Genotypic variations of Porphyromonas gingivalis in chronic periodontitis patients with and without diabetes: An in vitro study using arbitrarily primed-polymerase chain reaction and heteroduplex-polymerase chain reaction.

CONTEXT: Diabetes has become an endemic throughout the world. Periodontitis is associated with diabetes, and it has been regarded as the sixth complication of diabetes. However, the role of diabetes on periodontopathic microbiota such as Porphyromonas gingivalis remains unclear. AIMS: To compare the total number of different genotypes of P. gingivalis in chronic periodontitis patients with and without diabetes by using arbitrarily primed-polymerase chain reaction (AP-PCR) and heteroduplex-PCR. SETTINGS AND
DESIGN: This is a single-center comparative study.
MATERIALS AND METHODS: A total of 100 patients were included in this study. Patients were divided into two groups: Group A - patients having chronic periodontitis without diabetes (50) and Group B - patients having chronic periodontitis with diabetes (50). Subgingival plaque samples were collected from both groups of patients. Plaque samples were cultured for P. gingivalis. Positive culture samples and extracted DNA from samples by proteinase-K method were collected. Part of DNA samples were checked by AP-PCR using OPA-13 primer, and part of the DNA were checked using heteroduplex-PCR using P. gingivalis-specific Pg8 primer. Results were analyzed by polyacrylamide gel electrophoresis procedure. STATISTICAL ANALYSIS USED: Independent t-test and Chi-square test (SPSS 16) were used.
RESULTS: Thirty-four out of fifty samples of Group B patients were found positive for P. gingivalis, whereas 21 out of 50 samples in Group A were found positive for P. gingivalis. AP-PCR showed nine different genotypes in Group B and six different genotypes in Group A. Heteroduplex-PCR showed a total of seven different genotypes in Group B and five different genotypes in Group A.
CONCLUSIONS: Results of this study show that, in diabetic condition, P. gingivalis shows increased variations in genotypes.

INTRODUCTION

Periodontal disease is caused by complex bacterial species that provoke host immune response, causing the production of a large spectrum of inflammatory mediators, leading to destruction of connective tissue and supporting alveolar bone.[1]

The change from periodontal health to disease is associated with the transposition of predominantly Gram-positive bacterial flora with Gram-negative anaerobes.[2] A constant association has emerged between Porphyromonas gingivalis, a Gram-negative, black pigmented strictly anaerobic bacterium, and manifestation of periodontal diseases.[34]

There has also been a long-standing debate for many years if diabetes has any role to play on the periodontal microbiota. This question was first raised by scientists in the late 1980s, who postulated that elevated glucose in gingival crevicular fluid (GCF) in diabetic individuals assists the growth of specific microbial species in the subgingival area,[5] resulting in increased propensity to periodontitis and faster disease progression. Studies to find out the impact of diabetes on periodontal microbiota showed inconclusive and contradicting data. There are few studies which showed increase in periodontopathic bacteria in patients with diabetes;[6] however, there are few studies which reported that diabetes has insignificant effect on microbial population in periodontal patients.[78]

Heteroduplex analysis has been used for screening the strain variability of P. gingivalis and Prevotella intermedia.[910] Heteroduplex analysis is an electrophoretic mobility shift assay and can be used to differentiate between two closely related DNA sequences. It is a quick and predictable method for genotyping analysis of large number of samples, and is particularly suited to the analysis of polymerase chain reaction (PCR) products.[11] Another advantage of this method is that the obtained sample can be analyzed directly without the need of culture.

However, studies investigating the appearance of any new genotype or increase in the number of genotype of P. gingivalis in diabetes patients with periodontitis are few in number. The current study aims at screening the total number of different strains of P. gingivalis associated with periodontal patients with and without diabetes.

MATERIALS AND METHODS

A total of 100 patients having chronic periodontitis with or without diabetes aged between 25 and 70 years were included in the study. The study was approved by the Institutional Ethics Committee (IEC 756/2014). The patients were informed about the details of the study, and their participation was voluntary. They were included in the study after receiving informed consent.

