Literature DB >> 31484948

Effect of exogenous spermidine on floral induction, endogenous polyamine and hormone production, and expression of related genes in 'Fuji' apple (Malus domestica Borkh.).

Ling Qin1, Xin Zhang1, Jie Yan1, Lu Fan1, Chunxiao Rong1, Chuanyuan Mo1, Manrang Zhang2.   

Abstract

Flower bud formation in 'Fuji' apple (Malus domestica Borkh.) is difficult, which severely constrains commercial production. Spermidine (Spd) plays an important role in floral induction, but the mechanism of its action is incompletely understood. To investigate the effect of Spd on flowering, 6-year-old 'Fuji' apple trees were treated with 1 × 10-5 mol L-1 Spd to study the responses of polyamines [putrescine (Put), Spd and spermine (Spm)], hormones [gibberellins (GA3) and abscisic acid (ABA)], and polyamine-, hormone- and flowering-related genes. Spd application promoted flowering during floral induction by increasing MdGA2ox2 (gibberellin 2-oxidase) through GA3 reduction and increasing MdNCED1 and MdNCED3 (9-cis-epoxycarotenoid dioxygenase) through ABA enrichment during 60 to 80 days after full bloom. The flowering rate as well as the expressions of flower-related genes, except for MdLEY (LEAFY), also increased, thereby promoting flowering. In addition, spraying with Spd significantly increased the contents of endogenous polyamines except for Spm in terminal buds by increasing the expressions of polyamine-associated genes. We hypothesize that the contribution of Spd to flowering is related to crosstalk among polyamines, hormone signals, and related gene expressions, which suggests that Spd participates in the apple floral induction process.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31484948      PMCID: PMC6726604          DOI: 10.1038/s41598-019-49280-0

