Mkrn2 deficiency induces teratozoospermia and male infertility through p53/PERP-mediated apoptosis in testis.

The apoptosis that occurs in the immature testis under physiological conditions is necessary for male germ cell development, whereas improper activation of apoptosis can impair spermatogenesis and cause defects in reproduction. We previously demonstrated that in mice, the makorin-2 (Mkrn 2) gene is expressed exclusively in the testis and its deletion leads to male infertility. To understand the potential molecular mechanism, in this study, we found that levels of apoptosis in the testis were abnormally high in the absence of Mkrn 2. To identify specific gene(s) involved, we performed digital gene expression profiling (DGE) and pathway analysis via gene set enrichment analysis (GSEA) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, and we found that MKRN2 inhibits p53 apoptosis effector related to PMP22 (PERP) expression and that levels of the protein in sperm samples have an inverse correlation with infertility levels. GSEA additionally indicated that PERP is a negative regulator of spermatogenesis and that its ectopic expression induces male infertility. Further, Gene Expression Omnibus (GEO) dataset analysis showed that p53, upstream of PERP, was upregulated in oligoasthenoteratozoospermia (OAT). These observations suggest that Mkrn 2 is crucial for protecting germ cells from excessive apoptosis and implicate Mkrn 2-based suppression of the p53/PERP signaling pathway in spermatogenesis and male fertility.

INTRODUCTION

Spermatogenesis is a complex and elaborated process, whereby spermatogonia proliferate and differentiate into spermatozoa. Notably, during this process, approximately 75% of all progeny of spermatogonia is destroyed by germ cell apoptosis.12 Previous studies demonstrated that the dysregulation of germ cell apoptosis may cause suboptimal male reproductive function and even male infertility.34 Apoptosis in the testis can be induced by factors that disrupt spermatogenesis. For example, fenvalerate induces germ cell apoptosis in the testis by acting on the Fas/FasL signaling pathway.5 Pulsed or continuous electromagnetic field induces apoptosis of the spermatogenic cells in mouse through p53/p21-mediated apoptotic signaling pathway and thus results in male fertility.6 Similarly, decrease of p53 levels affects germ cell homeostasis during spermatogenesis.7 Deficiency of the Magea gene cluster leads to small testes and high rates of apoptosis during the first wave of spermatogenesis, but the Magea gene cluster regulates male germ cell apoptosis without affecting the fertility in mice.8 Recently, exposure to environmental pollutants has also been suggested to cause male reproductive defects.910 Furthermore, the treatments of radiation and chemotherapeutic drugs in current cancer also cause germ cell apoptosis and increase the risk of male infertility.1112 Thus, there is an urgent need to understand the mechanisms that underlie excessive apoptosis in spermatogenic cells, as well as to identify ways to prevent this phenomenon. The makorin (MKRN) gene family encodes putative ribonucleoproteins that have a distinctive array of zinc finger domains.13 Makorin-2 (MKRN2), which was first identified in the human CD34+ hematopoietic stem/progenitor cells, was only recently added to the Makorin family.14 This zinc finger protein contains the typical C3HC4 protein–protein interaction motif (termed the RING domain) that is common to many proteins expressed in various tissues and cell lines.1516 We previously demonstrated that in mice, its mRNA and protein are expressed most prominently in the testis and at low levels in various other tissues.17 Immunohistochemical analysis revealed that MKRN2 protein is located mainly in the Sertoli cells and spermatids, suggesting that it plays an important role in spermiogenesis and spermiation. Furthermore, we generated Mkrn2-knockout (KO) mice and found that KO mice were infertile; no pups were born during a 4-month period of mating. Moreover, spermatozoa were in low number, with poor motility and abnormal morphology in Mkrn2-KO mice. However, further studies are required to fully understand the molecular mechanisms responsible for the sterility caused by Mkrn2 deficiency in mammals.

Here, we identified differential expression genes in Mkrn2-KO and Mkrn2 wide-type (WT) mice and further found an increase in apoptosis of the testis in the absence of Mkrn2. In particular, we found the p53 signaling pathway to be highly upregulated, which is known to be related to apoptosis,181920 implying that apoptosis could play a major role in the infertility associated with the Mkrn2 KO. In this study, we further showed that MKRN2 inhibits p53/PERP signaling, protecting germ cells from excessive apoptosis.

