LncRNA UCA1 affects epithelial-mesenchymal transition, invasion, migration and apoptosis of nasopharyngeal carcinoma cells.

Objective: In this study, long non-coding RNA urothelial carcinoma associated 1 (lncRNA UCA1) in nasopharyngeal carcinoma (NPC) and its effect on the malignant phenotype of NPC cells was investigated.
Methods: Initially, the expression of UCA1 in NPC tissues and cells was detected. NPC cell line that with highest expression of UCA1 was selected for subsequent cell function test. A series of experiments were used to detect proliferation, colony formation, cell cycle distribution, apoptosis, invasion and migration of NPC cells with the interference of UCA1 expression. Western blot analysis was carried out to detect the expression of E-cadherin and vimentin for verifying the effect of UCA1 on epithelial mesenchymal transition (EMT).
Results: The expression of UCA1 was found to be upregulated in NPC tissues and cells. The expression of UCA1 in stage Ⅲ + IV of NPC tissues and in patients with lymph node metastasis was significantly higher than that in patients at stage Ⅰ + Ⅱ and in patients without lymph node metastasis. Inhibition of UCA1 repressed proliferation, EMT, colony formation, invasion and migration while stimulating apoptosis of NPC cells.
Conclusion: Our study suggests that UCA1 expression was overexpressed in NPC. Additionally, UCA1 suppression could inhibit proliferation, EMT, invasion and migration, and promote apoptosis of NPC cells.

Introduction

Nasopharyngeal carcinoma (NPC) is known as one of the most frequent malignant head and neck tumors, which arises in the surface epithelium of nasopharynx [1-3]. According to the statistics, high incidences of NPC are found in Southeast Asia and southern China [4], particularly in the Cantonese region of Guangzhou, which contributing to serious healthcare problems [5]. Referring to the World Health Organization (WHO) classification in 1991, NPC is grouped into two main histological subtypes: keratinizing squamous cell carcinoma (KSCC) and non-KSCC [6]. NPC is a multifactorial disease that is caused by complicated etiological factors, such as genetic predisposition, Epstein-Barr virus (EBV) infection as well as other environmental risk factors [7]. The treatment with radiotherapy and chemotherapy is suggested to control the primary tumor temporarily, while most of patients present radioresistance and chemoresistance, which remains the major obstacles for patient’s survival of NPC [8,9]. Despite great advances in the treatment of NPC, no obvious improvements have been found in the overall survival because of local or regional failure and recurrence [10]. Therefore, it is of great importance to identify more accurate predictive biomarkers and seek for the molecular mechanisms of NPC to further understand NPC cell biology.

Long non-coding RNAs (lncRNAs) are considered as new regulators of different biological functions, which playing an essential role in both oncogenesis and tumor progression [11,12]. A growing number of evidence have suggested that lncRNAs are of great importance in various biological processes, such as X chromosome inactivation, regulation of gene expression, post-transcriptional modification, chromatin remodeling as well as translational control [13-17]. Urothelial carcinoma-associated 1 (UCA1) is a member of lncRNA family with three exons, which encodes a 1.4 kb isoform and a 2.2 kb isoform [18]. As previously reported, UCA1 is remarkably upregulated in numerous cancers, such as hepatocellular carcinoma, colorectal cancer, gastric cancer, endometrial cancer and medulloblastoma, indicating that UCA1 could function as a vital oncogene in human cancers [19-23]. In view of this, we could speculate that lncRNA UCA1 may exert its function in the progression and metastasis of cancers, while the role of UCA1 in NPC and its underlying mechanism remains undiscovered. Therefore, the purpose of this study is to figure out the expression of lncRNA UCA1 in NPC and its effect on the malignant phenotype of NPC cells.

Materials and methods

Ethical statement

This study was approved by the ethics committee of Nanfang Hospital, Southern Medical University. All the subjects signed the informed consent.