Study design

The present work was a comparative cross-sectional study. A total of 100 patients were recruited for the study and were divided into two groups based on inclusion and exclusion criteria: Group A – patients with periodontitis without diabetes (50) and Group B – patients with periodontitis with diabetes (50).

Inclusion criteria

Participants belonged to Group A were individuals who were nondiabetic with their fasting blood glucose level <120 mg/dl, individuals who were diagnosed with diabetes with fasting blood glucose level of above 120 mg/dl, individuals having at least twenty natural teeth, and those with probing pocket depth (PPD) of ≥5 mm and clinical attachment loss (CAL) of ≥3 mm.

Criteria for exclusion

Individuals having any other systemic diseases other than diabetes, any infectious diseases, had previously undergone periodontal surgical procedures, had taken antimicrobial therapy within the previous 6 months, pregnant women, and smokers.

Clinical parameters such as gingival index (GI), plaque index (PI), bleeding on probing (BOP), pocket probing depth, and CAL were recorded for all the patients with the help of University of North Carolina-15 probe.

Method of collecting the plaque samples

The sites selected for the collection of subgingival plaque sample were isolated using sterile cotton rolls. The deepest pocket in every quadrant was selected for plaque sampling (a total of four sites per patient). Supragingival plaque was removed by using hand instruments (scalers and curettes). A sterile Gracey curette was inserted inside the pocket until soft-tissue resistance was felt, and plaque sample was taken. The collected sample was then transferred in a sterile vial (Eppendorf tube) containing reduced transport fluid (RTF). Samples from all the four sites were pooled together into one tube.

Microbiology and molecular biological data

Initially, the plaque samples were cultured for P. gingivalis and later from the positive culture of P. gingivalis, strain variability was done by using arbitrarily primed-PCR (AP-PCR) and hetroduplex-PCR.

Laboratory procedure

Samples were collected and sent to laboratory on the same day. Anaerobic culture specific for P. gingivalis was done. From the positive P. gingivalis culture samples, bacterial DNA was extracted and was taken for AP-PCR and heteroduplex-PCR analyses separately for the detection of P. gingivalis strain variability.

Culture

Sample received in the transport medium (RTF, containing 0.1 M ethylenediaminetetraacetic acid, 4.8% Na2CO3, 1% dithiothreitol [freshly prepared] 20 ml, resazurin 0.1%, and distilled water) was first vortexed and then inoculated in enriched and selective culture medium according to the requirement for P. gingivalis, i.e., blood agar as enriched medium with hemin and Vitamin K. It was incubated at 37°C for 3–4 days in anaerobic jar, in strictly anaerobic condition (CO2 10 %; H2 10 %; N2 80 %). After incubation, the plates were removed, and the colony characteristics were noted [Figure 1]. Organisms were confirmed by Gram staining and key biochemical reactions (no glucose fermentation, indole production, and positive hemagglutination).

Figure 1

Culture-positive Porphyromonas gingivalis colonies showing black pigmented colonies. The culture process was carried out in blood agar

DNA extraction procedure

From the positive culture samples, bacterial inoculum (small amount of substance containing bacteria from a pure culture) was collected, and DNA extraction was carried out by modified proteinase-K method.

Arbitrarily primed-polymerase chain reaction procedure

Extracted DNA was amplified with the help of AP-PCR procedure in a step-wise manner. At first, the set of PCR primer that was selected for carrying out AP-PCR analysis was OPA-13 and 5’-CAGCACCCA C-3’ [Table 1]. Agarose gel electrophoresis was used to separate the mixed DNA that was obtained after AP-PCR procedure.

Table 1

Primers for polymerase chain reactions

Primer	Sequence
785	GGATTAGATACCCTGGTAGTC
422	GGAGTATTTAGCCTT
Pg8	TGTATATGACTGATGGTGAAAACC
241	TTCGCTCGCCGCTACT

Sequences of primers used in the present study. PCR – Polymerase chain reaction

Heteroduplex-polymerase chain reaction

A two-step, nested PCR was performed for the amplification of P. gingivalis-specific gene. In the first step, universal prokaryotic primers (785, 422) were used to amplify the spacer region between 16s and 23s rRNA. This was followed by a second step where the first PCR products were used to amplify P. gingivalis-specific gene by employing universal primers (241) and P. gingivalis-specific primers (pg8) [Table 1].