MATERIALS AND METHODS

Mkrn2-KO mice

Mkrn2-heterozygous and Mkrn2-KO mice were generated as previously described,17 and the genotype of their pups was determined by polymerase chain reaction (PCR). The tail DNA in mice was extracted and mutant Mkrn2 allele was identified by PCR as described17 (). All mice were housed and maintained under specific pathogen-free conditions, and all animal experiments were approved by the Committee of Laboratory Animal Experimentation of Nanjing Medical University (Nanjing, China). All methods were performed in accordance with the relevant guidelines and regulations.

Cell culture

Mkrn2-WT and Mkrn2-KO primary mouse embryonic fibroblasts (MEFs) were derived from 13.5-day embryos and cultured as described,17 and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM, catalog# 10566016, Gibco, Carlsbad, CA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS, catalog# 100500, Gemini, West Sacramento, CA, USA), 100 U ml−1 penicillin, and 100 μg ml−1 streptomycin (1% [w/v] PS, catalog# 15070063, Gibco) and were maintained at 37°C and at 5% (v/v) CO2.

Construction of expression vector and transfection

The Mkrn2-mus expression vector and its control vector (pCMV-C-Flag) were acquired as described.17 The p53 expression vector (pHMT.wt p53) was a gift from James Sherley (catalog# 12139, Addgene plasmid, Boston, MA, USA). The pGIPZ-Mkrn2-ShRNA vector and control negative vector (pGIPZ) were acquired as described.17 Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) was used to transfect the plasmids or negative control vector, shRNA or negative control shRNA into MEFs and 293T cells following the manufacturer's protocol.

Immunohistochemical analysis

Testes were obtained from 12-day-old mice, dissected, and immersed in Bouin's fixatives for 24 h before being embedded in paraffin. Sections (4 μm) were stained with hematoxylin and eosin (H and E) for histological examination. For further immunohistochemical analysis, the sections were deparaffinized in xylene and hydrated in a graded ethanol series. The peroxidase in the section tissues was eliminated using 3% (v/v) hydrogen peroxide at room temperature for 20 min, and then, sections were treated for antigen recovery with 0.01 mol l−1 sodium citrate solutions. The sections were blocked with 1% Bovine Serum Albumin (BSA) for 1 h at room temperature before incubation primary antibody at 4°C overnight. For immunohistochemical analysis, anti-MKRN2 antibody (catalog# NB100-55250, Novus Biologicals, Inc., Littleton, CO, UK) was used at a 1:2000 dilution, anti-cleaved caspase 3 antibody (catalog# 19677-1-AP, Proteintech, Wuhan, China) was used at a 1:200 dilution, anti-BCL2 Associated X (BAX) antibody (catalog# 50599-2-Ig, Proteintech) was used at a 1:100 dilution, anti-p53 apoptosis effector related to PMP22 (PERP) antibody (catalog# AB_48032, Abcam, Inc., London, UK) was used at a 1:100 dilution, and anti-p53 (DO-7) antibody (catalog# 48818, CST, Inc., Boston, MA, USA) was used at a 1:100 dilution. After the samples were incubated with secondary antibody, signals were detected using the diaminobenzidine (DAB) Histochemistry Kit (catalog# TL-015-HD, Invitrogen, Boston, MA, USA). The relative integrated option density (IOD) values of each section were analyzed by Image-Pro Plus software (Media Cybernetics, Bethesda, MD, USA).

