell was approximately 9.0–12.0 cm in length and 4.0–5.0 cm in width. The coloration and vertical stripes were dark brownish, and alternated by a cream tinge.

Map of sampling location and distribution of Achatina fulica, Angiostrongylus cantonensis, and A. malaysiensis in Thailand.

Details of collection sites are given in Table 1.

Table 1

Locations in Thailand where Achatina fulica was collected and number of corresponding COI haplotypes.

Regions	Location	Code	Latitude	Longitude	Number of samples	Haplotype name	Number of haplotypes
North	Uttaradit	UTT	17.620088	100.099294	2	AF1	2
	Chiang Rai	CRI	19.907165	99.830955	4	AF1	4
	Chiang Mai	CMI	18.706064	98.981716	2	AF1	2
	Nan	NAN	18.775631	100.773041	4	AF1	4
	Phrae	PRE	18.144577	100.140283	4	AF1	4
Central	Phitsanulok	PLK	17.036385	100.583513	3	AF1	3
	Phetchabun	PNB	16.301669	101.119280	4	AF1	4
	Bangkok	BKK	13.756330	100.501765	4	AF1	4
	Lop Buri	LRI	14.799508	100.653370	1	AF1	1
	Phra Nakhon Si Ayutthaya	AYA	14.353212	100.568959	3	AF1	3
	Nakhon Sawan	NSN	15.693007	100.122559	4	AF1	4
East	Rayong	RYG	12.707434	101.147351	3	AF1	3
Northeast	Nakhon Ratchasima	NMA	14.979899	102.097769	2	AF1	2
	Buri Ram	BRM	14.993001	103.102919	3	AF1	3
	Maha Sarakham	MKM	16.013201	103.161516	4	AF1	4
	Chaiyaphum	CPM	15.806817	102.031502	4	AF1	4
	Udon Thani	UDN	17.413841	102.787232	4	AF2	4
	Nakhon Phanom	NPM	17.392039	104.769550	3	AF1	3
South	Pattani	PTN	6.761830	101.323254	4	AF1	4
	Chumphon	CPN	10.493049	99.180019	4	AF1	4
	Surat Thani	SNI	9.138238	99.321748	4	AF1	4
West	Prachuap Khiri Khan	PKN	11.812367	99.797327	4	AF1	4

Isolation of Angiostrongylus larvae from Achatina fulica

The body of A. fulica was removed from the shell. The mantle and foot of the land snail (approximately 25 mm3) were cut by a razor blade and kept at -20°C for further molecular analysis. To isolate Angiostrongylus larvae, most of the remaining snail’s body was mixed with 50–100 mL of 0.7% pepsin solution (Acros Organics, Geel, Belgium) and minced in a blender. The mixed solution was transferred to a beaker and incubated in a water bath at 37°C until the majority of the tissue was dissolved (1–2 h). The digested tissue solution was then placed in a Baermann apparatus, which consisted of a grass funnel connected to a short piece of rubber tubing at the outlet. The funnel, supported by a wire mesh, was covered with a layer of gauze and was let stand for 30–60 min to allow larval migration to the funnel’s neck. The filtered liquid containing mainly larvae was transferred to a Petri dish. The larvae were identified as described previously [11]. Angiostrongylus larvae were collected using a sterile Pasteur pipette under a stereomicroscope, transferred to a 1.5-mL microcentrifuge tube, and stored at -20°C for molecular analysis.

Extraction of genomic DNA

Genomic DNA from individual land snails and from third-stage larvae of Angiostrongylus was extracted using the NucleoSpin® Tissue kit (Macherey-Nagel, Duren, Germany) following the manufacturer’s instructions. The genomic DNA solution was checked by running it on a 0.8% agarose gel in 1× TBE buffer at 100 V. The gel was stained with ethidium bromide, followed by destaining with distilled water and photographed under u.v. light. The DNA solution was kept at -20°C for further use.

