Literature DB >> 31470619

Dietary 25-Hydroxyvitamin D3 Supplementation Alleviates Porcine Epidemic Diarrhea Virus Infection by Improving Intestinal Structure and Immune Response in Weaned Pigs.

Jiwen Yang1, Gang Tian1, Daiwen Chen1, Ping Zheng1, Jie Yu1, Xiangbing Mao1, Jun He1, Yuheng Luo1, Junqiu Luo1, Zhiqing Huang1, Aimin Wu1, Bing Yu2.   

Abstract

We conducted this experiment to determine if feeding 25-hydroxyvitamin D3 (25(OH)D3) to weaned pigs would alleviate porcine epidemic diarrhea virus (PEDV) infection and immune response. Forty-two weaned pigs were allotted to 1 of 6 dietary 25(OH)D3 treatments (5.5, 5.5, 43.0, 80.5, 118.0, 155.5 μg 25(OH)D3/kg diet) for 26 days. On day 22 of the trial, all the treatments were orally administrated with PEDV except for one of the 5.5 μg 25(OH)D3/kg treatments, which was challenged with the same volume of sterile saline and served as control. Another 5.5 μg 25(OH)D3/kg group for PEDV challenge was named CON-PEDV. Average daily gain (p < 0.05) was reduced by PEDV infection. PEDV administration also induced severe diarrhea (p < 0.05), reduction of villous height and the ratio of villous height to crypt depth, and increase of crypt depth and serum diamine oxidase activity (p < 0.05). Serum IgM and complement component 4 levels were increased by PEDV challenge. However, 155.5 μg 25(OH)D3/kg supplementation alleviated intestinal damage (p < 0.05) compared with CON-PEDV. Furthermore, 155.5 μg 25(OH)D3/kg supplementation downregulated the mRNA abundance of inflammatory cytokines and interferon signal pathway-related genes (p < 0.05) compared with CON-PEDV. These results suggested that dietary supplementation of 155.5 μg 25(OH)D3/kg could alleviate intestinal damage and protect against PEDV-induced inflammatory status.

Entities:  

Keywords:  antivirus; diarrhea; intestinal morphology; piglets; vitamin D

Year:  2019        PMID: 31470619      PMCID: PMC6770734          DOI: 10.3390/ani9090627

Source DB:  PubMed          Journal:  Animals (Basel)        ISSN: 2076-2615            Impact factor:   2.752


1. Introduction

Porcine epidemic diarrhea virus (PEDV) infection causes severe damage to the intestinal function and barrier integrity of pigs [1], leading to diarrhea, vomiting, dehydration, and high mortality in piglets [2]. Recently, it was shown that the villus height and transepithelial resistance were decreased in PEDV-infected pigs [3]. PEDV also induced intestinal mucosa and systemic proinflammatory cytokine responses in pigs [4,5]. Currently, vaccination is the main means for preventing PEDV infection. However, vaccines are poorly effective because of genetic variants of the viruses [6,7]. Vitamin D not only enhances calcium and phosphate absorption but also regulates immune function [8]. Previous studies have shown that vitamin D can inhibit rotavirus replication and alleviate infection symptoms in piglets [9,10]. PEDV infection has shown similar symptoms to rotavirus and, therefore, we speculated that 25(OH)D3 might ease the infection of PEDV in pigs. However, studies on the feasibility of vitamin D3 as anti-PEDV infection agent in piglets are scarce. It is generally believed that the bioavailability of 25(OH)D3 is higher than vitamin D3 [11,12,13]. In this study, 25(OH)D3 was used to investigate whether it could alleviate PEVD-infected diarrhea and intestinal injury.

2. Materials and Methods

The experimental protocol involved in the present study was approved by the Animal Care Advisory Committee of Sichuan Agricultural University (Animal Ethics Committee approval number is CD-SYXK-2017-015).