Immunoblot

Tissues ground in liquid nitrogen were lysed on ice for 30 min in ice-cold Radio-Immunoprecipitation Assay (RIPA) buffer (catalog# P0013C, Beyotime Biotechnology, Shanghai, China) supplemented with protease inhibitor cocktail (catalog# P8340-1 ml, Sigma, San Francisco, CA, USA). The cells lysates were centrifuged at 21 100 g at 4°C for 15 min. The tissues lysates were subjected to three sets of 15-s pulses between pulses for 15 min on ice and then centrifuged at 21 100 g at 4°C for 1 h. The extracts were subjected to immunoblot using antibodies for MKRN2 (1:2000 dilution; catalog# NB100-55250, Novus Biologicals), PERP (1:500 dilution; catalog# AB_48032, Abcam), p53 (DO-7) (1:1000 dilution; catalog# 48818, CST), and anti-p53 (acetyl-K120) (1:1000 dilution; catalog# HW-186, SAB, Inc., Nanjing, China) as described above. In addition, the housekeeping protein β-actin antibody (1:2500 dilution; catalog# 60008-1-Ig, Proteintech) was used as a loading control. The integrated density values were used to calculate the gray values by Image J software (National Institutes of Health, Bethesda, MD, USA).

RNA extraction, reverse transcription-polymerase chain reaction (RT-PCR), and quantitative real-time PCR (qRT-PCR) analysis

Total RNAs were extracted from Mkrn2-WT and Mkrn2-KO MEFs, as well as from 293T cells, and purified using TRIzol reagent (catalog# 15596018, Invitrogen) according to the manufacturer's instructions. RT-PCR was performed using the HiScript II Q RT SuperMix (+gDNA wiper) (catalog# R323, Vazyme Biotech, Nanjing, China). qRT-PCR was performed using ChamQ SYBR Color qPCR Master Mix (High ROX Premixed) (catalog# Q441, Vazyme Biotech Co., ltd.) on a 7900HT system. Gapdh, β-actin, and Hprt levels were used as internal controls,2122 and relative quantification (2−ΔΔCt) was used to calculate fold changes. The primer sequences are listed in .

Digital gene expression profiling and KEGG-based pathway analysis

Total RNAs extracted from the Mkrn2-WT and Mkrn2-KO MEFs were sequenced by Illumina HiSeq™ 2000 sequencing system. Mouse reference genome used was mm9 and alignment software used was STAR. The counts were obtained by htseq-count, and transcripts per million (TPM) values were calculated. Pathway analysis of the datasets was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and ggplot2. In the Volcano plot, the threshold for differential expression genes is log fold change (FC) >1 or <−1 (P < 0.05).

Gene set enrichment analysis (GSEA)

The samples in Gene Expression Omnibus (GEO) dataset GSE6872, which contains sperm sample microarray data, were split into two groups on the basis of expression levels of PERP. The GSEA program was employed to analyze the spermatogenesis signal enrichment scores in the PERP-high versus PERP-low expression groups from the Molecular Signatures Database (MSigDB) gene set (Gene Ontology (GO) male gamete generation; HALLMARK: SPERMATOGENESIS).

TUNEL assay

The terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay was performed with Click-iT™ TUNEL Colorimetric IHC Detection Kit (catalog# C10625, Invitrogen, Boston, MA, USA) according to the manufacturer's instructions. Briefly, the fixed and permeabilized tissues23 were incubated with 1 U of DNase I (catalog# 18068015, Invitrogen, Boston, MA, USA) diluted in 1× DNase I reaction buffer (20 mmol l−1 Tris-HCl, pH 8.4, 2 mmol l−1 MgCl2, 50 mmol l−1 KCl) for 30 min at room temperature. Afterward, the samples were washed once with deionized water and then reacted with the terminal deoxynucleotidyl transferase (TDT) enzyme. Finally, 1× DAB reaction mixture was added to each sample, and the reactions proceeded at room temperature for 5 min.

Gene signature analysis

PERP signatures were analyzed using the spermatogenesis signal enrichment scores. The p53 signature were analyzed using the GEO dataset GSE6872.2425 The MKRN2 signatures were analyzed using the HALLMARK SPERMATOGENESIS gene set described above for the GSE6872 dataset (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6872).2425

Statistical analyses

Data are presented as the means ± standard deviation (s.d.). Statistical analysis and Spearman's correlation analysis were performed using GraphPad Prism 7 (GraphPad Software, San Diego, CA, USA). The two-way ANOVA with Bonferroni post hoc test was used to evaluate the differences between the multiple groups using GraphPad Prism 7. The two-tailed Student's t-test was used to analyze the quantitative variables between the two groups, assuming equal or unequal variance determined by the t-test of equality of variances. Student's t-test was carried out with SPSS version 22.0 (SPSS Inc., Chicago, IL, USA). Correlations between the MKRN2 and PERP expression signatures were analyzed by Pearson's correlation analysis. The differences were considered statistically significant at P < 0.05.