PCR and sequencing

PCR was used to amplify a partial region of the COI gene of A. fulica. A set of primers, AfCOI_F (5′-TGTGGGTTAGTTGGCACAGG-3′) and AfCOI_R (5′-TTAAGGGCGGGTACACAGTC-3′), was designed based on the deposited GenBank sequence (accession no. KT290318) using the Primer-BLAST program. The primers were used to amplify a 319-bp fragment. The reaction mixture was prepared in a total volume of 30 μL containing 3 μL of 10× buffer (1×), 2.1 μL of 25 mM MgCl2 (1.75 mM), 0.6 μL of 200 mM dNTPs (4 mM), 1.2 μL of 5 μM of each primer (0.2 μM), 0.3 μL of 5 U/mL Taq DNA polymerase (0.05 U/mL), 18.6 μL of distilled water, and 3 μL of DNA template (20–200 ng). The PCR conditions included initial denaturation at 95°C for 1 min, followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 50°C for 40 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min. The PCR was performed in a Biometra TOne Thermal cycler (Analytik Jena AG, Jena, Germany). The amplified products were analyzed by 1.2% agarose gel-electrophoresis, stained with ethidium bromide, destained with distilled water, and visualized and photographed under u.v. light. The amplified PCR products were then purified using a NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). Two volumes (56 μL) of buffer NTI were added to the tube containing the PCR product solution (28 μL). The mixture was then transferred onto a NucleoSpin® Gel and PCR Clean-up Column and centrifuged at 11,000 × g for 30 s. Buffer NT3 (700 μL) was added to the tube and this was centrifuged again at 11,000 × g for 30 s. The column was transferred to a new 1.5-mL microcentrifuge tube, followed by addition of 30 μL of elution buffer and incubation at room temperature (25°C) for 1 min. The tube was centrifuged at 11,000 × g for 1 min. The purified PCR product was checked on a 1.2% agarose gel in 1× TBE buffer at 100 V. The gel was stained with ethidium bromide, followed by destaining with distilled water and photographed under u.v. light. The purified PCR products were shipped to Macrogen Inc., Seoul, Korea, for sequencing in both forward and reverse directions.

For Angiostrongylus, PCR was used to amplify the selected nucleotide regions (COI, ITS2, SSU rRNA, and cytb for A. cantonensis and ITS2 for A. malaysiensis). Specific primers are listed in . The reaction mixture was prepared in a total volume of 30 μL, containing 15 μL of EconoTaq® PLUS 2× Master mix (1×; Lucigen Corporation, Middleton, WI, USA), 1.5 μL of 5 μM of each primer (0.25 μM), 9 μL of distilled water, and 3 μL of DNA template (20–200 ng). PCR conditions for amplifying COI, ITS, and SSU rRNA were as described by Rodpai et al. (2016); whereas those for amplifying cytb were as described by Dusitsittipon et al. (2015). All PCR amplifications were conducted in a Biometra TOne Thermal cycler. The amplified products were analyzed by 1.2% agarose gel-electrophoresis as mentioned above, and then purified using a NucleoSpin® Gel and PCR Clean-up kit as mentioned above. The PCR products were sequenced in both the forward and reverse direction by Macrogen Inc.

Sequence and phylogenetic analysis

All sequences were edited by viewing the peak of the chromatogram in SeqMan II software (DNASTAR, Madison, WI, USA). Species identification of Angiostrongylus and Achatina was confirmed by a BLASTN search, whereby similarity with known sequences in the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was determined. The maximum likelihood (ML), neighbour joining (NJ) and maximum parsimony (MP) phylogenetic trees were constructed based on a Kimura 2-parameter model for SSU rRNA and cytb alignment, Tamura 3-parameter model for ITS2 alignment, and the General Time Reversible model for COI alignment with 1,000 bootstrap replicates using MEGA 7 software [32]. Bayesian analysis were performed based on Markov chain Monte Carlo method in MrBayes v3.2 [33-35]

Haplotype diversity (h) and nucleotide diversity (𝜋) for A. fulica were calculated in ARLEQUIN, version 3.5.1.2 [36]. Population pairwise FST (p < 0.05) calculated in ARLEQUIN was used to infer the genetic structure of A. fulica from the six different sampled regions.

Results

Infection of Angiostrongylus in Achatina fulica

A total of 1,595 Angiostrongylus larvae were isolated from 343 A. fulica collected in 22 provinces across Thailand. These included 13 and 1,269 A. malaysiensis larvae isolated from A. fulica collected in Phrae and Chiang Rai provinces in northern Thailand, respectively; as well as 313 A. cantonensis larvae from A. fulica collected in Chaiyaphum province, northeast Thailand (). A total of 41 Angiostrongylus spp. specimens and 74 individual land snails were randomly selected for further genetic studies.

Genetic characterization of Achatina fulica

A partial region of the COI gene from 74 individual snails collected in different locations was amplified by PCR and sequenced. PCR amplicons were 319 bp in length. Based on an edited stretch of 291 bp, all sequences showed high similarity (99–100%) with the known COI sequence of A. fulica (GenBank accession no. MF415341). All 74 sequences of A. fulica COI in the present study were deposited in the NCBI database (GenBank accession nos. MK858335-MK858408). The phylogenetic tree of the 74 COI sequences of A. fulica collected across Thailand revealed a monophyletic cluster with bootstrap and Bayesian posterior probability values (61/62/-/85%). It could be grouped together with A. fulica from the United Kingdom and the United States ().

Maximum likelihood phylogenetic tree generated from 74 sequences of a partial COI sequence (291 bp) of A. fulica collected across Thailand.