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Flower bud formation is difficult in ‘Fuji’, the main apple variety in China, which severely hinders commercial production. Floral induction, the most pivotal stage in flower development, is regulated by environmental conditions as well as internal factors such as endogenous hormones[1]. Floral induction ensures that flowering occurs at the proper time in response to complex network processes and multiple environmental signals[2]. Exploration of the regulatory mechanism underlying floral induction is thus crucial to maintain high yield. SOC1(SUPPRESSOR OF OVER- EXPRESSION OF CONSTANS1), FT(FLOWEING LOCUS T), and LFY(LEAFY), which were first discovered in Arabidopsis thaliana, are the three core genes in the floral induction pathway[3-5]. FD(FLOWERING LOCUS), like FT and SOC1, is another key flowering gene. Studies have shown that SOC1 modulates photoperiod, ambient temperature, and vernalization pathway signals[6,7]. SOC1 has a central role in the regulation of flowering time and is widely expressed in roots, leaves, and shoot apexes[7,8]. As a characteristic floral meristem gene, LFY functions in the floral development regulatory network[9,10]. Polyamines (PAs), which are aliphatic, low molecular weight, polycationic compounds, act as nitrogenous growth regulators and are considered to be ubiquitous in all living organisms[11]. The major forms of free PAs are putrescine (Put), spermidine (Spd), and spermine (Spm). In plants, these PAs play a crucial role in biological processes throughout the life cycle[12,13]. Because they are positively charged, PAs can interact with cell macromolecules, such as DNA, RNA, chromatin, and phospholipids, as well as with proteins; this interaction explains their relationship to multiple basic cellular processes, including gene expression regulation, translation, chromatin remodeling, RNA processing, protein activation, cell proliferation, cell signaling regulation, membrane stabilization, and modulation of cell death[12,14,15]. Furthermore, numerous studies have shown that PAs are indispensable in advanced plant growth and development processes, including floral bud differentiation, flowering regulation, reproductive organ development, sex differentiation, and fruit growth and senescence[16-18]. Five key biosynthetic enzymes involved in PA biosynthesis in higher plants have currently been investigated: arginine decarboxylase (ADC), ornithine decarboxylase (ODC), S-adenosylmethionine decarboxylase (SAMDC), Spd synthase (SPDS), and Spm synthase (SPMS)[19]. The significant physiological functions of endogenous PAs in floral induction and flower primordial and organ formation have been confirmed in numerous laboratory studies of horticultural crops[20,21]. The triamine Spd, the most important of the three above-mentioned PAs, is involved in many physiological processes. In Polianthes tuberosa[20], Spd and Cad are markers of flower bud differentiation. Experiments on Cucurbita pepo L.[22] and Ginkgo biloba[23] have also found that Spd predominates during flower bud differentiation. When Spd reaches a certain level, it can promote the initiation of a flowering gene, thereby triggering the synthesis of a special protein and finally the formation of the flower primordium[24]. As a consequence, exogeneous Spd was used in the present study. Gibberellins (GAs) and abscisic acid (ABA) are significant hormones in plant flowering pathways. In Arabidopsis, GAs play a pivotal role in floral induction, which involves a flowering regulatory pathway independent of GA[25]. Studies have shown that GA has different roles in flowering regulation in different plants. In Arabidopsis, for example, GA accelerates the transition from vegetative development to the first inflorescence stage of reproductive development[26]; in contrast, GA has a negative effect on flower bud formation in woody trees such as mango[27] and apple[28]. Hedden and Thomas[29] have reported that the terminal steps of GA biosynthesis are mainly catalyzed by gibberellin 20-oxidase (GA20ox) and gibberellin 3-oxidase (GA3ox), whereas GA catabolism is facilitated by gibberellin 2-oxidase (GA2ox). ABA controls many aspects of development, such as seed dormancy, root and bud structure, flowering time, and senescence[30-33]. The active effect of ABA on flowering time acceleration and drought-escape response has recently been demonstrated in Arabidopsis and rice[32,34]. In transgenic Arabidopsis, NCED is reportedly adjusted by positive feedback through ABA[35]. ABFs are a family of ABA-responsive element binding factors. In the presence of ABA, SnRK2 can phosphorylate its downstream target ABFs (i.e., ABF1, ABF2, ABF3, and ABF4)[36,37]. Given the above relationship of PAs and hormones to floral induction, we studied the molecular mechanism underlying the physiological response of ‘Fuji’ apple to exogenous Spd treatment. To advance understanding of PA and hormonal regulation of flowering, we examined the responses of endogenous PAs and hormones, floral genes, and genes related to PA and hormone synthesis following spraying with Spd before the cessation of shoot growth. We then used the results to propose how Spd regulates floral development in conjunction with floral and related genes. The ultimate goals of this research were to elucidate the effect of PAs on flower formation from a physiological–molecular perspective, further enrich basic biological knowledge of fruit tree flowering, and provide a theoretical basis for artificial regulation of apple flowering time.

Results

Effects of exogenous Spd on flowering rate

To study the effect of exogenous Spd on apple flowering, the flowering rate of short shoots was investigated in the second year after treatment. As shown in Fig. 1, the flowering percentage was higher in trees treated with Spd than in the control.
Figure 1

Effect of spermidine (Spd) treatment on the flowering rate (%) of ‘Fuji’ apple. (A,B) Flowering rates in control (A) and Spd-treated trees (B). Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the two groups.

Effect of spermidine (Spd) treatment on the flowering rate (%) of ‘Fuji’ apple. (A,B) Flowering rates in control (A) and Spd-treated trees (B). Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the two groups.

Effects of exogenous Spd on PA contents

After applying exogenous Spd, we simultaneously analyzed the contents of the three endogenous PAs, namely, Put, Spd, and Spm. Except at 40 DAF, the Put content of buds treated with Spd was significantly higher than that of the control until 60 DAF, with no significant differences observed thereafter (Fig. 2A). At the early floral induction stage (40 DAF), Spd levels were significantly decreased in treated buds relative to the control and then significantly steadily increased (Fig. 2B). Spm levels, which declined over time in both groups, were significantly lower in the Spd-treated group compared with the control at 30 and 70 DAF (Fig. 2C).
Figure 2

Endogenous polyamine contents of Spd-treated terminal buds of ‘Fuji’ apple. (A) Put; (B) Spd; (C) Spm. Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the treatment and control groups.