RESULTS

The sets of differential expression genes (DEGs) enriched in Mkrn2 KO were compared to those from WT mice

To identify the mechanism responsible for the Mkrn2-KO phenotype, we extracted RNAs from MEFs of Mkrn2-KO and Mkrn2-WT embryos and profiled gene expression levels by DGE. Analysis of the raw data revealed many DEGs existing in the Mkrn2-KO versus Mkrn2-WT samples (Figure and ), among which 614 genes were upregulated (red) and 754 were downregulated (blue). To identify the genes most likely to be responsible for the Mkrn2-KO phenotype, we performed KEGG analysis using the DEGs. The results showed that these gene sets were enriched for multiple pathways in the context of the Mkrn2 deficiency (). Furthermore, using the online KEGG pathway maps website (https://www.genome.jp/kegg/tool/map_pathway2.html), we found that there were several crucial mediators of the p53 pathway in DEGs (Bbc3, Bax, Perp, Apaf1, Atr, Cdk1, Chek1, Ccng2, Cytc, Igf1, Igfbp3, Pmaip1, Sesn1, and Sesn2).

The sets of DEGs enriched in Mkrn2-KO were compared to those from the Mkrn2-WT mice. (a) Volcano plot of DEGs in MEFs isolated from Mkrn2-KO and Mkrn2-WT mice. DEGs are color coded according to whether they are up- or down-regulated (logFC >1 or <−1, P < 0.05); 614 genes upregulated in Mkrn2-KO group, red; 754 genes downregulated in Mkrn2-KO group, blue. (b) Scatter plot illustrating relative gene expression levels by group, with color coding as in a. (c) Biological pathways represented among the identified DEGs, as determined by KEGG analysis. DEG: differential expression gene; Mkrn2: makorin-2; KO: knockout; WT: wild type; MEF: mouse embryonic fibroblast; KEGG: Kyoto Encyclopedia of Genes and Genomes; logFC: log fold change; mTOR: Mechanistic Target Of Rapamycin Kinase.

MKRN2 inhibited expression of PERP, apoptosis modulator

To understand the effects of MKRN2 on p53 pathway signaling better, we first assessed the levels of identified DEGs that are part of the p53 pathway by qRT-PCR. This analysis revealed that the levels of most of the DEGs were changed, with the expression levels of PERP mostly affected ( and ). Second, we tested the effects of MKRN2 overexpression and knockdown on PERP expression levels in 293T cells, which express MKRN2 at low levels under normally physiological conditions. Analysis by qRT-PCR confirmed that Perp levels were lower in the presence of the Mkrn2 expression vector than in its absence (gray vs blue) (). Moreover, it showed that the effect was specific to MKRN2 because co-transfection with an Mkrn2-targeting shRNA vector counteracted the effect of MKRN2 expression (red). Western blot confirmed these findings at the protein levels ( and ). Third, we investigated the correlation between MKRN2 and PERP expression levels in the human samples in the GEO dataset GSE6872 (sperm samples for sperm specimens from 8 patients with oligoasthenoteratozoospermia [OAT] and 13 normal subjects). We found an inverse correlation between levels of MKRN2 and PERP (r = −0.7376, P = 0.0001; ).