2.1. Experimental Design

Forty-two crossbred healthy weaned pigs (Duroc × Landrace × Yorkshire, 24 days old) with an initially body weight (BW) of 6.61 ± 0.41 kg were used in the 26 days trial. On the first day of the trial, all pigs were allotted on the basis of BW to six groups and each fed diets supplemented with either 5.5, 5.5, 43.0, 80.5, 118.0, or 155.5 μg 25(OH)D3/kg. Each treatment consisted of four gilts and three barrows. At day 22 of this study, all the treatments were orally administrated with 35 mL of PEDV (5.6 × 103 TCID50/mL) except for one of the 5.5 μg 25(OH)D3/kg (220 IU vitamin D/kg equivalent) treatment, which was served as control (CON) and administrated with the same volume of sterile saline. Another 5.5 μg 25(OH)D3/kg treatment for PEDV challenge was named by CON-PEDV. In order to prevent infection, the CON groups were housed in the next room of challenge groups. The settings for the two rooms were the same. Pigs in the CON group were negative for PEDV throughout the trial period. As shown in Table 1, the basal diet was formulated to meet or exceed nutrient requirement for weaned piglets [14], except for vitamin D3, which was not prepared in the vitamin premix. Each treatment was formed by supplementing with indicated 25(OH)D3 levels in the basal diet. All pigs had ad libitum access to water and experimental diets throughout the trial. 25(OH)D3 (Hy-D) was kindly provided by DSM Nutritional Products Ltd. Shanghai, China. The PEDV was kindly presented by professor Zhiwen Xu, College of Veterinary Medicine, Sichuan Agricultural University. Average daily gain (ADG) and average daily feed intake (ADFI) were determined via weighing to determine body weight and recording of feed intake.
Table 1

Ingredients and nutrient contents of the basal diet.

ItemsContent
Ingredients (%)
Corn35.28
Corn, extruded26.00
Soybean meal, dehulled9.50
Soybean meal, extruded8.00
Soybean protein concentrate5.50
Sucrose2.00
Soybean oil1.50
Fish meal3.50
Dried whey5.50
L-Lysine HCl0.53
DL-Methionine0.10
L-Threonine0.13
L-Tryptophan0.03
Limestone0.90
Dicalcium phosphate0.45
Choline chloride0.15
NaCl0.20
Benzoic acid0.50
vitamin premix 10.03
Mineral premix 20.20
Total100.00
Nutrient content (%)
Digestible energy (kJ/kg)14.64
Crude protein18.6
Calcium0.81
STTD 3 phosphorus0.37
SID 4 Lys1.40
SID 4 Met0.40
SID 4 Thr0.80
SID 4 Trp0.22

1 Provided per kilogram of complete diet: 10,050 IU vitamin A; 40 IU vitamin E; 4 mg vitamin K3; 3 mg thiamine; 9 mg riboflavin; 6 mg VB6; 0.04 mg VB12; 0.3 mg biotin; 35 mg nicotinic acid; 15 mg pantothenic acid; 1.5 mg folic acid. 2 Provided per kilogram of complete diet: 100 mg Fe; 10 mg Cu; 20 mg Mn; 0.3 mg I; 100 mg Zn; Se 0.3 mg. 3 Standardized total tract digestible. 4 Standardized ileal digestible.

After the PEDV challenge, the fecal consistency and diarrhea incidence were assessed every day according to Hu et al. [15]: 1 = hard feces, 2 = firm well formed, 3 = soft and partially formed feces, 4 = loose, semi-liquid feces, and 5 = watery feces. Diarrhea rate (%) = (A/5d) × 100, in which A = total days per pig with diarrhea after PEDV challenge. Mean cumulative score = ∑A/B, in which A = the sum of daily scores, and B = pigs per treatment.

2.2. Sample Collection

All pigs were bled via anterior vein on 27 day. The blood was used for extracting serum via centrifugation at 3000 g for 15 min, and the serum samples were stored at −20 °C until analysis. All pigs were then euthanized by intramuscular injection of Shumianning (comprised of ketamine, xylazine, and midazolam, Nanjing Agricultural University, 0.08 mL/kg body weight). About 2 cm jejunal tissue sample was stored in 4% paraformaldehyde solution for histological analysis. Mucosal samples from the middle jejunum were scraped and rapidly frozen in liquid nitrogen, and then stored at −80 °C for further analysis.

