| Literature DB >> 31516351 |
M Al-Mutary1, M Al-Ghadi2, A Al-Himaidi2, D Iwamoto2,3, Y Al-Anazi2, A Ammari2, J Ahmad2, A Al-Khedhairy2.
Abstract
The aim of this study is to evaluate the effect of sheep follicular fluid (SFF) supplementation of the in vitro maturation (IVM) media of sheep oocytes on the resumption of meiosis, glutathione (GSH) level, and expression of apoptosis (Bax, Bcl-2) as well as heat shock protein beta-1 (HSPB1) genes. Sheep ovaries were collected from the central slaughterhouse of Riyadh city, KSA. Oocytes were aspirated from 3 to 8 mm follicles. Sheep oocytes were cultured in maturation medium with different concentrations of sheep follicular fluid: 0% (control), 10%, 20% and 40% for 24 h. The results indicated that the maturation rate of oocytes was significantly (p ≤ .05) decreased in 40% SFF (36.87%) versus the control (61.3%), 10% SFF (63.95%) and 20% SFF (64.08%). The supplementation of the IVM medium with 10% SFF induced an intra-oocyte GSH concentration that was significantly higher than in sheep oocytes cultured with 20% and 40% SFF and similar to the GSH content in oocytes cultured without SFF. Real-time polymerase chain reaction analysis of gene expression revealed no significant differences in the Bax and HSPB1 genes between the control and 10% SFF, whereas they were significantly higher in 40% FF (p ≤ .05) compared to the control. The expression of Bax:Bcl-2 was significantly higher in 20% and 40% SFF compared to the control group. In conclusion, the addition of SFF to the IVM culture of sheep oocytes is recommended to support nuclear maturation and increase oocyte competence.Entities:
Keywords: Apoptosis genes; Glutathione; In vitro maturation; Sheep follicular fluid
Year: 2018 PMID: 31516351 PMCID: PMC6733311 DOI: 10.1016/j.sjbs.2018.01.001
Source DB: PubMed Journal: Saudi J Biol Sci ISSN: 1319-562X Impact factor: 4.219
Effect of the supplementation in vitro maturation medium with SFF on maturation rates of sheep oocytes.
| Nuclear status (Mean ± SEM) | Deg. oocytes (%) | Total oocytes | Concentration of SFF | |||
|---|---|---|---|---|---|---|
| M II (%) | M I (%) | GVBD (%) | GV (%) | |||
| 276 | 64 | 44 | 16 | 49 | 449 | 0% SFF (control) |
| 301 | 41 | 51 | 8 | 69 | 470 | 10% SFF |
| 273 | 78 | 41 | 8 | 46 | 426 | 20% SFF |
| 170 | 130 | 73 | 27 | 59 | 459 | 40% SFF |
Data are presented as the Mean ± S.E.M. GV: germinal vesicle; GVBD: germinal vesicle break down; MI: metaphase-I; MII: metaphase-II; SFF sheep follicular fluid. Five replicates in each treatment. (a,b,c) letters with different superscript in the same column differ significantly (p ≤ .05).
The sequence of primers for quantitative Real-time PCR.
| Functions | Genes | Primer sequences (5′–3′) | Size (bp) | Ref. |
|---|---|---|---|---|
| Endogenous control | H2AFZ | (F) AGGACGACTAGCCATGGACGTGTG(R) | 212 | |
| Apoptosis genes | BAX | (F) CTACTTTGCCAGCAAACTGG(R) | 158 | |
| Bcl-2 | (F): GCCGAGATGTCCAGTCAGC(R) | 150 | ||
| Stress gene | HSPB1 | (F) TCCCTGGACGTCAACCACTTCG(R) | 391 |
Fig. 1Glutathione levels in sheep oocytes with different concentrations of sheep follicular fluid during IVM. Columns with different superscript (a, b, c) differ significantly (p ≤ .05).
Fig. 2Fold differences in relative gene expression for three different genes; Bax, Bcl-2 and HSPB1 genes in sheep oocytes matured in different concentrations of sheep follicular fluid during IVM. Columns with different superscript (a, b, c) for the same gene columns differ significantly (p ≤ .05).
Fig. 3Relative Quantitative RT-PCR representing the Bax/Bcl-2 ratio in sheep oocytes matured in different concentrations of sheep follicular fluid during IVM. Columns with different superscript (a, b, c) differ significantly (p ≤ .05).