Endogenous polyamine contents of Spd-treated terminal buds of ‘Fuji’ apple. (A) Put; (B) Spd; (C) Spm. Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the treatment and control groups. As demonstrated by the results shown in Fig. 1, Spd application significantly affected the contents of endogenous PAs in all tested trees during at least one time point.

Effects of exogenous Spd on GA3 and ABA contents

We studied the effect of Spd treatment on endogenous GA3 and ABA concentrations during flower development. Compared with the control, Spd spraying significantly elevated the level of GA3 at 30–50 DAF, while GA3 content was significantly lower than that of the control group at 60–80 DAF (Fig. 3A). Terminal buds of trees treated with exogenous Spd contained significantly less endogenous ABA at 30 DAF and significantly more at 70 DAF relative to the control (Fig. 3B).
Figure 3

Levels of endogenous hormones in Spd-treated terminal buds of ‘Fuji’ apple. (A) GA3; (B) ABA. Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the treatment and control groups.

Levels of endogenous hormones in Spd-treated terminal buds of ‘Fuji’ apple. (A) GA3; (B) ABA. Values are means ± SE (n = 3); an asterisk indicates a significant difference (P < 0.05) between the treatment and control groups. According to the above results, as shown in Fig. 3, the influence of Spd on GA3 and ABA contents differed depending on the physiological processes that were active.

Effects of exogenous Spd on flowering-associated gene expressions

To better understand molecular events associated with significant changes in the degree of flowering, we analyzed the expressions of genes controlling flowering in terminal spur buds. MdFD transcription was significantly up-regulated at 40 DAF after treatment with Spd (Fig. 4A). The expression pattern of the floral integrator gene MdFT was very similar to that of MdSOC1, with significant up-regulation and peak expression of both genes observed at 50 DAF in the Spd-treated group (Fig. 4B,C). In contrast, the expression of MdLFY remained lower than in the control, with exogenous Spd significantly down-regulating MdLFY transcription at 40 and 50 DAF compared with the control (Fig. 4D).
Figure 4

Relative expression levels of floral genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05).

Relative expression levels of floral genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05). These results (Fig. 4) indicate that exogenous Spd application significantly affected all flowering-related genes at one or more time points, thus suggesting that these genes responded to Spd levels in buds.

Effects of exogenous Spd on PA-related gene expressions

As shown in Fig. 5, transcription levels of PA biosynthetic genes, including MdADC1, MdODC1, MdSAMDC2, MdSPDS1, and MdSPDS2, changed rapidly after exogenous Spd application. MdADC1 expression was obviously up-regulated in Spd-treated buds at some time points. In particular, MdADC1 was up-regulated at 40, 60, and 70 DAF and significantly down-regulated at 50 DAF in shoots treated with Spd compared with the untreated control (Fig. 5A). Interestingly, MdSPDS1 and MdSPDS2, which both belong to the MdSPDS gene family, had different responses to Spd treatment. Exogenous Spd decreased transcript levels of MdSPDS1 and significantly increased those of MdSPDS2 at 40 and 50 DAF, whereas application of this PA respectively increased and decreased transcript levels of MdSPDS1 and MdSPDS2 from 60 to 80 DAF (Fig. 5B,C). A significant increase in MdODC1 transcript levels was observed in Spd-treated shoots from 40 to 60 DAF (Fig. 5D). In addition, the expression of MdSAMDC2 in Spd-treated buds mainly increased during bud development and peaked at 70 DAF (Fig. 5E).
Figure 5

Expression profiles of PA-related genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05).