Support values (ML bootstrap/NJ bootstrap/MP bootstrap/Bayesian posterior probabilities) show above the branches of the phylogenetic tree. At the branches of the tree, a dash (-) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate sequences obtained in the present study. Archachatina marginata was used as the out-group. TH, Thailand; UK, United Kingdom; USA, United States of America; NG, Nigeria.

Two haplotypes were identified and named as AF1 and AF2 (and . All nucleotides in haplotypes AF1 and AF2 were the same except for the nucleotide at position 161, which corresponded to a “T” in AF1 and a “C” in AF2. Haplotype AF1 was found in the northern, central, eastern, northeastern, southern, and western regions of Thailand; whereas haplotype AF2 was found in Udon Thani province, northeast Thailand. shows the haplotype and nucleotide diversity of A. fulica COI sequences. In northeastern Thailand, haplotype and nucleotide diversity were found among 20 specimens. Population pairwise FST analysis revealed no genetic differentiation among populations from northern, central, eastern, northeastern, southern, and western Thailand (.

Genetic characterization of Angiostrongylus

Partial sequences of SSU rRNA, COI, cytb, and ITS2 regions from 41 Angiostrongylus specimens were determined by PCR and sequencing. BLASTN search results relative to these four nucleotide regions are shown in . Based on 839 bp of the SSU rRNA gene, 14 specimens (GenBank accession nos. MK858285-MK858298) of Angiostrongylus showed 100% identity with A. cantonensis (GenBank accession no. KU528682). The maximum likelihood tree derived from all sequences of SSU rRNA from the present study was grouped together with A. cantonensis from Thailand (GenBank accession nos. KU528687 and KU528682) and Japan (GenBank accession no. AY295804) (. Phylogenetic tree showed well support values (98/97/95/100%). There was no difference in p-distance for intraspecific divergence within A. cantonensis (.

Maximum likelihood phylogenetic tree of A. cantonensis based on a partial SSU rRNA sequence (839 bp).

Support values (ML bootstrap/NJ bootstrap/MP bootstrap/Bayesian posterior probabilities) show above the branches of the phylogenetic tree. Bold letters indicate sequences obtained in the present study. Metastrongylus salmi was used as the out-group. TH, THA, Thailand; JPN, Japan.

Based on a partial COI sequence (478 bp) of Angiostrongylus, 16 sequences (GenBank accession nos. MK734431-MK734446) from this study showed 100% similarity with the known sequence of A. cantonensis (GenBank accession no. KU532147). The maximum likelihood tree of 16 Angiostrongylus COI sequences was grouped together with the identified haplotypes of A. cantonensis AC10 (GenBank accession no. KU532147) (. All sequences were formed a monophyletic group with support values of 66/64/83/85%. There was no difference in p-distance for intraspecific divergence within A. cantonensis (S3 Table).

Maximum likelihood tree based on a partial COI sequence (478 bp) of 16 samples of A. cantonensis from Thailand, together with A. cantonensis haplotypes AC1-AC16.

Support values (ML bootstrap/NJ bootstrap/MP bootstrap/Bayesian posterior probabilities) show above the branches of the phylogenetic tree. At the branches of the tree, a dash (-) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate sequences obtained in the present study. A. vasorum and A. costaricensis were used as out-groups. TH, Thailand.

All ten cytb sequences (853 bp) from the present study (GenBank accession nos. MK858275-MK858284) showed 99–100% identity to the known sequence of A. cantonensis (GenBank accession no. KP721446). The phylogenetic tree of the cytb sequence revealed that ten sequences from the present study were closely related to A. cantonensis AC1 (GenBank accession no. KP721446), AC2 (GenBank accession no. KC995263), AC3 (GenBank accession no. KP721449), AC4 (GenBank accession no. KC995278), AC5 (GenBank accession no. KP721447), AC6 (GenBank accession no. KP721442), AC7 (GenBank accession no. KC995190), and AC8 (GenBank accession no. KC995205) (. Six sequences from this study were similar to A. cantonensis haplotype AC1. In addition, three sequences were identified as belonging to the new haplotype AC19 with support values of 65/63/-/93% and one to the haplotype AC20 with support values of 62/78/56/-%. Comparison of nucleotide sequences between these two new haplotypes and 18 previously reported haplotypes is presented in S4 Table. Intraspecific distances within A. cantonensis ranged from <0.1% to 0.9% (.

Maximum likelihood phylogenetic tree of A. cantonensis based on a partial cytb sequence (853 bp).

Support values (ML bootstrap/NJ bootstrap/MP bootstrap/Bayesian posterior probabilities) show above the branches of the phylogenetic tree. At the branches of the tree, a dash (-) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate sequences obtained in the present study. A. costaricensis, A. malaysiensis, and A. vasorum are included in the tree. TH, Thailand.