Study subjects

A total of 68 patients with NPC (40 males and 28 females, with an average age of 45.3 ± 11.5 years) diagnosed and treated in Nanfang Hospital, Southern Medical University from October 2014 to October 2016 were selected for experiment. The NPC tissues and adjacent normal tissues (over 5 cm away from the tumor margin) were selected from NPC patients after surgical resection. The inclusion criteria were as follows: patients were diagnosed with NPC by histology or cytology; patients had not receive preoperative radiotherapy, chemotherapy and other adjuvant treatments. The corresponding exclusion criteria were: patients had distant metastasis or with other malignant tumors. The clinicopathological features of the patients were collected.

Cell selection and culture

NPC cell lines CNE1, CNE2, HONE1 and C666-1 were obtained from Shanghai Zishi Biotechnology Co., Ltd (Shanghai, China), and cultured in an incubator at 37°C with 5% CO2 in RPMI 1640 medium containing 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA). Normal nasopharyngeal epithelial cell line NP69 was purchased from Shanghai Xcess Biotechnology Co., Ltd. (Shanghai, China) and cultured in an incubator at 37°C with 5% CO2 in KMSF medium (Gibco, Grand Island, NY, USA). The solution was changed every 2–3 days. When the cell confluence was between 80% and 90%, the passage culture began. The expression of UCA1 in all cells was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR), and the cells with the greatest difference from NP69 cells were selected for cell function test.

Cell grouping and treatment

NPC in logarithmic growth stage was assigned into three groups, namely the blank group and the negative control (NC) group (cells transfected with empty plasmid) and the UCA1 siRNA group (cells transfected with UCA1 siRNA plasmid). The siRNA sequences for UCA1 were si-UCA1-1: 5ʹ-AGUAUGUUGUUUGUUGUUAGA-3ʹ (Sense) and 5ʹ-UAACAACAAACAACAUACUUU-3ʹ (Antisense), si-UCA1-2: 5ʹ-UUAAUCCAGGAGACAAAGATT-3ʹ (Sense) and 5ʹ-UCUUUGUCUCCUGGAUUAATT-3ʹ (Antisense) and si-UCA1-3: 5ʹ-GCACCUUGUUAGCUACAUAAA-3ʹ (Sense) and 5ʹ-UAUGUAGCUAACAAGGUGCCA-3ʹ (Antisense), and the sequences for NC were: 5ʹ-UUCUCCGAACGUGUCACGUTT −3ʹ (Sense) and 5ʹ-ACGUGACACGUUCGGAGAATT-3ʹ (Antisense). The empty plasmid, si-UCA1-1, si-UCA1-2 and si-UCA1-3 plasmids were purchased from Shanghai GenePharma Co., Ltd (Shanghai, China). According to the instructions of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), the cells after transfection were cultured in an incubator for 48 hours to detect the expression of UCA1.

qRT-PCR

The one-step method of Trizol (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNA in cells and tissues, and the high-quality RNA was confirmed by ultraviolet (UV) analysis and the detection of formaldehyde denaturation electrophoresis. cDNA was obtained by avian myeloblastosis virus (AMV) reverse transcriptase (ThermoFisher Scientific, Massachusetts, USA) after the acquirement of l μg RNA. Design and synthesis of PCR primer was designed and synthesized by Invitrogen, Carlsbad, CA, USA (Table 1). Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an internal control (U6 as an internal control of the nuclear RNA). The PCR amplification conditions were as follows: pre-denaturation at 94°C for 5 min, a total of 40 cycles of denaturation at 94°C for 40 s, annealing at 60°C for 1 min, extension at 72°C for 1 min and finally, extension at 72°C for 10 min. The product was verified by agarose gel electrophoresis. The threshold cycle (Ct) value of each reaction tube was obtained by manually selecting the threshold at the lowest point of parallel rise of each logarithmic expansion curve. 2−ΔΔCt method [24] was used to analyze the ratio relation of target gene expression between the experimental group and the control group. The formula is as follows: ΔΔCt = [Ct (target gene) – Ct (internal control gene)] the experimental group – [Ct (target gene) – Ct (internal control gene)] the control group. The experiment was repeated for 3 times to obtain the average value.