Expression profiles of PA-related genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05).

Effects of exogenous Spd on expressions of GA- and ABA-related genes

We analyzed two important synthetic genes in the gibberellin biosynthesis pathway. MdGA20ox2 and MdGA3 oxidase (GA3ox) expressions in Spd-treated buds were initially significantly higher than in control buds, with MdGA20ox2 and MdGA3ox subsequently down-regulated at 70 and 80 DAF (Fig. 6A,B). In addition, the expression level of MdGA2ox2, a gene involved in the inactivation of GA catabolites, was also high. In particular, MdGA2ox2 exhibited significantly up-regulated expression from 40 to 60 DAF in response to Spd treatment (Fig. 6C). These data indicate the possible existence of a negative feedback loop maintaining a GA steady state[29].
Figure 6

Expression patterns of GA- and ABA-related genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. (A–F) Expression patterns of genes related to GA (A–C) and ABA (D–F). Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05).

Expression patterns of GA- and ABA-related genes in ‘Fuji’ apple terminal buds during floral induction after Spd treatment. (A–F) Expression patterns of genes related to GA (A–C) and ABA (D–F). Values are means ± SE (n = 3). Means labeled by different lowercase letters (a and b) are significantly different (P < 0.05). Several ABA signaling pathway genes were also analyzed, including NCED, a family of ABA biosynthetic enzymes[38]. NCED1 and NCED3 are key regulatory factors in ABA biosynthesis. In addition, ABF3 is a major transcription factor in the ABA signaling pathway. Notably, expression levels of MdNCED1 and MdNCED3 substantially increased in response to exogenous Spd. MdNCED1 expression peaked at 40 DAF, and MdNCED3 levels were highest at 80 DAF (Fig. 6D,E). In contrast, expression of MdABF3 decreased, but the difference was not significant. (Fig. 6F).

Discussion

Numerous studies have revealed that flower bud differentiation is affected by a combination of in vitro and in vivo factors. Evidence suggesting a close connection between PAs and the physiological events leading to flowering has been summarized by Galston and Kaur-Sawhney[39], Kakkar and Rai[40], and Galston et al.[41]. In the present study, we investigated the roles of PAs in flower development in ‘Fuji’ apple. We observed a correlation between the concentration of endogenous PAs and hormones and the expression of related genes during floral development.

Effect of exogenous Spd on flower formation

The application of Spd has been previously shown to accelerate flower bud formation[20], a finding further confirmed by our experimental results (Fig. 1). After spraying with Spd, the flowering rate of short shoots increased, which suggests that Spd treatment is beneficial to flower bud formation. At the molecular level, plant flowering is regulated by complicated networks involving endogenous and environmental signals[42]. In our study, the transcriptional activities of floral integrators MdFD (Fig. 6A), MdFT (Fig. 6B), and MdSOC1 (Fig. 6C) were enhanced by exogenous Spd. A rise in transcription levels of an FT-encoding gene has been connected with floral induction in several species[43]. According to our results, Spd applied before floral induction can hasten flowering in ‘Fuji’ apple. To our surprise, we observed a reduction in MdLFY expression during floral induction in apple buds treated with Spd (Fig. 5D). We speculate that MdLFY is subject to other modes of regulation in apple, but this hypothesis requires further testing.