DEGs and PERP expression levels in Mkrn2-KO cells and tissues. (a) Expression levels of DEGs for the Mkrn2-KO and Mkrn2-WT MEFs are analyzed by qRT-PCR. Data are presented and analyzed by the Student's t-test from three independent experiments performed in triplicate. **Significant difference compared with WT group (P < 0.01). 293T cells were co-transfected with an Mkrn2 shRNA (shMkrn2) or negative control (Mock) vector plus an MKRN2 expression vector or control vector. (b) qRT-PCR is used to analyze the mRNA expression of PERP. Data are presented as mean ± s.d. from three independent experiments performed in triplicate. (c) Western blot is used to analyze the protein expression of PERP, densitometric analysis of Western blot signals (right). (b and c) Results are presented and analyzed by the two-way ANOVA, *Significant difference at P < 0.05, **Significant difference at P < 0.01. (d) Correlation between MKRN2 and PERP expression levels in GEO dataset GSE6872 (contains sperm samples), as analyzed by Pearson's correlation analysis. DEG: differential expression gene; Mkrn2: makorin-2; KO: knockout; WT: wild type; PERP: p53 apoptosis effector related to peripheral myelin protein 22 (PMP22); qRT-PCR: quantitative real-time polymerase chain reaction; s.d.: standard deviation; MEF: mouse embryonic fibroblast; GEO: Gene Expression Omnibus.

PERP levels were negatively correlated with spermatogenesis

PERP expression levels were higher in sperm samples from the OAT patients than the normal subjects (). Furthermore, GSEA results of PERP-high and PERP-low expression groups of the GSE6872 dataset indicated that the male gamete generation and spermatogenesis gene sets were enriched for PERP- low expression groups, showing that high PERP expression is detrimental to spermatogenesis (Figure and ). Spearman's correlation analysis also showed an inverse rank correlation between PERP expression levels and spermatogenesis in the sperm expression dataset (r = −0.6208, P = 0.0027; ).

Correlation of PERP levels with spermatogenesis. (a) Relative expression levels of the Mkrn2 in normal and OAT sperm samples from the GSE6872 dataset. Data are presented and analyzed by two-tailed, unpaired Student's t-test. **Significant differences compared with WT group (P < 0.01). (b) Enrichment and ranking of genes in the PERP-high and PERP-low expression groups of the GSE6872 dataset are assessed by GSEA analysis (C5: GO gene sets; BP: GO biological process; gene set: male gamete generation) and the corresponding clustering heatmap of genes that contribute most to enrichment score is on the right. (c) Enrichment and ranking of genes in the PERP-high and PERP-low expression groups of the GSE6872 dataset are assessed by GSEA analysis (H: hallmark gene set; gene set: spermatogenesis) and the corresponding clustering heatmap of genes that contribute most to enrichment score is on the right (PERP-low datasets: GSM158476, GSE158477, and GSM158479 and PERP-high datasets: GSM158478, GSM158480, GSM158481, GSM158482, and GSM158483). (d) Correlations between spermatogenic signature scores and PERP expression levels are determined by Spearman's rank correlation analysis. Mkrn2: makorin-2; KO: knockout; WT: wild type; PERP: p53 apoptosis effector related to PMP22; GSEA: gene set enrichment analysis; OAT: oligoasthenoteratozoospermia.

Mkrn2-KO induced PERP expression mediated by p53

To determine whether the p53 family members participate in the MKRN2/PERP pathway, we assayed the expression level of p53 using the GSE6872 dataset. The results confirmed that p53 levels were elevated, which is consistent with upregulation of PERP, in the sperm samples from the OAT patients versus normal subjects (). We analyzed the correlation between MKRN2 and p53/PERP in MEFs. Western blot demonstrated that the expression levels of p53 and PERP were upregulated in Mkrn2-KO MEFs ( and ). In Mkrn2-KO MEFs, overexpression of p53 reversed the inhibition of PERP expression in the presence of the MKRN2 expression ( and ). We evaluated the expression levels of PERP in 293T cells by transfecting with vector and negative control vector (CON), Mkrn2 and CON, and Mkrn2 and p53. We found that the expression changes of PERP were consistent with the above results as in MEFs ( and ).