Table 1.

Primer sequence.

Gene	Sequence
UCA1	F: 5ʹ-CATCGCGACCCTACATTAAAGCTAAT −3’
	R: 5ʹ- GCTTCAAGTGTGACCAGGGACT −3’
GAPDH	F: 5ʹ- TGGGTGTGAACCATGAGAAG-3’
	R: 5ʹ- GTGTCGCTGTTGAAGTCAGA-3’

Note: UCA1, urothelial carcinoma associated 1; GAPDH, glyceraldehyde phosphate dehydrogenase.

Western blot analysis

The proteins from cells in each group were extracted and the protein concentrations were determined according to the instructions of the bicinchoninic acid (BCA) assay (Wuhan Boster Biological Technology LTD, Wuhan, China). The extracted protein was added to the sample buffer and then boiled at 95°C for 10 min, with each well for 30 μg protein. Following 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (Wuhan Boster Biological Technology LTD, Wuhan, China), protein samples were transferred to a nitrocellulose (NC) membrane using the wet transfer method, with the electrophoretic voltage from 80 v to 120 v, the trarsmembrane voltage of 100 mv and the time for 45–70 min. Subsequently, the protein samples were transferred to polyvinylidene fluoride (PVDF) membrane and blocked with 5% bovine serum albumin (BSA). Afterward, the membranes were added with the primary antibodies of E-cadherin (1: 1000; ab15148), Vimentin (1: 1000; ab137321) and β-actin (1: 3000; ab227387) (all from Abcam, Cambridge, MA, USA) and incubated at 4°C overnight. The membranes were rinsed with Tris-buffered saline and Tween 20 (TBST) for 3 times, each time for 5 min, and the corresponding secondary antibodies (Shanghai Miao Tong Biotechnology Company, Shanghai, China) were incubated at room temperature for 1 h to wash the membranes for 3 times, each time for 5 min, and an electrogenerated chemiluminescence (ECL) solution was used for developing. β-actin was regarded as an internal control. Gel Doc EZ formatter (Bio-rad, California, USA) was used for developing. The gray value analysis of target band was analyzed by Image J software (National Institutes of Health, Bethesda, Maryland, USA). The experiment was repeated for three time to obtain the average value.

Cell counting kit-8 (CCK-8) assay

The cell suspensions of each group were diluted with a certain concentration and then inoculated into 96-well plates at the density of 1 × 103 cells/100 μL/per well. Each group was set for 15 parallel wells. The cells were classified into 5 groups according to the culture time of 0 h, 24 h, 48 h, 72 h and 96 h, and each group was set 3 multiple wells. CCK-8 solution (Sigma, St. Louis, MO, USA) was added to the cell-free medium as a blank control, and the culture plate was cultured at 37°C and 5% CO2. At each time point, 10 μL CCK-8 solution was added to the corresponding well and incubated in an incubator for 4 hours. The optical density (OD) value of each well was measured at the wavelength of 450 nm by a microplate reader (ThermoFisher Scientific, Massachusetts, USA).

Colony formation assay

The detached cells were fully dispersed and inoculated with 200 cells into 6-well plates, and the culture plate was gently shaking so that the cells were dispersed evenly and cultured for 2 ~ 3 weeks. When the cell colony was visible to the naked eye, the culture was terminated, the culture solution was abandoned, and washed with the cells with phosphate buffer saline (PBS) and fixed with 4% paraformaldehyde for 30 min. After that, the cells were washed with PBS for 3 times, stained with Giemsa application solution (Beyotime Biotechnology, Shanghai, China) for 60 min, then washed out slowly by water, and dried in air. The number of cell colonies were counted under a microscope.