The ITS2 sequences (278 bp) from 20 specimens in the present study (GenBank accession nos. MK858299-MK858318) displayed 100% similarity to A. cantonensis (GenBank accession no. KU528692). A maximum likelihood tree showed that all 20 sequences fell in the A. cantonensis groups from Thailand (GenBank accession nos. KU528688 and KU528692), the Philippines (GenBank accession nos. EU636007 and EU636008), China (GenBank accession nos. HQ540546, HQ540549, and HQ540551), United States (GenBank accession no. KU528689), and Spain (GenBank accession no. GQ181112) (. In addition, sixteen ITS2 sequences (268 bp) of Angiostrongylus larvae from this study (GenBank accession nos. MK858319-MK858334) showed 100% identity to A. malaysiensis (GenBank accession no. KU528697). Based on the maximum likelihood tree, all A. malaysiensis sequences fell in the A. malaysiensis groups from Thailand (GenBank accession no. KU528695), Laos (GenBank accession no. KU528697), and Myanmar (GenBank accession no. KU528694) (). Two major clades of phylogenetic tree based on ITS2 sequences showed clearly distinguished between A. cantonensis and A. malaysiensis with support values of 100/97/100/100% and 100/83/100/66%, respectively (). Interspecific distances between A. cantonensis and A. malaysiensis sequences ranged from 14.8% to 15.5% (. Intraspecific distances among A. cantonensis samples were <0.4–0.7%. There was no difference in p-distance for intraspecific divergence within A. malaysiensis ( and .

Maximum likelihood phylogenetic tree of A. cantonensis and A. malaysiensis based on a partial ITS2 sequence (278 bp).

Support values (ML bootstrap/NJ bootstrap/MP bootstrap/Bayesian posterior probabilities) show above the branches of the phylogenetic tree. At the branches of the tree, a dash (-) instead of a numerical support value indicates that a certain grouping was not seen by that method of analysis. Bold letters indicate sequences obtained in the present study. A. costaricensis, A. vasorum, and A. chabaudi are included in the tree. TH, THA, Thailand; CHN, China; PHL, Philippines; LAO, Laos; MMR, Myanmar; USA, United States of America; ESP, España.

Discussion

The present study describes infection of A. fulica with A. cantonensis and A. malaysiensis in Thailand. Earlier studies on the prevalence of A. cantonensis reported infection rates of up to 90% [37,38]; these estimates were lowered in later studies to 36.4% [39]. Recently, several surveys of A. cantonensis larvae in A. fulica were reported from various provinces in Thailand, their infection rates ranging between 1.1% and 7.6% [26,27,40]. Such low infection rates may be ascribed to variability in the presence and abundance of A. cantonensis in different environments, as well as to abiotic factors, such as humidity and temperature. The distribution of infected rats, the species of rats, and the interactions between gastropods and rats may determine the prevalence of A. cantonensis in snails [41]. In addition, we found A. fulica infected with A. malaysiensis in the north (Phrae and Chiang Rai provinces) of the country; in agreement with a previous report that detected A. malaysiensis in the northern Mae Hong Sorn and Tak provinces. Because this nematode is found also in the south (Phatthalung and Phang Nga provinces) of the country, close to Malaysia [9,28], A. fulica is a possible intermediate host for A. cantonensis and A. malaysiensis throughout Thailand. Moreover, A. fulica is implicated in an increased distribution of A. cantonensis in China and Japan [29,42]. At present, most human angiostrongyliasis cases are reported in the northeast of Thailand, but transmission of Angiostrongylus species reflects the dispersal of intermediate and definitive hosts. Accordingly, spreading of the African giant land snail can potentially augment the dispersion of angiostrongyliasis cases.

In the present study, genetic characterization of A. fulica collected from across Thailand was studied based on sequencing of the COI gene. The phylogenetic tree showed a monophyletic group for A. fulica in Thailand, suggesting that a single lineage of this snail had been introduced in the country. Interestingly, this lineage was closely related to A. fulica from the United Kingdom and the United States. Accordingly, these giant African land snail populations may share a common ancestor that was brought to each country by human intervention. In a previous study, A. fulica from Odisha state in India was closely related to A. fulica from Bangalore, Kerala, Africa, Cameroon, and China [30]. That result differs from the present one relating the Thai, UK, and USA isolates to a common origin, and demonstrates the existence of multiple lineages of this snail around the world, all originating from the African continent. The population genetic structure of A. fulica in Thailand revealed no difference between the six sampled regions. This uniformity may be due to gene flow within the A. fulica population in Thailand. Indeed, A. fulica was first introduced into Thailand from Malaysia in 1937 [43]. Five years after the first presumed entry, A. fulica population increased dramatically and expanded to several other parts of the country [44]. By analyzing the COI gene sequence, we identified two haplotypes (AF1 and AF2) of A. fulica. However, diversity between the two haplotypes was detected only in the northeast of Thailand, possibly as a result of the founder effect [45]. Importantly, in the present study, A. fulica haplotype AF1 from the northeast and north of Thailand was naturally infected with A. cantonensis and A. malaysiensis; whereas haplotype AF2, which is restricted to the northeast of the country, was not infected with any of the two Angiostrongylus species. At present, it is difficult to explain why A. fulica haplotype AF1 seems to be more susceptible to Angiostrongylus infection than haplotype AF2.

