| Literature DB >> 31526386 |
Ming Tan1, Qian Zhang1,2, Xiaohong Yuan1, Yuanzhong Chen3, Yong Wu4.
Abstract
In the publication of this article [1], there are two corrections.Entities:
Year: 2019 PMID: 31526386 PMCID: PMC6747749 DOI: 10.1186/s13046-019-1377-7
Source DB: PubMed Journal: J Exp Clin Cancer Res ISSN: 0392-9078
Fig. 5Homoharringtonine (HHT) combined with arsenic trioxide (ATO) decrease the proportion of primary leukemia stem cells (LSCs) in serum free medium with cytokine cocktail (Flt3L, SCF, IL-3 and IL-6). Quantification of frequencies of CD34+cells (a), CD34+/CD38− cells (b) and CD34+/CD38−/CD96+ cells (c). (d) Display of flow cytometric analysis on bone marrow sample of patient no. 2 after treatment with HHT and ATO alone or combined. (e) Represents the proportion of normal primary CD34+/CD38- (n = 3)
Fig. 8Homoharringtonine (HHT) combined with arsenic trioxide (ATO) remarkably obliterated the histological infiltration of leukemia stem cells (LSCs). (a) H&E-stained sections of representative 4% paraformaldehyde-fixed spleens and bone marrow from NRG mice. (b) hCD45 and hCD34 levels were detected in the different groups by confocal laser-scanning microscopy in representative 4% paraformaldehyde-fixed spleens and bone marrow samples from NRG mice. Scale bars: 50 μm
Patients characteristic
| NO. | Gender | Age | WBC(*109/L) | Hb (g/L) | PLT (*109/L) | FAB type | BM Blasts(%) | Immune markers | Karyotype |
|---|---|---|---|---|---|---|---|---|---|
| 1 | female | 23 | 1.85 | 124 | 168 | M0 | 63.2 | CD7, CD117, HLA-DR | 46 XX |
| 2 | male | 29 | 12.72 | 138 | 7 | M5 | 60.3 | CD7,HLA-DR, CD33 | 46 XY |
| 3 | male | 32 | 1.14 | 46 | 4 | M2a | 80 | MPO,CD99,CD117 | 46 XY t(8;21) |
| 4 | female | 36 | 5.57 | 50 | 83 | M5b | 78 | CD117, CD33,MPO | 46 XX |
| 5 | female | 43 | 20.57 | 45 | 10 | M1 | 72 | CD117, CD33, MPO | 46 XX |
| 6 | female | 25 | 19.6 | 34 | 23 | M0 | 69.3 | CD7, CD117, MPO | 46 XX |
| 7 | male | 29 | 27 | 23 | 3 | M5 | 59.6 | CD33, HLA-DR CD15 | 46 XY |
NO.1-4 were used to FCM (Flow Cytometry) analysis; NO.5-7 were used to synergistic effect. NO.7 were also used for WB
Primer Sequences for PCR
| Gene | Primer Sequences |
|---|---|
| β-actin | Forward 5’-GCCAACCGCGAGAAGATGA-3’ |
| Reverse 5’-CATCAGGATGCCAGTGGT-3’ | |
| CD34 | Forward 5’- ACTCGGTGCGTCTCTCTAGG -3’ |
| Reverse 5’- CCGTGAGACTCTGCTCTGC-3’ | |
| CD38 | Forward 5’- TTG GGA ACTCAG ACC GTA CCT TG-3’ |
| Reverse 5’- CCA CAC CAT GTGAGG TCA TC-3’ | |
| CD96 | Forward 5’- ACCACAGTCAAGGTTTTTG-3’ |
| Reverse 5’- CCAGGCTGGAGAAGGTTGG-3’ |