PA signaling regulates floral induction in Spd-treated buds

The significance of PAs in flowering development has received much attention[44]. Because PA biosynthesis is transcriptionally regulated, we analyzed the expressions of genes related to PA biosynthesis in Spd-treated shoots. As inferred from results displayed in Figs 2A–C and 5A–F, we discovered that exogenous Spd significantly impacted the contents of endogenous PAs and related gene expressions in all tested materials at some time point(s). According to our results, Spd boosted the level of endogenous Spd in buds during the late stage of floral induction (from 60 to 80 DAF); however, no significant difference was found in MdSPDS1 expression during floral induction, and MdSPDS2 expression even significantly declined. The increase in endogenous Spd levels in Spd-treated buds may be mainly due to the permeation of exogenous Spd in addition to the synthesis of new Spd. In plants, Put is biosynthesized from arginine via ADC or from ornithine by way of ODC[20]. We propose that the presence of Spd augmented the content of Put because exogenous Spd significantly increased MdADC1 and MdODC1 expression and even MdSAMDC2 transcripts. Conversely, we observed a depression in the Spm content of Spd-treated buds, a finding in accord with previous studies where exogenous Spd decreased endogenous PA contents during flowering[45]. We conclude that feedback inhibition caused by high levels of endogenous PAs takes place after application of exogenous Spd. This finding contrasts with the results of Huang[20], who found that early floral initiation is associated with a rise in free Spd and a drop in free Put and Spm in P. tuberosa. These conflicting results suggest that the effects of PAs on flowering vary depending on species, organ, and physiological process. Our results collectively demonstrate that endogenous PA contents and the expressions of related genes change markedly and regularly after exogenous Spd application along with developmental stages of flower bud differentiation, thereby affecting flowering.

Expression of GA genes in Spd-treated buds

To provide evidence for the influence of applied Spd on the metabolism of endogenous hormones in terminal spur buds, we measured endogenous hormone concentrations and transcript levels of hormone biosynthetic genes. Hormones synergistically or antagonistically play a pivotal regulatory role in plant growth and development[1]. GA is one of the most studied hormones in the flowering process in plants, and the mutual effect of PAs and GAs has been preliminarily researched in species such as Arabidopsis and tomato[46-48]. Alcázar et al.[46] have reported that a high concentration of endogenous Spd/Spm in 35S:AtADC2 Arabidopsis plants is accompanied by a significant drop in AtGA3ox3 and AtGA20ox1 expression and a decrease in GA production. In addition, a significant increase in GA2ox expression and a decrease in GA content have been found in E8:ySAMDC transgenic tomato fruits, which had three to four times more Spd compared with the control[48]. In our study, however, we discovered that Spd application dramatically augmented the GA content of buds by increasing transcript levels of the GA biosynthetic genes MdGA20ox2 and MdGA3ox during the initial process of floral induction (30 to 50 DAF) while simultaneously significantly increasing transcript levels of the GA catabolism gene MdGA3ox. This result suggests the existence of a negative feedback loop to maintain GA balance[29]. Next, we found that Spd application lowered the expressions of MdGA20ox2 and MdGA3ox and increased the expression of MdGA2ox2, which significantly restrained GA biosynthesis from 60 to 80 DAF. Hence, the effects of Spd on GA vary depending on physiological processes, and gene family members have diverse reactions to Spd stimulation. As a high GA content inhibits flowering[49], we conclude that exogenous Spd promotes flower formation by reducing GA in the later stages of physiological differentiation. The specific mechanism remains unclear, however, and requires further research.

Expression of ABA genes in Spd-treated buds

A previous finding that ABA contents of leaves and shoots change significantly during the induction phase of apple flowering[50] suggests that ABA participates in the regulation of flowering induction in perennial woody plants. NCED3 has different functions in different species. In Brassica napus, for example, BnNCED3 has been discovered to participate in both stress adaptation and plant development[51]. After rapid induction of MdNCED1 expression in apples, endogenous ABA content gradually increases[52]. The interplay between ABA and PAs during seed maturation and germination has also been thoroughly researched[53]. Further evidence highlighting the interaction between PA anabolism and the ABA signaling pathway has been obtained in grape, a perennial plant[46]. ABA content is positively correlated with the expression level of NCED[51]. Our data indicate that Spd application significantly enhances the expressions of MdNCED1 and MdNCED3, in turn increasing ABA levels during the late stage of floral induction. ABF3 has redundant functions in ABA signaling[54]. In our study, exogenous Spd decreased the expression of MdABF3. We thus infer that Spd regulates flowering by depressing MdABF3 expression. Results reported by Keumbi Hwang et al.[55] support the idea that ABA is involved in flowering regulation to speed the floral transition. Increased ABA is thus considered to play a crucial role in flowering regulation. Our results indicate that Spd promotes flowering to a certain extent and is closely related to ABA metabolic regulation at the transcriptional level.