Genetic characterization of A. cantonensis in the present study was achieved through sequencing of SSU rRNA, ITS2, COI, and cytb nucleotide regions. Based on the COI maximum likelihood tree, A. cantonensis (16 specimens) collected from Chaiyaphum province was closely related to A. cantonensis AC10, which was collected from the closely located Khon Kaen province. Sixteen COI-based haplotypes (AC1-AC16) of A. cantonensis have been reported from several parts of the world [9,31,46]. Haplotypes AC1, AC2, AC3, AC5, and AC7 were reported in Japan; haplotypes AC8 and AC9 were reported in Brazil; and haplotype AC6 was found in China (31, 46). In Thailand, the different haplotypes of A. cantonensis appeared confined to specific localities: haplotype AC4 to Bangkok in the central part of the country, AC10 and AC11 to Khon Kaen province in the northeast, AC13 to Surat Thani province in the south, AC14 to Kanchanaburi province in the west, AC15 to Trat province in the east, and AC16 to Chanthaburi province in the east. This distribution corresponds to our finding of the AC10 haplotype in Chaiyaphum province in the northeast of Thailand. Therefore, the COI region represents a good marker for studying the genetic evolution and differentiation of Angiostrongylus spp. [47], as well as to distinguish geographical isolates of A. cantonensis [46] and to identify its haplotypes [48].

In the present study, SSU rRNA sequences of A. cantonensis isolated from Chaiyaphum province shared a single phylogenetic group. All 14 sequence samples were closely related to the Thai and Japanese isolates. This was confirmed by the lack of difference between intraspecific distances within A. cantonensis isolates. Previous studies have reported little variation of the nuclear small subunit (SSU) rRNA sequences within a nematode species but substantial divergence among species, allowing for species differentiation [22,24,31]. Therefore, the SSU rRNA gene has been used to identify A. cantonensis and for the discrimination of Angiostrongylus species [24,31].

In this study, A. cantonensis cytb sequences (10 specimens) from Chaiyaphum province were closely related to AC1-AC8 cytb haplotypes found across several provinces in Thailand. However, most sequences (six specimens) were similar to cytb haplotype AC1, suggesting that this may be the dominant haplotype in Thailand. In addition, we identified two new cytb haplotypes: AC19 (three sequences) and AC20 (one sequence). Previous studies reported 15 haplotypes (AC1-AC15) based on the cytb sequence in Thailand; two haplotypes (AC16 and AC18) were reported in China; and one haplotype (AC17) was reported in Hawaii [27,28]. In Thailand, cytb haplotypes were distributed at random throughout the country; AC1 in Phitsanulok and Prachuap Khiri Khan provinces; AC2 in Prachuap Khiri Khan province; AC3 in Chiang Rai province; AC4 in Phitsanulok province; AC5 in Chiang Mai province; AC6 in Samut Prakan province and Bangkok; AC7 in Bangkok; AC8 in Kanchanaburi province; AC9 in Bangkok; AC10 in Nan, Surat Thani, and Nakhon Si Thammarat provinces; AC11 in Khon Kaen province; AC12 in Nan and Lop Buri provinces; AC13 in Maha Sarakham province; AC14 in Lop Buri province; and AC15 in Maha Sarakham province [28]. A larger sample size may reveal a clearer relationship between the cytb haplotype of this worm and localization in Thailand.

ITS2 sequences revealed differences between A. cantonensis and A. malaysiensis. The genetic distance between A. cantonensis and A. malaysiensis was 14.8–15.5%, whereas intraspecific distances among A. cantonensis were <0.4–0.7% and there was no intraspecific divergence within A. malaysiensis. Our findings are similar to those reported previously [9,23,49] and suggest that the ITS2 sequence might be useful for the identification of Angiostrongylus species [23,49].

