| Literature DB >> 31552905 |
Shuai Wei1, Xue-Zhen Liang2, Qian Hu3, Wei-Shan Wang3, Wen-Jing Xu4, Xiao-Qing Cheng5, Jiang Peng5, Quan-Yi Guo4, Shu-Yun Liu4, Wen Jiang1, Xiao Ding1, Gong-Hai Han6, Ping Liu7, Chen-Hui Shi3, Yu Wang5.
Abstract
Sensory and motor nerve fibers of peripheral nerves have different anatomies and regeneration functions after injury. To gain a clear understanding of the biological processes behind these differences, we used a labeling technique termed isobaric tags for relative and absolute quantitation to investigate the protein profiles of spinal nerve tissues from Sprague-Dawley rats. In response to Wallerian degeneration, a total of 626 proteins were screened in sensory nerves, of which 368 were upregulated and 258 were downregulated. In addition, 637 proteins were screened in motor nerves, of which 372 were upregulated and 265 were downregulated. All identified proteins were analyzed using the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analysis of bioinformatics, and the presence of several key proteins closely related to Wallerian degeneration were tested and verified using quantitative real-time polymerase chain reaction analyses. The differentially expressed proteins only identified in the sensory nerves were mainly relevant to various biological processes that included cell-cell adhesion, carbohydrate metabolic processes and cell adhesion, whereas differentially expressed proteins only identified in the motor nerves were mainly relevant to biological processes associated with the glycolytic process, cell redox homeostasis, and protein folding. In the aspect of the cellular component, the differentially expressed proteins in the sensory and motor nerves were commonly related to extracellular exosomes, the myelin sheath, and focal adhesion. According to the Kyoto Encyclopedia of Genes and Genomes, the differentially expressed proteins identified are primarily related to various types of metabolic pathways. In conclusion, the present study screened differentially expressed proteins to reveal more about the di?erences and similarities between sensory and motor nerves during Wallerian degeneration. The present findings could provide a reference point for a future investigation into the differences between sensory and motor nerves in Wallerian degeneration and the characteristics of peripheral nerve regeneration. The study was approved by the Ethics Committee of the Chinese PLA General Hospital, China (approval No. 2016-x9-07) in September 2016.Entities:
Keywords: Kyoto Encyclopedia of Genes and Genomes; Wallerian degeneration; gene ontology; isobaric tags for relative and absolute quantitation; motor nerve; proteomics; sensory nerve; spinal nerve
Year: 2020 PMID: 31552905 PMCID: PMC6905349 DOI: 10.4103/1673-5374.265556
Source DB: PubMed Journal: Neural Regen Res ISSN: 1673-5374 Impact factor: 5.135
Sequences of primers used for quantitative real-time polymerase chain reaction
| Gene ID | Official name | Primer ID | Sequence (5′–3′) |
|---|---|---|---|
| 24185 | Akt1-rat-F | ACCTCTGAGACCGACACCAG | |
| Akt1-rat-R | AGGAGAACTGGGGAAAGTGC | ||
| 25012 | Snap25-rat-F | ACAGGATCATGGAGAAGG | |
| Snap25-rat-R | TTCCCAGCATCTTTGTTG | ||
| 24520 | Kcna1-rat-F | CATCCGCTTGGTAAGGGTGT | |
| Kcna1-rat-R | GGGGATACTGGAGAAGTGCG | ||
| 117550 | Kif5b-rat-F | ATGTAAAGCAACCGGAGGGG | |
| Kif5b-rat-R | CTGTTTGCAGCGTTTCACCA | ||
| 84008 | Cntnap1-rat-F | CTCCGCATGATGAGTCTCCG | |
| Cntnap1-rat-R | CCATCCACTGATGCCGTGTAG | ||
| 170673 | Palm-rat-F | AGCAAGCGGAGACAATTGGA | |
| Palm-rat-R | TCTCGAGTCTGGTGATGGACT |