Conclusions

The current study revealed the existence of an intricate regulatory mechanism that manages floral induction in ‘Fuji’ apple. The contribution of Spd to the promotion of flowering might be closely associated with the metabolism of hormones and floral integrators (Fig. 7). How PAs regulate flowering genes and influence ‘Fuji’ flowering, however, still needs further study.
Figure 7

A schematic model to explain our experimental results. Arrows between processes correspond to promotion, while the line with a terminal bar indicates inhibition.

A schematic model to explain our experimental results. Arrows between processes correspond to promotion, while the line with a terminal bar indicates inhibition.

Materials and Methods

Plant materials, growth conditions, and Spd treatment

All experiments were carried out at the Apple Experimental Station of Northwest A&F University, Qianyang, Shanxi Province, China (107.13°E, 34.65°N). Six-year-old trees of ‘Fuji’/M26/M. robusta Rehd. were chosen at random and divided into six blocks of three trees each, with a spacing of 1.3 m × 4.0 m. Three blocks were sprayed with 1 × 10−5 mol L−1 Spd (Sigma Chemical Company). The other three blocks were sprayed with water and used as a control. All treatments were carried out with a low-pressure hand-wand sprayer. The spraying was performed twice on clear mornings at 22 and 28 days after full bloom (DAF) (April 27 and May 3, respectively). Terminal buds on spurs (<5 cm) were collected into liquid nitrogen at 30, 40, 50, 60, 70, and 80 DAF, stored at −80 °C, and used for analysis of PAs, hormone quantification, and correlation analysis of gene expression.

Analysis of flowering rate

The flowering rate was calculated as described by Zuo et al.[56] with sight modifications. Specifically, two large branches on each Spd-treated or control tree were labeled, and the flowering rate of terminal buds on their short shoots (<5 cm) were recorded. During full bloom, on April 10, 2019, the total number of terminal buds on short shoots and the number of floral terminal buds on the marked branches were counted. The flowering rate (number of floral buds/number of total buds) based on these data was then calculated.

Extraction and measurement of endogenous PAs in spur apical buds

PAs were estimated using high-performance liquid chromatography (HPLC) as described by Flores and Galston[57] with minor modifications. Briefly, frozen tissue (0.3 g) from each treatment was mixed with 3 mL cold 5% (w/v) perchloric acid in a centrifuge tube. The homogenate was chilled in an ice bath for 1 h and then centrifuged at 15,000 ×g for 30 min at 4 °C. Next, 1 mL of 2 M NaOH solution was combined with 1 mL supernatant, and 10 µL benzoyl chloride was added. The mixture was incubated for 20 min at 37 °C, and 2 mL saturated sodium chloride was then added to terminate the reaction. Benzoyl-PAs were extracted into 2 mL diethyl ether by centrifugation at 4,500 ×g for 5 min. 1 mL of the ether phase was collected and evaporated to dryness with a nitrogen blower. The dried extracts were dissolved in 500 µL of 60% methanol for further testing. The above-prepared benzoyl-PA extract was filtered through a 0.22-μm membrane filter and then eluted on a C18 reverse-phase column (6.0 mm × 150 mm; particle size 5 mm) at room temperature. The mobile phase was composed of HPLC-grade methanol, HPLC-grade acetonitrile, and ddH2O (58:2.5:39.5, v/v/v). The flow rate was 1.0 mL/min, the detection wavelength was 254 nm, and the column temperature was 30 °C. Put, Spd and Spm PA standards were used to construct standard curves. The PA analyses were repeated three times.