Flow cytometry

The detached cells in each group were collected and centrifuged at 1000 rpm for 5 min, then the supernatant was abandoned. Subsequently, the cells were suspended and washed with PBS to make the cell concentration adjusted to 1 × 106 cells/mL, thus the single cell suspension was prepared. The single cell suspension was centrifuged for 5 min, and the supernatant was removed. The volume fraction of about 70% ethanol (500 μL) was added to each group, and then fixed for 2 hours at 4°C until overnight. The fixative solution was discarded, and 1 mL PBS was supplemented to further eluate fixation solution, centrifuged at 2000 rpm for 3min, with the supernatant removed. Afterward, 100 μL RNase A (Sigma, St. Louis, MO, USA) was added to the cells at 37°C for 30 min, then 400 μL PI (Sigma, St. Louis, MO, USA) was added to the cells and mixed at 4°C for 30 min devoid of light. The red fluorescence at the excitation wavelength of 488 nm was recorded. The flow cytometer (BD, New Jersey, USA, USA) was used for cell cycle distribution detection.

After the cells in logarithmic growth phase were detached, the suspension cells were mixed, centrifuged to collect the cells, with the supernatant discarded. The cells were washed with 4°C pre-cooled PBS for 5 min, and this step was repeated for two times. The cell concentration was adjusted to 106 cells/mL, and 200 μL of the cells were washed with 1 mL pre-cooled PBS for twice and then centrifuged. The cells were suspended in 100 μL binding buffer and added with 2 μL Annexin-V-FITC (20 μg/mL, Sigma, St. Louis, MO, USA), gently mixed, and placed on the ice for 15 min. Next, the cells were turned to the flow detection tube, added with 300 μL PBS, and also added with 1 μLPI (50 μg/mL, Sigma, St. Louis, MO, USA) to each sample before going on the machine, and the detection was lasted for 30 min. The criteria for determine the results were as follows: Annexin V was regarded as horizontal axis, and PI as longitudinal axis; left upper quadrant as mechanically injured cells, right upper quadrant as late apoptotic cells or necrotic cells, left lower quadrant as negative normal cells and right lower quadrant as early apoptotic cells.

Transwell assay

After 48 hours of transfection, the cells of each group were detached, and each Transwell chamber (Corning, Lowell, MA, USA) was spread 1:8 Matrigel (80 μL) and seeded with 1 × 105 cells. Subsequently, the cells were added with 100 μL serum-free RPMI 1640 medium, added with complete culture medium in the basolateral chamber and incubated for 24 hours. After that, the cells in the apical chamber were erased with cotton swabs, fixed with 4% paraformaldehyde for 15 min, and stained with crystal violet staining solution for 10 min. Under a microscope, 5 visual fields were selected for photographing and counting.

Scratch test

At the back of the 6-well plate, the marker pen was used to draw a uniform horizontal line against the ruler about every 0.8 cm or so, crossing the well. Each well passed through at least 5 lines. When about 5 × 105 cells were added into each well, the cell confluence reached 100%. The next day, a 10 μL gun head was perpendicular to the back of the horizontal line against the ruler scratch, and the gun head was vertical and could not be tilted. After scratching, the cells were gently washed with PBS for 3 times, then gently adhered to the wall and added with PBS. The cells were washed and removed, then added to the culture medium and cultured in a CO2 incubator at 37°C. At the time point of 0 h and 24 h, the sampling was performed so as to take pictures under an inverted microscope. The wound healing area was calculated with National instrument Vision Assistant 8.6 software (Texas, Austin, USA). Cell migration rate = wound healing area/initial scratch wound area × 100. The experiment was repeated three times to obtain the average value.

Statistical analysis

The data were analyzed by SPSS21.0 software (SPSS, Inc, Chicago, IL, USA). The data were normally distributed by Kolmogorov-Smirnov test. The results were expressed as mean ± standard deviation. The comparison between the two groups was performed by t test. One-way analysis of variance (ANOVA) was used in comparison among multiple groups. After ANOVA analysis, the Fisher’s least significant difference t test (LSD-t) was utilized for pairwise comparison. All tests were bilateral, and the significant difference was defined as P < 0.05.

