Correction to: small RNA discovery in the interaction between barley and the powdery mildew pathogen.

Following the publication of the original article [1], the authors noted several typesetting errors which are noted in this Correction article.

Correction to: BMC Genomics

https://doi.org/10.1186/s12864-019-5947-z

Following the publication of the original article [1], the authors noted several typesetting errors which are noted in this Correction article.

In the section “PhasiRNA analysis” there was an error in the first equation in the PDF version of the article. A fraction bar was erroneously introduced between (20 m and n-x), (m and x), and (21 m and n).

The incorrect version was:

The correct version is:

Furthermore, due to the formatting of Table 3 there was an error in the formatting of the alignment bars. The correct Table 3 is provided in this Correction article.

Table 3

Differentially expressed predicted miRNAs and barley mapped reads with homology to miRBase miRNAs

Predicted miRNA or read	Sequence	miRBase match	Number of predicted barley copies	DE time points (and log2 fold changes)	miRBase blastn overlap	Mismatches
DE barley mapped read	TCGGACCAGGCTTCATGCCCC	miR165	NA	bln1 16 HAI (-2.55), bln1 20 HAI (-2.39), mla6 20 HAI (-1.77), rar3 20 HAI (-2.14), bln1 24 HAI (-2.47), mla6 24 HAI (-2.02), bln1 48 HAI (-2.41), mla6 48 HAI (-1.78)		1
DE barley mapped read	TTCGGACCAGGCTTCCTTCCC	miR166	NA	mla6 48 HAI (1.92)		2
DE barley mapped read	TGGGACCAGGCTTCATTCCCC	miR166	NA	bln1 20 HAI (-2.24), rar3 20 HAI (-1.71)		1
DE barley mapped read	TCGGACCAGGGTTCATTCCCC	miR166	NA	bln1 48 HAI (-2.31), mla6 48 HAI (-1.80)		1
DE barley mapped read	TTCGGACCAGGCTTCAGTCCC	miR166	NA	rar3 48 HAI (-2.10)		2
DE predicted miRNA	ACACAAACCGGGACTAAAG	miR2120	9	mla6 20 HAI (1.59)		2
DE predicted miRNA	GTGTTCTCAGGTCGCCCCCGC	miR398	2	mla6 32 HAI (2.03)		1
DE predicted miRNA	AGAACAGAGAATGGCGATAGACTC	miR398	1	mla6 0 HAI (1.63), mla6 20 HAI (1.72), mla6 24 HAI (1.66), mla6 48 HAI (1.93)		4
DE barley mapped read	TGTGTTCTCAGGTCGCCCCCG	miR398	NA	mla6 24 HAI (1.71), mla6 32 HAI (2.57)		0
DE predicted miRNA	TCCTGTGCCTGCCTCTTCCAT	miR528	1	mla6 20 HAI (1.97), mla6 24 HAI (2.27), mla6 32 HAI (2.18)		1
DE barley mapped read	TCCTGTGCCTGCCTCTTCCAT	miR528	NA	mla6 24 HAI (2.07), mla6 32 HAI (2.19)		1
DE barley mapped read	TGGAAGGGGCATGCAGAGGA	miR528	NA	mla6 32 HAI (1.86)		0
DE barley mapped read	TGGAAGGGGCATGCAGAGGAG	miR528	NA	mla6 16 HAI (2.20), mla6 20 HAI (2.40), mla6 24 HAI (2.21), mla6 32 HAI (2.09)		0
DE barley mapped read	CCTGTGCCTGCCTCTTCCATT	miR528	NA	mla6 0 HAI (1.99)		0
DE predicted miRNA	ATTTTGCTTCGTATGTAGACT	none	17	mla6 0 HAI (1.97)	none	NA
DE predicted miRNA	TATTAGTTGACAGAGGGAGTA	none	5	mla6 48 HAI (-1.77), mla6- bln1 48 HAI (-2.44), bln1 48 HAI (-2.40)	none	NA
DE predicted miRNA	AACTAGTACTACTCTAATGTGCCT	none	3	mla6 0 HAI (-1.07)	none	NA
DE predicted miRNA	GCTTTCATAGCTCAGTTGGTTAGAGCACCCG	none	1	bln1 32 HAI (1.64)	none	NA
DE predicted miRNA	AATTTGAACTGTGAAACT	none	1	mla6 0 HAI (1.46), mla6 20 HAI (1.76), mla6 24 HAI (1.56)	none	NA

The publisher would like to apologize to the authors and readers for any inconvenience caused. The original article has been corrected.