2.3. Immunological Parameters

The concentration of IgG, IgM, and complement component 3 (C3) and C4 (Sichuan Maker Biotechnology Co. Ltd. Chengdu, China) in serum were detected by automatic biochemical analyzer (Model 3100; Hitachi, Tokyo, Japan). Immunology multiple control were performed before sample determination to ensure the outcomes were correct.

2.4. Intestinal Morphology and Integrity

After being embedded in paraffin, the jejunal samples were stained with hematoxylin and eosin for intestinal morphology measurement. A minimum of 20 well-orientated villi and crypts from each intestinal sample of pigs were measured using Image-Pro Plus 6.0 software. As a measurement of intestinal permeability, serum diamine oxidase activity (DAO) was detected using commercial assay kits (Nanjing Jiancheng Institute of Bioengineering, Jiangsu, China) following the protocols of the manufacturer.

2.5. Gene Expression

Total RNA was extracted from the mucosa of jejunum tissue using TRIzol reagent (Invitrogen, Shanghai, China). Reverse transcription was performed with RNA using a PrimeScript RT reagent kit (TaKaRa, Dalian, China). The mRNA expression of genes of interest were quantified using an ABI 7900HT detection system (Applied Biosystems, Foster, CA, USA) and the SYBR Premix Ex Taq II with ROX reagents (TaKaRa, Dalian, China). The primer sequences used for RT-PCR are listed in Table 2. All primer pairs were designed to have melting temperatures of approximately 60 °C. Cycling conditions were as follows: 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The relative mRNA expression of each gene was calculated according to a previous publication [16]. Expression levels were normalized to β-actin.
Table 2

Primer sequence of the target and reference genes.

GenesPrimer Sequence (5′–3′)ProductGenBank Accession
MUC2 Forward: GGTCATGCTGGAGCTGGACAGT181XM_021082584.1
Reverse: TGCCTCCTCGGGGTCGTCAC
Claudin2 Forward: GCATCATTTCCTCCCTGTT156NM_001161638.1
Reverse: TCTTGGCTTTGGGTGGTT
ZO1 Forward: CGTGTCAACGCCACTATCA90XM_021098896.1
Reverse: TTGTCTTCCAAAGCCCCT
Occludin Forward: AACTTCCACTGATGTCCCCCGT116NM_001163647.2
Reverse: CCTAGACTTTCCTGCTCTGCCC
RIGI Forward: AGAGCAGCGGCGGAATC82NM_213804.2
Reverse: GGCCATGTAGCTCAGGATGAA
MDA5 Forward: TCCGGGAAACAGGCAACTC75NM_001100194.1
Reverse: CAAAGGATGGAGAGGGCAAGT
TLR2 Forward: TCACTTGTCTAACTTATCATCCTCTTG162XM_005653576.3
Reverse: TCAGCGAAGGTGTCATTATTGC
TLR9 Forward: CACGACAGCCGAATAGCAC121NM_213958.1
Reverse: GGGAACAGGGAGCAGAGC
MyD88 Forward: GTGCCGTCGGATGGTAGTG65NM001099923
Reverse: TCTGGAAGTCACATTCCTTGCTT
IFNα Forward: ACCTGGAAGCCTGTGTCATG164NM_214393.1
Reverse: CATGACTTCTGCCCTGACGA
IFNλ Forward: TGCATCACATCCACGTCGAA131NM_001142837.1
Reverse: GCAGCCTTGGGACTCTTTCT
MxA Forward: GCATCACCAGGGTAGCTGTA195NM_214061.2
Reverse: AGATCCCGATGGTCCTGTCT
IL6 Forward: TTCACCTCTCCGGACAAAAC122NM_001252429.1
Reverse: TCTGCCAGTACCTCCTTGCT
IL8 Forward: AGTTTTCCTGCTTTCTGCAGCT72NM_213867.1
Reverse: TGGCATCGAAGTTCTGCACT
STAT1 Forward: GCAGGTTCATCAGCTCTACGA124NM_213769.1
Reverse: AAAACGGATGGTGGCAAACG
IFNAR1 Forward: TCTTCATCCGTGTCCAAGCA105NM_213772.1
Reverse: TGATGACGGGAGGAAACAGG
IFNLR1 Forward: TCCGAGGACTTGAGTTCCCT126XM_021095536.1
Reverse: GGTCAGTGTCCGCAGAGAAA
TRIF Forward: ACTCGGCCTTCACCATCCT87NM_001315738.2
Reverse: GGCTGCTCATCAGAGACTGGTT
TRAF3 Forward: ACACCGGCTACTTTGGCTAC106XM_021081630.1
Reverse: TCCCCACGCATGATGACAAA
β-Actin Forward: GGATGACGATATTGCTGCGC190XM_003124280.5
Reverse: GATGCCTCTCTTGCTCTGGG