Conclusions

In summary, we describe here the genetic characterization of A. cantonensis and A. malaysiensis isolated from the giant African snail A. fulica in Thailand. Two haplotypes (AF1 and AF2) of A. fulica were identified for the first time based on sequencing of the COI gene. Only haplotype AF1 of A. fulica was infected with A. cantonensis and A. malaysiensis. This confirmed that A. cantonensis and A. malaysiensis were found across the country. A. fulica is the main intermediate host for transmission of Angiostrongylus spp. in nature. The COI and cytb genes of A. cantonensis are suitable for phylogenetic studies, whereas the SSU rRNA gene is appropriate for identification. The ITS2 nucleotide region represents a good genetic marker for distinguishing between A. cantonensis and A. malaysiensis. Two new additional cytb haplotypes of A. cantonensis (AC19 and AC20) were identified in this study. A larger sample will help future studies on the genetics of this nematode species. This study provides basic genetic information about the parasite Angiostrongylus and its snail intermediate host, A. fulica.

Mitochondrial DNA genealogy for 78 cytochrome c oxidase I (COI) sequences (74 sequences from Thailand and 4 sequences from other geographical regions) of A. fulica constructed by median joining network method.

Each haplotype is represented by a circle. Sizes of circles are relative to number of individuals sharing specific haplotype.

(TIF)

Click here for additional data file.

Number of Achatina fulica used for artificial digestion method collected across Thailand.

(PDF)

Click here for additional data file.

Pairwise p-distances SSU rRNA gene within A. cantonensis samples.

(XLS)

Click here for additional data file.

Pairwise p-distances COI gene within A. cantonensis samples.

(XLS)

Click here for additional data file.

Variable nucleotide position within the cytb gene of A. cantonensis.

(XLS)

Click here for additional data file.

Pairwise p-distances cytb gene within A. cantonensis samples.

(XLS)

Click here for additional data file.

Pairwise p-distances ITS2 within A. cantonensis and A. malaysiensis samples.

(XLS)

Click here for additional data file.

Pairwise p-distances ITS2 within A. cantonensis samples.

(XLS)

Click here for additional data file.

Pairwise p-distances ITS2 within A. malaysiensis samples.

(XLS)

Click here for additional data file.

22 Jul 2019

PONE-D-19-18473

Genetic characterization of Angiostrongylus larvae and their natural intermediate host, Achatina fulica, in Thailand

PLOS ONE

Dear Dr. Vitta,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

==============================

The MS brings informative results of the distribution of Angiostrongylus and the snail intermediate host in Thailand.

The comments and suggestions of the reviewers were complementary and the authors should address all the items suggested if possible.

Improvement on the text is necessary. Organizing better the ideas, specially in the discussion. The methodology should be written in a more concise manner. The map presented as a supplementary material could be a figure in the article, with data of snails/haplotypes and Angiostrongylus/haplotypes. Also in the discussion, the correlation of haplotype and final hosts (human infection if possible) would be an interesting and informative point in this MS.

We would appreciate receiving your revised manuscript by Sep 05 2019 11:59PM. When you are ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter.

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled 'Manuscript'.

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out.

We look forward to receiving your revised manuscript.

Kind regards,

Marcello Otake Sato, Ph.D., D.V.M.

Academic Editor

PLOS ONE

Journal Requirements:

1. When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

http://www.journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and http://www.journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why.

Additional Editor Comments:

The MS brings informative results of the distribution of Angiostrongylus and the snail intermediate host in Thailand. However, improvement on the text is necessary. The methodology should be written in a more concise manner. The map presented as a supplementary material could be a figure with data of snails/haplotypes and Angiostrongylus/haplotypes. Also in the discussion, the correlation of haplotype and human infection (if possible) would be an interesting and informative point in this MS.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: No

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: PONE-D-19-18473

This is a very nice set of data, with genetic studies of Angiostrongylus and its intermediate host in a wide an important endemic area.

The title: what do authors mean by “natural”? I can think of two meanings: “that can be found naturally infected” and “well-adapted”. I suggest to remove this word from the title since it does not add any fundamental information besides the main objective.

Line 73: As commented above, I see no reason to include “in nature”.

Line 84- Sure that genetic studies are fundamental, but the linkage between this study and “disease control” or specifically angiostrongyliasis control is not clear. Perhaps authors may re-write or clarify.

Line 100- “…an invasive land snail..” is not needed here as this was just addressed in the previous section.

Tables- formatting shall be revised according to PLoS One instructions.

Figures- They also need improvement for better quality.

Figure 1- the map of Thailand showing places where collection was performed. A much nicer presentation would be the indication of collection places with dots corresponding to exact geographic coordinates (geo-referencing). This shall be the informative mode of presenting geographic occurrence data, since just painting the geographic area of province is less informative.

Results- one very important information is the distribution of individual larvae counts. I strongly suggest authors to provide this information ina suppplementary file or to add it in manuscript and explore it. It gives a very nice opportunity to discuss the degree of parasite-host adaptation. It also enriches the contribution of this nice work.