All PCRs were performed at a total volume of 100 μl reaction mixture. For the first PCR step, 0.036 μg of primers 785 and 0.36 μg of primers 422 were used. For the second amplification step, 0.03 μg of each primer 241 and pg8 was used. DNA isolated from a reference strain of P. gingivalis (ATCC 33277) was used as positive control and was run simultaneously with all the positive patient samples.

The amplified PCR products by the above-mentioned method were used for heteroduplex-PCR analysis. Equal quantities of amplified product from each clinical sample and control strain were mixed in a 0.2-ml PCR tube to make a final quantity of 12 μl. For the formation of heteroduplexes, the mixture was incubated at 95°C for 5 min to melt the double-stranded DNA followed by cooling to 25°C at the rate of 1°C per minute for re-annealing. The tubes were then immediately placed on ice and subjected to polyacrylamide gel electrophoresis for visualization of heteroduplexes.

Polyacrylamide gel electrophoresis procedure

The samples were loaded on to 10% polyacrylamide gel and electrophoresed at 120 V for 3.5 h. With each run, a molecular weight marker of 100–1500 bp was included.

RESULTS

The mean age of the patients in Group A was 42.20 ± 12.41 years; in Group B, it was 53.76 ± 8.75 years; this difference was statistically significant after applying independent t-test (P ≤ 0.001) [Table 2]. Out of the fifty patients in Group A, 16 patients were female and 34 were male. In Group B, out of the fifty patients, 20 were female and 30 were male. There was no significant difference in gender distribution among the two groups (P = 0.405) [Table 3].

Table 2

Age distribution in both Group A (periodontitis with diabetes) and Group B (periodontitis without diabetes)*

	Group (mean±SD)		P
	Group A	Group B
Age	42.20±12.41	53.76±8.75	<0.001 (S)

*Age of Group B participants (periodontitis with diabetes) is statistically significantly higher than Group A participants (periodontitis without diabetes) after applying independent t-test. P<0.001 was taken as statistically significant. SD – Standard deviation; S – Significant; P – P < 0.001

Table 3

Gender distribution in Group A and Group B

	Group		P
	Group A, n (%)	Group B, n (%)
Sex
Female	16 (32.0)	20 (40.0)	0.405 (NS)
Male	34 (68.0)	30 (60.0)

No significant difference was found in the gender distribution among Groups A (periodontitis without diabetes) and B (periodontitis with diabetes), after applying “Chi-square test.” P<0.001 was taken as statistically significant. n – Number of participants; NS – Not significant; P – 0.405

Clinical parameters

Gingival index and plaque index

The mean PI score in Group A was 1.14 ± 0.11 and in Group B was 1.11 ± 0.04; however, the difference was found to be statistically insignificant (P = 0.071). Mean GI in Group A was 1.16 ± 0.10 and in Group B was 1.11 ± 0.04; this difference was found to be statistically significant (P < 0.001) [Table 4].

Table 4

Distribution of bleeding on probing, probing pocket depth, clinical attachment loss, plaque index, and gingival index in Group A and Group B**

	Group (mean±SD)		P
	Group A	Group B
BOP	9.54±2.38	10.08±2.28	0.25 (NS)
PPD	5.50±0.61	6.0±0.70	<0.001 (S)
CAL	1.66±0.52	2.14±0.76	<0.001 (S)
Plaque index	1.14±0.11	1.11±0.04	0.071 (NS)
Gingival index	1.16±0.10	1.11±0.04	<0.001 (S)

**Group B individuals (periodontitis with diabetes) showing statistically significantly higher PPD and CAL than Group A participants (periodontitis without diabetes) (applying independent t-test). P<0.001 was taken as statistically significant. S – Significant; NS – Not significant; PPD – Probing pocket depth; CAL – Clinical attachment loss; BOP – Bleeding on probing; SD – Standard deviation; P – 0.25, <0.001, <0.001, 0.071, 0.001 respectively

Bleeding on probing

BOP was present at all diseased sites. There was no significant difference in the mean percentage of sites with BOP among the two groups (P = 0.25) [Table 4].