MUC2 = mucin 2; ZO1 = zonula occludens protein-1; RIGI = retinoic acid inducible gene I; MDA5 = melanoma differentiation-associated protein 5; TLR = toll-like receptor; MyD88 = myeloid differentiation factor 88; IFN = interferon; MxA = myxovirus resistance A; IL = interleukin; STAT = signal transducers and activators of transcription; IFNAR1 = interferon α and β receptor subunit 1; IFNLR1 = interferon lambda receptor 1; TRIF = toll-like receptor-associated activator of interferon; TRAF3 = TNF receptor-associated factor 3.

2.6. Protein Expression

Protein sample processing was performed according to Zhang et al. [17]. Briefly, jejunal mucosa protein was extracted with lysis buffer (Beyotime, Shanghai, China). After centrifugation for 20 min at 12,000 rpm, the supernatants were harvested for bicinchoninic acid assay to detect protein concentration. Then, the samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes, and incubated with the corresponding antibodies: anti-sucrase-isomaltase (SI), anti-sIgA, anti-occludin (Abcam, Shanghai, China), and anti-β-actin (Santa Cruz, Shanghai, China). Following washing, the samples were incubated with secondary antibodies, and then proteins were incubated with Electro-Chemi-Luminescence reagent for chemiluminescence. The protein expression was analyzed by Image Lab and normalized to β-actin.

2.7. Statistical Analyses

In this study, each pig was used as the experimental unit. The differences between CON and CON-PEDV group were assayed by Student’s t-test. On the condition of PEDV challenge, the data were performed using the PROC MIXED SAS 9.4 procedure according to the following model:Y = μ + α + β + ε, where Y = dependent variable; μ = mean; α = effect of treatment; β = block effect of BW, and ε = error. Orthogonal comparisons were also applied for linear and quadratic responses of increasing dietary 25(OH)D3 levels (5.5, 43.0, 80.5, 118.0, 155.5 μg 25(OH)D3/kg). Data of the innate immune gene expression were analyzed by Tukey’s test for post hoc comparisons. The significance was declared at p < 0.05 and trends at p < 0.10.

3. Results

3.1. Performance and Diarrhea Parameter

As shown in Table 3, PEDV challenge (CON-PEDV) decreased ADG (p < 0.05) and ADFI (p = 0.08) compared with CON. However, the performance was not influenced among the different 25(OH)D3 supplementation groups. PEDV infection induced severe diarrhea in piglets (Table 3, p < 0.05). However, the dietary supplementation of 25(OH)D3 decrease diarrhea scores (p < 0.05) and diarrhea rate (Table 3, p < 0.1).
Table 3

Growth performance and diarrhea parameter of weaned piglets fed 25(OH)D3 as indicated with porcine epidemic diarrhea virus (PEDV) challenge.