Quantitative analysis of endogenous hormones in spur apical buds

GA3 and ABA in terminal spur buds were measured by liquid chromatography as described previously[58] with slight modifications. Specifically, 0.3 g of each treated fresh bud sample in 20 mL of 70% cold acetone was maintained on ice for 1 h. After centrifugation at 8,000 ×g and 4 °C for 10 min, the supernatant was collected and concentrated using a nitrogen evaporator. Next, extraction was performed by addition of 10 mL of petroleum ether, decolorization for 10 min, and removal of the ether phase. This procedure was carried out three times. Ten milliliters of ethyl acetate was added and collected after 10 min, and this step was repeated once more. The two collections of the ester phase were concentrated with a nitrogen blower until no solvent remained. The dried extracts were dissolved in 1.5 mL methanol and filtered through a 0.22-μm filter for future analysis. The liquid-chromatography mobile phase consisted of HPLC-grade methanol and 0.1% formic acid. The flow rate was 1.0 mL/min, and the column temperature was 30 °C. GA3 and ABA (Sigma) standards were used to construct standard curves. Three biological replicates of GA3 and ABA analyses were performed.

RNA isolation and cDNA synthesis from spur apical buds

Total RNA was isolated using a cetyltrimethylammonium bromide method[59] with minor modifications. RNA from all samples was quantified spectrophotometrically, and total RNA purity and integrity were assessed by agarose gel electrophoresis. Total RNA (1 µg) was reverse transcribed into cDNA using a PrimeScript RT Reagent kit with gDNA Eraser (Takara, Shiga, Japan) according to the manufacturer’s instructions.

Gene expression analysis by quantitative RT-PCR (RT-qPCR)

Gene-specific primers were used for PCR amplification (Table 1). RT-qPCR amplifications were performed in 20-μL reaction mixtures containing 2 μL cDNA (diluted 1:16), 10 μL of 2 × SYBR Premix ExTaq II (Takara), 0.8 μL of each primer, and 6.4 μL ddH2O. The RT-qPCR assay was carried out on a QuantStudio5 instrument. The cycling protocol was as follows: 30 s of denaturation at 95 °C, followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s, and 72 °C for 30 s. A melting curve analysis was performed immediately after the PCR amplification.
Table 1

Primers used for quantitative real-time PCR gene expression analysis.