Results

Lncrna UCA1 is highly expressed in NPC tissues and NPC cells

The expression of UCA1 in NPC tissues and their adjacent normal tissues was detected by qRT-PCR. The results showed that the expression of UCA1 in NPC tissues was significantly higher than that in adjacent normal tissues (P < 0.01; Figure 1a).

Figure 1.

Expression level of UCA1 in nasopharyngeal carcinoma tissues and nasopharyngeal carcinoma cells.

Note: A. qRT-PCR was used to detect the expression of UCA1 in nasopharyngeal carcinoma tissues and adjacent normal tissues; t test was used to analyze the data; N = 68; **, P < 0.01 vs. adjacent normal tissues; B. The expression of UCA1 in nasopharyngeal carcinoma cells and normal nasopharyngeal epithelial cells was detected by qRT-PCR; **, P < 0.01 vs. NP69 cells; C. The expression level of UCA1 in CNE2 cells was detected by qRT-PCR; **, P < 0.01 vs. the control group; One-way ANOVA was used in comparison among multiple groups. After ANOVA analysis, the LSD-t was utilized for pairwise comparison; the experiment was independently repeated for three times.

The expression level of UCA1 in CNE1, CNE2, HONE1 and C666-1 cells was significantly higher than that in normal nasopharyngeal epithelial cells NP69 (all P < 0.01), and the UCA1 expression level in CNE2 cells was the highest, so CNE2 cells were selected to perform functional tests (Figure 1b).

The results of qRT-PCR indicated that in CNE2 cells, the expression of UCA1 in the cells of the si-UCA1-1, si-UCA1-2 and si-UCA1-3 groups was significantly lower than that in the blank group and the NC group (all P < 0.01; Figure 1c), suggesting CNE2 cells with low expression of UCA1 were successfully constructed. Among them, si-UCA1-3 was superior to si-UCA1-1 and si-UCA1-2, so si-UCA1-3 was selected for subsequent experiments, which was named as UCA1 siRNA.

Expression of UCA1 is related to clinical stage and lymph node metastasis of NPC

The relationship between the expression of UCA1 and the clinicopathological features of NPC was analyzed. The results demonstrated that the expression of UCA1 in patients with stage III-IV in NPC tissues was significantly higher than that in stage I-II(P < 0.05), and the expression of UCA1 in NPC tissues with lymph node metastasis was significantly higher than that in patients without lymph node metastasis (P < 0.05). There was no significant correlation between expression of UCA1 with the gender and T stage of NPC patients (both P > 0.05; Table 2).

Table 2.

Relationship between expression of UCA1 and clinicopathological characteristics of nasopharyngeal carcinoma.

Clinicopathological characteristic	Case	UCA1 expression	t/F	P
Age (years)			1.00	0.323
≤ 50	43	4.39 ± 0.34
> 50	25	4.44 ± 0.29
Gender			1.67	0.100
Male	40	4.46 ± 0.32
Female	28	4.33 ± 0.31
T stage			1.29	0.202
T1 + T2	35	4.36 ± 0.31
T3 + T4	33	4.46 ± 0.33
Clinical stage			2.44	0.018
Ⅰ + Ⅱ	24	4.29 ± 0.32
Ⅲ + IV	44	4.48 ± 0.30
Lymph node metastasis			2.92	0.005
With	41	4.50 ± 0.30
Without	27	4.28 ± 0.31

Note: The date were analyzed by the unpaired t test.

Inhibition of UCA1 inhibits proliferation and colony formation of NPC cells

The results of MTT assay showed that there was no significant difference in proliferation of NPC cells in the NC group compared with the blank group (P > 0.05), but the proliferation rate of the UCA1 siRNA group was significantly slower than that of the NC group, and the proliferation rate was decreased significantly (P < 0.05; Figure 2a).

Figure 2.