Reviewer #2: Comment to MS: MS. No. PONE-D-19-18473 Genetic characterization of Angiostrongylus larvae and their natural intermediate host, Achatina fulica, in Thailand

This study revealed genetic diversity of Angiostrongylus larvae and Achatina fulica, natural intermediate host. New findings of A. fulica haplotypes were found (AF1 and AF2) based on sequencing of the COI gene. Two new additional cytb haplotypes of A. cantonensis (AC19 and AC20) were also identified in this study. Scientific sound is good. Manuscript is well written. This is useful for more understanding of system study to explore the epidemiology of Angiostrongylus spp. and Achatina fulica intermediate host.

Specific comment:

For ensure phylogenetic analysis, in addition to using the maximum-likelihood (ML) method in Phylogenetic analysis of Figures 1, 2 and 3, the authors should also use other methods such as (Bayesian analyses (BI) maximum-parsimony (MP) and neighbour-joining (NJ) analyses implemented as reported by as Ref 9: Rodpai R, Intapan PM, Thanchomnang T, Sanpool O, Sadaow L, Laymanivong S, et al. Angiostrongylus cantonensis and A. malaysiensis Broadly Overlap in Thailand, Lao PDR, Cambodia and Myanmar: A Molecular Survey of Larvae in Land Snails. PLoS One. 2016;11(8): e0161128. https://doi.org/10.1371/journal.pone.016112.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Carlos Graeff-Teixeira

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files to be viewed.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email us at figures@plos.org. Please note that Supporting Information files do not need this step.

11 Aug 2019

We have changed the manuscript as reviewers suggested. Details are in the attached file.

Submitted filename: Response to Reviewers.docx

Click here for additional data file.

18 Sep 2019

Genetic characterization of Angiostrongylus larvae and their intermediate host, Achatina fulica, in Thailand

PONE-D-19-18473R1

Dear Dr. Vitta,

We are pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it complies with all outstanding technical requirements.

Within one week, you will receive an e-mail containing information on the amendments required prior to publication. When all required modifications have been addressed, you will receive a formal acceptance letter and your manuscript will proceed to our production department and be scheduled for publication.

Shortly after the formal acceptance letter is sent, an invoice for payment will follow. To ensure an efficient production and billing process, please log into Editorial Manager at https://www.editorialmanager.com/pone/, click the "Update My Information" link at the top of the page, and update your user information. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, you must inform our press team as soon as possible and no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

With kind regards,

Marcello Otake Sato, Ph.D., D.V.M.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: Authors have adequately answered all questions and comments.

Reviewer #2: The revised manuscript have been done as standard of the journal and revised as my suggestions. I have no comment again.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Carlos Graeff-Teixeira

Reviewer #2: No

20 Sep 2019

PONE-D-19-18473R1

Genetic characterization of Angiostrongylus larvae and their intermediate host, Achatina fulica, in Thailand

Dear Dr. Vitta:

I am pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximize its impact. If they will be preparing press materials for this manuscript, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

For any other questions or concerns, please email plosone@plos.org.

Thank you for submitting your work to PLOS ONE.

With kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Marcello Otake Sato

Academic Editor

PLOS ONE

Table 2

Primers used for amplifying nucleotide regions in Angiostrongylus.

Gene or region	Primer/(Reference)	Approximate amplicon size(bp)	Targetorganism
SSU rRNA	Angi18S-1_forward5′- AAAGTTAAGCCATGCATG -3′Angi18S-2_reverse5′- CATTCTTGGCAAATGCTTTCG -3′[31]	885	A. cantonensis
cytb	Cytb-F5′-TGAATAGACAGAATTTTAAGAG-3′Cytb-R5′-ATCAACTTAACATTACAGAAAC-3′[27]	853	A. cantonensis
COI	AngiCOI_forward5′- TTTTTTGGGCATCCTGAGGTTTAT -3′AngiCOI_reverse5′- CGAGGATAACCATGTAAACCAGC -3′ [9]	605	A. cantonensis
ITS2	AngiITS2_forward5'—ACATCTGGTTCAGGGTTGTT—3'AngiITS2_ reverse5'—AGCATACAAGCACATGATCAC—3'[9]	395	A. cantonensisA. malaysiensis

Table 3

Haplotype diversity (h) and nucleotide diversity (π) for six populations of A. fulica in Thailand based on mitochondrial COI gene sequences.

Location	Number of samples	Haplotype diversity (h), mean±SD	Nucleotide diversity (π), mean±SD
Northern	16	0	0
Central	19	0	0
Eastern	3	0	0
Northeastern	20	0.3368±0.1098	0.0011±0.0013
Southern	12	0	0
Western	4	0	0
Total	74	0.1037±0.0469	0.0003±0.0006

Table 4

Population pairwise FST from six populations of A. fulica based on mitochondrial COI gene sequences.