Association of PERP and p53 expression levels in Mkrn2-KO cells and tissues. (a) Expression levels of p53 are analyzed by GEO dataset GSE6872. Data are presented and analyzed by two-tailed, unpaired Student's t-test. *Significant difference compared with the normal group (P < 0.05). (b) Expression levels of MKRN2, p53, and PERP in MEFs are analyzed by Western blot (left), densitometric analysis of Western blot signals (right). (c) Expression levels of p53 and PERP in MEFs transfected with a p53 vector or CON as indicated are analyzed by Western blot (left), densitometric analysis of Western blot signals (right). (d) PERP expression levels are determined by Western blot in 293T cells co-transfected with vector and control, Mkrn2 and CON, Mkrn2 and p53, respectively (left), densitometric analysis of Western blot signals (right). (c and d) Results are presented and analyzed by the two-way ANOVA from three independent experiments and each performed for three times. *Significant difference at P < 0.05, **Significant difference at P < 0.01. CON: negative control vector; Mkrn2: makorin-2; KO: knockout; WT: wild type; PERP: p53 apoptosis effector related to PMP22; GEO: Gene Expression Omnibus; MEF: mouse embryonic fibroblast.

p53/PERP levels were upregulated in Mkrn2-KO mouse testes

We used TUNEL assay and immunohistochemistry (IHC) for detecting the levels of cleaved caspase 3 and BAX to determine if Mkrn2-KO mice had higher levels of testicular apoptosis than the Mkrn2 WT ( and Supplementary Figure -). Histological analysis revealed higher levels of p53 and PERP expression in the testes of Mkrn2-KO than Mkrn2-WT mice (Figure and , and ), and these results are consistent with Western blot for p53 and PERP in Mkrn2 KO compared to WT testis ( and ).

p53/PERP expression levels in Mkrn2-KO mouse testes. (a) TUNEL assay to assess the levels of apoptosis in Mkrn2 KO versus WT mouse testis. Immunohistochemical staining of (b) p53 and (c) PERP expression in the testes of Mkrn2-KO and Mkrn2-WT mice. Scale bars=50 μm. (d) Western blot assay to test expression levels of MKRN2, p53, and PERP (left); and the different densitometric levels between two groups: Mkrn2-KO and Mkrn2-WT mouse testes are analyzed by the two-tailed, unpaired Student's t-test to compare the data of the two groups from three independent experiments (right). **Significant difference at P < 0.01. Mkrn2: makorin-2; KO: knockout; WT: wild type; PERP: p53 apoptosis effector related to PMP22; MEF: mouse embryonic fibroblast; TUNEL: terminal deoxynucleotidyl transferase dUTP nick end labeling.

DISCUSSION

Mammalian spermatogenesis is controlled by many factors, among which the regulation of gene expression during this period is pivotal.2627 However, the mechanisms underlying the expression levels of spermatogenesis-related genes remain largely unknown. MKRN2, a member of the MKRN protein family, was predicted to function as an ubiquitin E3 ligase.28 Early studies reported that it is expressed in all cells of hematopoietic origin,29 with particularly high expression in immune cells, where it promotes the ubiquitination and degradation of p65.28 In our previous study, we generated a novel mouse model in which exons 2–6 of the Mkrn2 gene cluster were deleted and exons 7 and 8 contained frameshift mutations.17 This gene KO resulted in an obvious reduction in testis size and disruption of ectoplasmic specialization (ES), leading to abnormalities in the sperm head and failure of spermiation.3031 These defects in Mkrn2 also suppressed expression of outer dense fiber protein 2 (Odf2) in germ cells, disrupting the flagellar assembly of sperm tails. However, the mechanism and function of the MKRN2 protein during the male germ cell development and spermatogenesis remain largely understudied.

Several studies of spermatogenesis have shown that both spontaneous and stress-induced apoptosis play key roles in maintaining the homeostasis of different cell types and eliminating germ cells that are defective or carry mutations.323334 Those studies showed that germ cell apoptosis occurs not only during the fetal period but also before puberty and during adult stages.3536 Additional studies have also shown that the dysregulation of germ cell apoptosis may cause suboptimal male reproductive function and even male infertility.3738 To maintain the ratio between Sertoli cells and maturing germ cells, the first wave of apoptosis is required for germ cell development.39 In this process, in mice at postnatal 10 days (P10), germ cells enter meiotic prophase; subsequently at P12, spermatocytes start to their transition to spermatids. Our study showed that the deletion of Mkrn2 disrupts the balance between germ cells survival and apoptosis, which leads to spermatogenic dysfunction in mice.