Effect of down-regulation of UCA1 on the proliferation and colony formation of nasopharyngeal carcinoma cells.

Note: A. MTT assay for the proliferation of CNE2 cells in each group; B. Detection of colony number of CNE2 cells in each group by clone forming experiment; *, P < 0.01 vs. the blank group; One-way ANOVA was used in comparison among multiple groups. After ANOVA analysis, the LSD-t was utilized for pairwise comparison; the experiment was independently repeated for three times.

Colony formation assay was used to detect the change of cell colony formation ability in each group. The results suggested that there was no significant difference in cell colony number between the blank and the NC groups (P > 0.05), but the colony number of the UCA1 siRNA group was significantly lower than that of the NC group (P < 0.05; Figure 2b). It suggested that down-regulation of UCA1 could inhibit the proliferation and colony formation of NPC cells.

Inhibition of UCA1 inhibits cell cycle progression and promotes apoptosis of NPC cells

The cell cycle distribution of each group was detected by flow cytometry. The results showed that there was no significant difference in the proportion of G0/G1, S and G2/M cells between the blank and the NC group (P > 0.05). Compared with the blank group and the NC group, the cells in G0/G1 phase in the UCA1 siRNA group were significantly increased, and the number of cells in S phase and G2/M phase decreased significantly (all P < 0.05; Figure 3a). Based on which, we could conclude that down-regulation of UCA1 expression can inhibit cell cycle progression and arrested cells at G0/G1 phase in NPC cells.

Figure 3.

Effect of down-regulation of UCA1 on cell cycle distribution and apoptosis of nasopharyngeal carcinoma cells.

Note: A. Flow cytometry was used to detect the cell cycle distribution of CNE2 in each group; B. Detection of apoptosis rate of CNE2 cells in each group by flow cytometry; *, P < 0.01 vs. the blank group; One-way ANOVA was used in comparison among multiple groups. After ANOVA analysis, the LSD-t was utilized for pairwise comparison; the experiment was independently repeated for three times.

The results of flow cytometry showed that there was no significant difference in apoptosis rate between the blank and the NC groups (P > 0.05), but the apoptosis rate of the UCA1 siRNA group was significantly higher than that of the blank group and NC group (both P < 0.05; Figure 3b). These results suggest that inhibiting the expression of UCA 1 can promote the apoptosis of NPC cells.

Inhibition of UCA1 inhibits epithelial-mesenchymal transition (EMT), invasion and migration of NPC cells

The expressions of E-cadherin and vimentin were detected by western blot analysis. The results revealed that compared with the blank group, the expression of E-cadherin and Vimentin were not significantly changed in the NC group (both P > 0.05), the expression of E-cadherin increased significantly and the expression of Vimentin decreased significantly in the UCA1 siRNA group (both P < 0.05; Figure 4a).

Figure 4.

Effect of down-regulation of UCA1 on epithelial-mesenchymal transition, invasion and migration in nasopharyngeal carcinoma cells.

Note: A. The expression level of epithelial interstitial marker protein in CNE2 cells in each group was detected by western blot analysis; B. The invasion number of CNE2 cells in each group was detected by Transwell assay (× 400); C. Detection of migration rate of CNE2 cells in each group by scratch test; *, P < 0.01 vs. the blank group; One-way ANOVA was used in comparison among multiple groups. After ANOVA analysis, the LSD-t was utilized for pairwise comparison; the experiment was independently repeated for three times.

The results of Transwell assay showed that there was no significant difference in the number of cell invasion in the NC group compared with the blank group (P > 0.05), and the number of cell invasion in the UCA1 siRNA group was significantly decreased in contrast to the blank group and the NC group (both P < 0.05; Figure 4b).

The results of scratch test indicated that compared with the blank group and the NC group, the migration ability of cells in the UCA1 siRNA group decreased significantly and the migration rate was also decreased significantly (both P < 0.05; Figure 4c). These results suggest that inhibition of UCA1 can inhibit EMT, invasion and migration of NPC cells.