Gene accession no.Primers (forward/reverse)Sequence (5′-3′)
MDP0000169473MdFD-FAGTGACCAGACCAACCACAACA
MdFD-RATTTGGGTGGTGGGATCAGTGA
MDP0000132050MdFT-FTGGTGGAGACGATCTCAGGACT
MdFT-RTTGCCGCAGTAGTTGCTGGAAT
MDP0000144597MdSOC1-FGTGCGAAGCCGTGGATGGAG
MdSOC1-RCAACAGCGCGCACCATTTGGC
MDP0000186703/MDP0000861601MdLFY-FTTGGCGGCAGGCATGTTACA
MdLFY-RGCTAGAGGCAGTGGCGTTGTT
MDP0000161317MdGA3ox-FTGAGATGCTGAGCAACGGAGTT
MdGA3ox-RCGCAACCGACACCCTTTCTTTC
MDP0000248981MdGA20ox2-FCAGGGCAGTGGTGAACAGTGAA
MdGA20ox2-RTTGTGAACTCCAGCAGCATCGA
MDP0000139968/MDP0000950387MdGA2ox2-FTTATGGCTGCAAAGGCGACACT
MdGA2ox2-RTGCCCATCCATTCTCACTCCCT
MDP0000813805/MDP0000333494MdNCED1-FCTGAAACAGGGGACCTCAAA
MdNCED1-RCGTAGCTAAGCGCGAAGAGT
MDP0000228070MdNCED3-FACAAGACACCGCCACCTTTC
MdNCED3-RTTGGGATTTGGATTACAGAAGG
MDP0000248567MdABF3-FACATCTTCATTGTCGCCGGT
MdABF3-RAGGTATAGGCCTGTTTACGAGC
MDP0000813339MdADC1-FGATAGCTCTCTTCCCGCGTC
MdADC1-RCGATTCGGTAGAGGTCGGAT
MDP0000228682MdODC1-FAGCTTGGCGTAATCATGGTC
MdODC1-RATGCTTCCGGCTCGTATGTT
MDP0000914975MdSAMDC2-FCAAGTGTACCGTGGAGCAAT
MdSAMDC2-RTGCAACCATTGTGAAAGCCA
MDP0000185362MdSPDS1-FGCCTCACGGTGGAATCAAGA
MdSPDS1-RGCCATGGGGTTATGTTGGGA
MDP0000198590MdSPDS2-FCGAGCGCCTTTTTATCCCGT
MdSPDS2-RGGAGGCAAAAACTAGCTGGC
MDP0000027925MdADC1-FTGGTCCCTGTCTCAGAGTGT
MdADC1-RGCCAAACGCACCAAAGGAAT
MDP0000912745MdACTIN-FTGACCGAATGAGCAAGGAAATTACT
MdACTIN-RTACTCAGCTTTGGCAATCCACATC
Primers used for quantitative real-time PCR gene expression analysis. Three replicates were analyzed per sample. The MdACTIN gene was used as an internal control for standardization of relative expression levels of all tested genes. Relative gene expression levels were calculated by the 2−ΔΔCt method[60].

Statistical analysis

All data, which were represented as means ± SE of three replicates, were subjected to analysis of variance (ANOVA) at the 5% level in IBM SPSS v19. The significance of differences among means was determined by Duncan’s multiple range test. Plots were generated with Excel 2007.
  5 in total

1.  Polyamine-Induced Hormonal Changes in eds5 and sid2 Mutant Arabidopsis Plants.

Authors:  Judit Tajti; Kamirán Áron Hamow; Imre Majláth; Krisztián Gierczik; Edit Németh; Tibor Janda; Magda Pál
Journal:  Int J Mol Sci       Date:  2019-11-15       Impact factor: 5.923

2.  PAs Regulate Early Somatic Embryo Development by Changing the Gene Expression Level and the Hormonal Balance in Dimocarpus longan Lour.

Authors:  Chunwang Lai; Xiaojuan Zhou; Shuting Zhang; Xueying Zhang; Mengyu Liu; Chunyu Zhang; Xiaoqiong Xu; Xiaoping Xu; Xiaohui Chen; Yan Chen; Wenzhong Lin; Zhongxiong Lai; Yuling Lin
Journal:  Genes (Basel)       Date:  2022-02-08       Impact factor: 4.096

3.  Polyamines Involved in Regulating Self-Incompatibility in Apple.

Authors:  Jie Yu; Baoan Wang; Wenqi Fan; Songbo Fan; Ya Xu; Chunsheng Liu; Tianxing Lv; Wanda Liu; Ling Wu; Linfeng Xian; Tianzhong Li
Journal:  Genes (Basel)       Date:  2021-11-15       Impact factor: 4.096

4.  Transcriptome analysis provides insights into the molecular mechanism of GhSAMDC1 involving in rapid vegetative growth and early flowering in tobacco.

Authors:  Xinqi Cheng; Fangqin Pang; Wengang Tian; Xinxin Tang; Lan Wu; Xiaoming Hu; Huaguo Zhu
Journal:  Sci Rep       Date:  2022-08-10       Impact factor: 4.996

Review 5.  Plant Development and Crop Yield: The Role of Gibberellins.

Authors:  Ricardo Castro-Camba; Conchi Sánchez; Nieves Vidal; Jesús Mª Vielba
Journal:  Plants (Basel)       Date:  2022-10-09
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.