To explore Mkrn2 function in spermatogenesis, we used DGE and bioinformatic techniques to identify the DEGs in the Mkrn2-KO and Mkrn2-WT mice. We found differential expressions of 1368 such genes (P < 0.05). Furthermore, the p53-signaling pathway was found to be mostly deregulated from analysis of the online KEGG pathway maps database because its activation could easily lead to excessive apoptosis of the mutant spermatocytes.40 The expression levels of the DEGs of the p53 signal pathway in MEFs isolated from Mkrn2-KO and Mkrn2-WT mice by qRT-PCR confirmed that Perp levels were greatly increased in the former cells, which have important roles in the regulation of apoptosis in cancer.414243 Interestingly, our analysis with the GSE6872 dataset revealed that the expression of PERP was not only negatively correlated with MKRN2 expression but also was negatively correlated to the extent of spermatogenesis. Previous study has provided evidence that p53 has an effect on spermatogenesis including the role for meiotic checkpoint control and germ cell quality. Consistently, our Western blotting result showed that p53 expression and MKRN2 levels have a negative correlation and that while p53 was overexpressed, PERP expression can be increased. Our results showed that p53/PERP is an important downstream of Mkrn2 during spermiogenesis and spermiation. It was reported that the expression of PERP stabilized active p53 via modulation of p53-mouse double-minute 2 protein (MDM2) interaction and positively influenced the transcription level of MDM2 depending on p53.44 To determine whether Mkrn2 KO affects protein levels of p53 and PERP as well as the expression of MDM2, we detected MDM2 expression levels in Mkrn2-WT and Mkrn2-KO MEFs, and the results showed no significant difference of MDM2 levels between Mkrn2-WT and Mkrn2-KO MEFs (results are not shown). Meanwhile, Mdm2 is also not existed in DEGs analysis. It was suggested that cellular heterogeneity increased the complexity of modeling gene regulation.45 In our model, we suggest that the absence of Mkrn2 may affect other molecules for regulating MDM2, which may cause the difference. However, the influence of Mkrn2 on the expression levels of MDM2 would be interesting to be further explored in the future. Recent studies have indicated that the modification of p53 may be involved in its biological regulation,46 including by acetylation which may increase p53 activity.47 More importantly, acetylated p53 (K120) plays a crucial role in the process of p53-mediated apoptosis.4849 To investigate the correlation between Mkrn2 and acetyl-p53, we analyzed the levels of the acetyl-p53 (K120) protein and showed that Mkrn2 KO upregulated the expression levels of acetyl-p53 (K120) (). This result suggests that the Mkrn2-inducing p53/PERP apoptosis pathway may be regulated through the acetylation of p53 (K120). However, whether Mkrn2 KO activates the p53-induced apoptosis pathway primarily through the abnormal modification and acetylation of p53 needs to be further investigated. Taken together, these results indicate that Mkrn2 KO may regulate the first wave of apoptosis to affect the germ cell development through p53 apoptosis pathway.

Our study provides the first molecular insight into the function of the Mkrn2 gene in the testicular development, including roles in the maintenance of normal testis size and protection of germ cells from excessive apoptosis. Furthermore, our results demonstrate that a lack of Mkrn2 contributes to increased p53 and PERP levels, thereby facilitating aberrant p53/PERP-mediated apoptosis. Our findings strongly support the notion that the expression levels of Mkrn2 play a critical role in male germ cell development.

AUTHOR CONTRIBUTIONS

YCQ and YXX performed experiments, analyzed data, and wrote the main manuscript text. CSW, ZMS, and CFJ maintained mice and acquired data. YYT performed IHC. XQ and LW performed cell culture experiments. BHJ designed and supervised the project and helped to prepare and revise the manuscript. All authors read and approved the final version of the manuscript.

COMPETING INTERESTS

All authors declare no competing interests.