Populations	Northern	Central	Eastern	Northeastern	Southern	Western
Northern	0.000
Central	0.000	0.000
Eastern	0.000	0.000	0.000
Northeastern	0.135	0.152	-0.064	0.000
Southern	0.000	0.000	0.000	0.107	0.000
Western	0.000	0.000	0.000	-0.012	0.000	0.000

Table 5

BLASTN search based on SSU rRNA, ITS2, COI, and cytb regions of Angiostrongylus spp. (41 specimens) in Thailand.

Code	Host/Location	No. of larvae	BLASTN identity (%)				Species identification
			COI	SSU rRNA	cytb	ITS2
AngC30CPM_TH	A. fulica/Chaiyaphum	1	100	ND	ND	ND	A. cantonensis
AngC31CPM_TH	A. fulica/Chaiyaphum	1	100	100	100	100	A. cantonensis
AngC32CPM_TH	A. fulica/Chaiyaphum	1	100	ND	ND	ND	A. cantonensis
AngC33CPM_TH	A. fulica/Chaiyaphum	1	100	ND	ND	ND	A. cantonensis
AngC35CPM_TH	A. fulica/Chaiyaphum	1	100	ND	100	99	A. cantonensis
AngC45CPM_TH	A. fulica/Chaiyaphum	1	100	100	ND	100	A. cantonensis
AngC46CPM_TH	A. fulica/Chaiyaphum	1	100	ND	ND	100	A. cantonensis
AngC47CPM_TH	A. fulica/Chaiyaphum	1	100	100	ND	100	A. cantonensis
AngC50CPM_TH	A. fulica/Chaiyaphum	5	100	ND	ND	100	A. cantonensis
AngC51CPM_TH	A. fulica/Chaiyaphum	10	ND	ND	99	100	A. cantonensis
AngC52CPM_TH	A. fulica/Chaiyaphum	10	100	100	99	ND	A. cantonensis
AngC53CPM_TH	A. fulica/Chaiyaphum	10	100	100	100	100	A. cantonensis
AngC72CPM_TH	A. fulica/Chaiyaphum	10	100	100	99	100	A. cantonensis
AngC73CPM_TH	A. fulica/Chaiyaphum	10	100	100	100	100	A. cantonensis
AngC74CPM_TH	A. fulica/Chaiyaphum	10	ND	ND	ND	100	A. cantonensis
AngC75CPM_TH	A. fulica/Chaiyaphum	10	ND	100	ND	100	A. cantonensis
AngC76CPM_TH	A. fulica/Chaiyaphum	9	100	100	100	100	A. cantonensis
AngC77CPM_TH	A. fulica/Chaiyaphum	10	100	100	ND	100	A. cantonensis
AngC78CPM_TH	A. fulica/Chaiyaphum	10	ND	ND	ND	100	A. cantonensis
AngC79CPM_TH	A. fulica/Chaiyaphum	10	ND	ND	ND	100	A. cantonensis
AngC80CPM_TH	A. fulica/Chaiyaphum	8	ND	100	100	100	A. cantonensis
AngC81CPM_TH	A. fulica/Chaiyaphum	6	ND	ND	ND	100	A. cantonensis
AngC83CPM_TH	A. fulica/Chaiyaphum	10	ND	100	ND	100	A. cantonensis
AngC84CPM_TH	A. fulica/Chaiyaphum	10	100	100	99	100	A. cantonensis
AngC85CPM_TH	A. fulica/Chaiyaphum	10	ND	100	ND	ND	A. cantonensis
AngM107CRI_TH	A. fulica/Chiang Rai	10	ND	ND	ND	100	A. malaysiensis
AngM15CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM4CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM14CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM5CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM6CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM7CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM21CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM105CRI_TH	A. fulica/Chiang Rai	10	ND	ND	ND	100	A. malaysiensis
AngM70CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM108CRI_TH	A. fulica/Chiang Rai	1	ND	ND	ND	100	A. malaysiensis
AngM109CRI_TH	A. fulica/Chiang Rai	10	ND	ND	ND	100	A. malaysiensis
AngM110CRI_TH	A. fulica/Chiang Rai	10	ND	ND	ND	100	A. malaysiensis
AngM40PRE_TH	A. fulica/Phrae	1	ND	ND	ND	100	A. malaysiensis
AngM26PRE_TH	A. fulica/Phrae	1	ND	ND	ND	100	A. malaysiensis
AngM39PRE_TH	A. fulica/Phrae	1	ND	ND	ND	100	A. malaysiensis

ND, not determined