Discussion

Emerging data strongly suggests lncRNAs in the basic regulation of protein-coding genes, which at both the transcriptional and the posttranscriptional levels, are central to normal development and oncogenesis [25-28]. Thus, differential expression of lncRNAs may contribute to cancer diagnosis and prognosis as well as select potential therapeutics. More and more evidence has been recently revealed the function of UCA1 as possessing the oncogenic roles in tumorigenesis [2,29,30]. Therefore, we tried to understand the role of lncRNA UCA1 in the occurrence and development of NPC. The results of this study showed that down-regulation of UCA1 could inhibit EMT, invasion and migration, and promote apoptosis of NPC cells, implying that UCA1 functions as an oncogene in NPC, which might be a potential biological target of NPC therapy.

In the present study, we determined the expression of UCA1 in NPC tissues and their adjacent normal tissues by qRT-PCR, and the results showed that the expression of UCA1 in NPC tissues was significantly higher than that in adjacent normal tissues. Additionally, we also found that the expression level of UCA1 in CNE1, CNE2, HONE1 and C666-1 cells was significantly higher than that in normal nasopharyngeal epithelial cells NP69. In accordance with the results in our study, Zheng et al. [31] and Gao et al. [32] also proposed that UCA1 was upregulated in both gastric cancer tissues and cell lines in contrast to that in normal control tissues. Besides, the expression of UCA1 in non-small cell lung carcinoma tissues and oral squamous cell carcinoma tissues and cells was significantly higher than that in pairmatched adjacent nontumourous tissues and cells [33,34]. Taken together, these findings supported our previous hypothesis that UCA1 might function as an oncogene in the progression of NPC. Subsequently, the relationship between the expression of UCA1 and the clinicopathological features of NPC was analyzed, and the corresponding results revealed that the expression of UCA1 was associated with clinical stage and lymph node metastasis. A previous study suggested that UCA1 expression was related to TNM stage and lymph node metastases of gastric cancer [35,36]. Additionally, the UCA1 expression was found to be closely related to TNM stage and tumor differentiation, and the overexpression of UCA1 implying poor prognosis [12]. Based on which, UCA1 is therefore regarded as a potential oncogene that could play a pivotal regulatory part in the clinical progression of NPC. In accordance with our results, Luo et al. found that downregulation of UCA1 was observed to be negatively related to cell invasion ability and inhibited EMT of bladder cancer cells [37].

Gain and loss of function analysis showed that siRNA-UCA1 inhibited invasion and migration and promote apoptosis of NPC cells. Notably, some articles have demonstrated that the depletion of lncRNA UCA1 can attenuate the cell migration and invasion ability of bladder cancer, esophageal squamous cell carcinoma and ovarian cancer [38-40], suggesting that lncRNA UCA1 could act as a vital regulator of migration and invasion of cells. EMT is a well-characterized process, which could facilitate both the invasion and metastatic dissemination of cancers [41,42]. Therefore, we further discussed whether lncRNA UCA1 could control EMT of NPC cells. The obtained results revealed that the expression of E-cadherin increased significantly and the expression of Vimentin decreased significantly in the UCA1 siRNA group. These data have shown that UCA1 may control cell invasion and migration by promoting EMT in NPC cells

In conclusion, this present study demonstrates the functional significance of UCA1 expression in tumorigenesis of NPC, and the results of our study indicated that UCA1 expression was upregulated in NPC tissues and cell lines. Besides, the upregulated UCA1 was related to the clinical stage and lymph node metastases of NPC. Furthermore, the poor expression of UCA1 underlined an inhibitory role in the inhibition of EMT, invasion and migration, and promote apoptosis of NPC cells. Thus, UCA1 acts as a biomarker in clinical application and holds great promise as a new diagnostic and prognostic marker as well as a therapeutic target for NPC. However, further studies which concentrated on the specific mechanisms, such as signaling pathway, of UCA1 on NPC cells were performed to verify our results.