Mkrn2 affects the expression levels of Perp mRNA. (a) The expression levels of DEGs between Mkrn2 WT vs. KO MEFs are analyzed by qRT-PCR, and (b) the corresponding melting curve are acquired from the 7900HT system. Data are represented as the means ± SD and analyzed by the two-tailed, unpaired Student's t-test. ** P<0.01

The originals of Western blots

Mkrn2 KO and the apoptosis levels of testes. (a) The relative IOD of TUNEL, p53 and PERP are calculated by Image-Pro Plus software. (b, c) Immunohistochemical staining of Cleaved Caspase 3 (C-Caspase 3) and BAX in testes of Mkrn2 KO and WT mice. Scale bar: 50 µm. (d) The relative IOD values of C-Caspase 3 and BAX are analyzed by Image-Pro Plus software. Data are represented and analyzed by the two-tailed, unpaired Student's t-test from three independent experiments and each performed for three times. *P<0.05, **P<0.01

Mkrn2 KO increases the acetylation levels of p53 (K120) in MEFs. (a) Western blotting is used to determine protein levels of p53 and acetylated-p53 (K120) in WT and KO MEFs, and (b) the relative density levels are quantified by Image J software. Data are presented and analyzed by the two-tailed, unpaired Student's t-test from experiments performed in triplicate. * P<0.05, ** P<0.01.

Supplementary Table 1

The generation of Mkrn2 KO and WT Mice

Male (n)	Female (n)	Number	Pups	Genotype/gender (n)
+/- (2)	+/- (4)	6	♂13 ♀3	+/+♂6
				+/-♂5♀2
				-/-♂2♀1
+/- (2)	-/- (4)	6	♂9 ♀6	+/-♂5♀4
				-/-♂4♀2

+/+: Mkrn2 WT +/-: Mkrn2 heterozygous - /-: Mkrn2 KO

Supplementary Table 2

Primers used in this study

Primer name	Sequence 5’- 3’
qRT-PCR
β-actin-F	GGCTGTATTCCCCTCCATCG
β-actin-R	CCAGTTGGTAACAATGCCATGT
Hprt-F	TCAGTCAACGGGGGACATAAA
Hprt-R	GGGGCTGTACTGCTTAACCAG
Mkrn2-F	GTCCTGCACCCAACCCTTC
Mkrn2-R	CACCAGCGTCTTCTTCTCCC
Bbc3-F	AGCAGCACTTAGAGTCGCC
Bbc3-R	CCTGGGTAAGGGGAGGAGT
Bax-F	TGAAGACAGGGGCCTTTTTG
Bax-R	AATTCGCCGGAGACACTCG
Perp-F	ATCGCCTTCGACATCATCGC
Perp-R	CCCCATGCGTACTCCATGAG
Apaf1-F	AGTAATGGGTCCTAAGCATGTTG
Apaf1-R	GCGATTGGGAAAATCACGTAAAA
Atr-F	GAATGGGTGAACAATACTGCTGG
Atr-R	TTTGGTAGCATACACTGGCGA
Cdk1-F	AGAAGGTACTTACGGTGTGGT
Cdk1-R	GAGAGATTTCCCGAATTGCAGT
Chek1-F	CTTGGTCAAAAGAATGACGAGGT
Chek1-R	CCGTCGCCTTTAGAAAGTCGG
Ccng2-F	AGGGGTTCAGCTTTTCGGATT
Ccng2-R	AGTGTTATCATTCTCCGGGGTAG
Cyct-F	GGTGGAAAAAGGCGGGAAAC
Cyct-R	CCGTGTAAGAAAATCCTGGTGC
Igf1-F	CTGGACCAGAGACCCTTTGC
Igf1-R	GGACGGGGACTTCTGAGTCTT
Igfbp3-F	CACACCGAGTGACCGATTCC
Igfbp3-R	GTGTCTGTGCTTTGAGACTCAT
Pmaip1-F	GCAGAGCTACCACCTGAGTTC
Pmaip1-R	CTTTTGCGACTTCCCAGGCA
Sesn1-F	GGCCAGGACGAGGAACTTG
Sesn1-R	AAGGAGTCTGCAAATAACGCAT
Sesn2-F	TCCGAGTGCCATTCCGAGAT
Sesn2-R	TCCGGGTGTAGACCCATCAC
Gapdh-F	AGGTCGGTGTGAACGGATTTG
Gapdh-R	TGTAGACCATGTAGTTGAGGTCA

F: Forward, R: Reverse