Probing pocket depth

The mean PPD score (in millimeters) for Group A was 5.50 ± 0.61 mm and for Group B, it was 6.00 ± 0.70 mm. Independent sample t-test showed that the difference in PPD among the study groups was statistically significant (P < 0.001) [Table 4].

Clinical attachment level

The mean CAL score (in millimeters) for Group A was 1.56 ± 0.22 mm and for Group B, it was 2.14 ± 0.76 mm. The mean difference in CAL between Groups A and B was found statistically significant (P < 0.001) [Table 4].

Microbiological and molecular biology data culture

Identification of Porphyromonas gingivalis in the plaque samples

A total of 55 out of 100 samples were culture positive for P. gingivalis [Figure 1]. This translated into a culture positivity of 55%. In Group A, P. gingivalis was identified in 21 out of the 50 samples, with a percentage distribution of 42.0%, and in Group B, a total of 34 out of the 50 samples were positive with a percentage distribution of 68.0%. Chi-square test revealed that the differences in culture positivity between Groups A and B were statistically significant (P = 0.009) [Table 5].

Table 5

Total number of culture-positive and culture-negative samples of Porphyromonas gingivalis in Group A and Group B and percentage distribution***

	Group		P
	Group A, n (%)	Group B, n (%)
Culture
Negative	29 (58.0)	16 (32.0)	0.009 (S)
Positive	21 (42.0)	34 (68.0)

***Group B participants (periodontitis with diabetes) showing statistically significantly higher culture-positive samples of Porphyromonas gingivalis than Group A participants (periodontitis without diabetes) (applying Chi-square test). P<0.001 was taken as statistically significant. n – Number of samples; S – Significant; P – 0.009

Detection of Porphyromonas gingivalis genotypes by using arbitrarily primed-polymerase chain reaction

Using AP-PCR on the extracted DNAs of the culture-positive samples showed that Group A had a total of six different genotypes of P. gingivalis [Figure 2] and Group B had a total of nine different genotypes [Figure 3]. Among the six different genotypes in Group A, type 2 genotype had the highest amount of percentage of distribution (28.6%); other genotypes had the following percentage of distribution: Type 1 (19.0%), Type 3 (9.5%), Type 4 (19.0%), Type 5 (9.5%), and Type 6 (14.5%) [Table 6].

Figure 2

Genotype detection of Porphyromonas gingivalis by arbitrarily primed-polymerase chain reaction (without diabetes): Agarose gel image

Figure 3

Genotype detection of Porphyromonas gingivalis by arbitrarily primed-polymerase chain reaction (with diabetes): Agarose gel images

Table 6

Total number of genotypes and percentage distribution of Porphyromonas gingivalis in Group A and Group B by using arbitrarily primed-polymerase chain reaction and heteroduplex-polymerase chain reaction

	Type	Group A, n (%)	Group B, n (%)
AP-PCR	1	4 (19.0)	5 (14.7)
	2	6 (28.6)	6 (17.6)
	3	2 (9.5)	3 (8.8)
	4	4 (19.0)	4 (11.8)
	5	2 (9.5)	4 (11.8)
	6	3 (14.3)	3 (8.8)
	7	0	4 (11.8)
	8	0	3 (8.8)
	9	0	2 (5.9)
Heteroduplex-PCR	1	2 (9.5)	2 (5.9)
	2	5 (23.8)	3 (8.8)
	3	9 (42.9)	5 (14.7)
	4	4 (19.0)	12 (35.3)
	5	1 (4.8)	2 (5.9)
	6	0	4 (11.8)
	7	0	6 (17.6)

Using AP-PCR on the extracted DNAs of the culture-positive samples showed that Group A had a total of six different genotypes of Porphyromonas gingivalis and Group B had a total of nine different genotypes. Using Heteroduplex-PCR showed that Group A had a total of five different genotypes of Porphyromonas gingivalis and Group B had a total of seven different genotypes. n – Number of samples; PCR – Polymerase chain reaction; AP-PCR – Arbitrarily primed-PCR

Among the nine different genotypes in Group B, type 2 genotype showed the highest percentage of distribution (17.6%); the percentage distribution of other genotypes was as follows: Type 1 (14.7%), Type 3 (8.8%), Type 4 (11.8%), Type 5 (11.8%), Type 6 (8.8%), Type 7 (11.8%), Type 8 (8.8%), and Type 9 (5.9%) [Table 6].

Detection of Porphyromonas gingivalis genotypes by using heteroduplex-polymerase chain reaction

Using heteroduplex-PCR on the extracted DNAs of the culture-positive samples showed that Group A had a total of five different genotypes of P. gingivalis [Figure 4] and Group B had a total of seven different genotypes [Figure 5]. Among the six different genotypes in Group A, type 3 genotype had the highest amount of percentage of distribution (42.9%); other genotypes had the following percentage of distribution: Type 1 (9.5%), Type 2 (23.8%), Type 4 (19.0%), and Type 5 (4.8%) [Table 6].

Figure 4

Genotype detection of Porphyromonas gingivalis by heteroduplex-polymerase chain reaction (without diabetes): Agarose gel images

Figure 5

Genotype detection of Porphyromonas gingivalis by heteroduplex-polymerase chain reaction (with diabetes): Agarose gel images

Among the nine different genotypes in Group B, type 4 genotype showed the highest percentage of distribution (35.3%); the percentage distribution of other genotypes was as follows: Type 1 (5.9%), Type 2 (8.8%), Type 3 (14.7%), Type 5 (5.9%), Type 6 (11.8%), and Type 7 (17.6%) [Table 6].

DISCUSSION

Periodontal disease is a microbiologically initiated chronic inflammatory disease, in which dysregulated immune-inflammatory processes are responsible for the majority of host tissue destruction and ultimately tooth loss. Although plaque bacteria initiate the inflammatory response, most of the tissue damage result from the host response.

Concentrating on the microbial etiology of periodontitis, it has been extensively investigated ever since the specific plaque hypothesis.[12] The question now is which specific organisms are responsible for which specific disease forms. P. gingivalis is the second most intensively studied probable periodontal pathogen.[2] It is a Gram-negative, anaerobic, nonmotile, asaccharolytic rod. Despite the strong association of this bacterium with periodontitis, it is also commonly present at periodontally healthy sites.[13] The present study was done to find the different genotypes of P. gingivalis in chronic periodontal patients with or without diabetes.

In the present study, individuals who belonged to the periodontitis with diabetes group (Group B) showed a statistically significant higher mean age (53.76 years) than individuals who belonged to periodontitis without diabetes group (Group A, mean age 42.20 years). The results were in accordance with a previous study done by Harris MI et al. in 1987 where they found that the total rates of diabetes increased with age, from 2.0% at age 20–40 years to 17.7% at age 65–74 years.[14] Their results showed that there was a male preponderance of diabetes. Researchers say that men are more susceptible to type 2 diabetes at lower BMI (body mass index) than women of same age, as they are less sensitive to insulin and storage of fat is around their organs rather than under the skin as in women.

In the present study, Group A showed higher GI score compared to Group B; however, the difference was found to be statistically significant (P < 0.001). BOP was present at all diseased sites. There was no significant difference in the proportion of sites with BOP among the two groups (P = 0.25). This result is also similar to a previous study done by Ervasti et al. in 1985, where they studied the correlation of diabetes and gingival bleeding. The variance in the quantity of gingival bleeding between diabetes and control groups was also statistically significant.[15]

The difference in PPD among the study groups was statistically significant (P < 0.001). Group B (periodontitis with diabetes) showed significantly higher mean probing depth (PD) compared to Group A (periodontitis without diabetes). This result is in accordance with previous studies carried out by Mombelli et al. in 1996 and Yano-Higuchi et al. in 2000, where they have shown that, with increase in millimeter of pocket probing depth the odds of detecting the organism increases by a factor of 1.56 and more deeper pocket has a more stronger anaerobic environment, which is helpful for thriving P. gingivalis.[1617] The results are in agreement with the study done by Oliver and Tervonen in 1993,[18] which showed that controlled diabetic patients had superior periodontal health than the controls. The mean difference in CAL between Groups A and B was found statistically significant (P < 0.001). In diabetic condition, there is altered homeostasis of collagen, advanced glycation product formation is in high quantity in diabetic patients, this leads to altered host response and manifestation of excess pro inflammatory cytokine productions, which leads to rapid destruction of tissue.[19] With the loss of supporting bone, there is enhancement of CAL. GCF from poorly controlled diabetic patients with periodontitis demonstrated higher Receptor Activator of Nuclear factor-Kappa B (RANKL) and RANKL-to- Osteoprotegerin (OPG) ratio compared to well-controlled or nondiabetic individuals with similar periodontal status[20] This would, in part, explain enhanced alveolar bone destruction in diabetic individuals.

All the subgingival plaque samples were cultured using selective medium specific for P. gingivalis. Out of the 100 plaque samples, P. gingivalis was identified in 55 samples: Group B – 68.0% and Group A – 42.0%. The result is in agreement with studies previously done on Caucasians and in the Brazilian population; they recognized culture positivity for P. gingivalis in deep periodontal pockets.[2122] This result is in accord with a previous study carried out by Ebersole et al. in 2008; they carried out a study on 39 Hispanic-Americans with type 2 diabetes and 24 nondiabetic controls. They observed P. gingivalis more frequently in patients with type 2 diabetes compared to those without diabetes.[6]

AP-PCR and heteroduplex methods were used to determine the diversity of P. gingivalis in periodontitis patients with or without diabetes. A total of 15 distinctive genotypes were identified in both groups; among these, Group A had a total of six different genotypes of P. gingivalis and Group B had nine different genotypes; however, the data state that there was no similarity between P. gingivalis genotypes isolated from Group A and Group B.

Among the six different genotypes in Group A, type 2 genotype had the highest amount of percentage of distribution (28.6%); other genotypes had percentage distribution of 9.5%–19.5%. Among the nine different genotypes in Group B, type 2 genotype showed the highest percentage of distribution (17.6%); percentage distribution of other genotypes was around 5.9%–14.7%.

In PCR, the strands of the DNA are physically separated at a high temperature in a process called DNA melting. In second step, the temperature is lowered and the primers bind to the complementary sequences of DNA. Only homoduplexes are formed when the sample contains a single strain of bacterium. However, when the sample contains two or more strains, heteroduplexes are formed. On electrophoresis, the number of bands formed is proportionate to the number of strain present in the sample.

Heteroduplex-PCR on the extracted DNAs of the culture-positive samples showed Group A with five and Group B with seven different genotypes of P. gingivalis. In Group A, type 3 genotype had the highest percentage of distribution (42.9%); others had 4.8%–19.5%. In Group B, type 4 genotype showed the highest percentage of distribution (35.3%); others had 5.9%–17%.

The finding of the present study was similar to a study carried out by Leys et al. who identified 22 heteroduplex types of P. gingivalis.[23] In 2009, Igboin et al. carried out a similar kind of study and demonstrated a geographic variation in the distribution of 22 different types of P. gingivalis. Six types were seen to be widely distributed in the USA, Europe, and East Asia and 14 rare types were found in isolated areas.[24]

The present work was conducted to find the genotypic variation of P. gingivalis in periodontal patients with or without diabetes by using simple species-specific primer with the help of AP-PCR and heteroduplex PCR techniques. Both techniques showed consistently high number of genotypes of P. gingivalis. This directs that, in diabetic state, new genotypes of P. gingivalis are spotted in the periodontal pocket environment.

Genotype variability of P. gingivalis always plays a key role in the etiopathogenesis of periodontitis. In periodontal patients, FimA II and FimA IV genotypes of P. gingivalis have been the more frequently identified genotypes in contrast to healthy controls in whom FimA I genotype is the most prevalent.[25]

Identifying these new genotypes by DNA sequencing method was beyond the ambit of this study, as it necessitates different procedure. The main causative factors which are behind the emergence of these new genotypes such as deranged host response in diabetic patients and altered composition of GCF are really difficult to pinpoint within the domain of this study, and hence further studies are required.

CONCLUSIONS

The following conclusions were drawn within the limitations of the present study:

P. gingivalis is related with chronic periodontitis, both with and without diabetes. Under diabetic condition, the number of P. gingivalis genotypic variant species increases in periodontitis patients.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.