CON (PEDV−)PEDV ChallengeSEMp-Value
25(OH)D3 (μg/kg)5.55.543.080.5118.0155.525(OH)D3LinearQuadratic
1–26 day
ADG (g)301.40246.62 *220.27252.12282.36256.4123.390.460.290.99
ADFI (g)456.25401.86 #374.90399.64433.40376.4822.950.240.810.49
Feed efficiency0.660.610.570.630.640.670.020.240.070.33
22–26 day
Mean cumulative score10.0016.21 *,a15.71 a,b13.93 a,b14.00 a,b11.25 b1.270.04<0.010.57
Diarrhea rate (%)060.00 *54.2948.5748.5716.6710.250.06<0.010.24

SEM, standard error. * Means different from CON (p < 0.05); # Means different from CON (p < 0.1); a,b Means not sharing the same superscript differ at p < 0.05.

3.2. Immunological Responses

PEDV infection increased serum IgM and C4 concentrations compared with CON (p < 0.05, Table 4). However, different levels of 25(OH)D3 supplementation had no effect on serum IgM, IgG, and C4 levels on the condition of PEDV challenge. In addition, dietary supplementation of 155.5 μg 25(OH)D3/kg decreased serum C3 levels compared with the 118.0 μg 25(OH)D3/kg group.
Table 4

Serum immunoglobulins and complement component levels of weaned piglets fed 25(OH)D3 as indicated with PEDV challenge.

CON (PEDV−)PEDV ChallengeSEMp-Value
25(OH)D3 (μg/kg)5.55.543.080.5118.0155.525(OH)D3LinearQuadratic
IgG (g/L)3.634.344.684.333.844.450.250.260.430.66
IgM (mg/L)96.71204.43 *156.71165.83222.86216.4334.930.530.390.32
C3 (mg/L)64.1475.86 a,b76.71 a,b64.57 a,b87.83 a58.14 b6.020.020.210.26
C4 (mg/L)4.178.17 *13.5715.8611.4310.142.530.270.830.04

SEM, standard error; * Means different from CON (p < 0.05); a,b Means not sharing the same superscript differ at p < 0.05.

3.3. Intestinal Morphology and Permeability

Compared with CON, PEDV challenge decreased villous height and the ratio of villous height to crypt depth (VCR), and increased the crypt depth of jejunum in the CON-PEDV group (Table 5, p < 0.05). However, 118.0 and 155.5 μg 25(OH)D3/kg treatments significantly increased villous height and VCR and decreased crypt depth compared with the CON-PEDV group (Table 5, p < 0.05). Furthermore, dietary supplementation of 25(OH)D3 increased villous height and VCR and decreased crypt depth in a linear way (p < 0.05).
Table 5

Jejunal villous height, crypt depth, and the ratio of villous height/crypt depth (VCR) of weaned piglets fed 25(OH)D3 as indicated with PEDV challenge.

CON (PEDV−)PEDV ChallengeSEMp-Value
25(OH)D3 (μg/kg)5.55.543.080.5118.0155.525(OH)D3LinearQuadratic
Villus height (μm)468.40263.19 *,b290.2 a,b314.51 a,b330.56 a333.36 a14.270.01<0.010.26
Crypt depth (μm)189.40247.9 *,a219.46 b190.03 b,c179.64 c,d163.6 d5.42<0.01<0.010.11
VCR2.501.06 *,a1.39 a,b1.65 b,c1.84 c,d2.02 d0.09<0.01<0.010.25

SEM, standard error; * Means different from CON (p < 0.05); a,b,c,d Means not sharing the same superscript differ at p < 0.05.

In addition, serum DAO activity of pigs in the CON-PEDV group was significantly increased compared with CON (Figure 1, p < 0.05). However, the dietary supplementation of 25(OH)D3 tended to decrease serum DAO activity (p < 0.1).
Figure 1

Serum diamine oxidase activity (DAO) activity of weaned piglets fed 25(OH)D3 as indicated with PEDV challenge. The p1 means t-test between CON and CON-PEDV, and p2 value means multiple comparisons among the PEDV challenge groups.

3.4. Intestinal Barrier Related Genes and Protein Expression

Compared with CON, the gene expression of intestinal barrier-related genes was not influenced by PEDV (Table 6). Upon PEDV challenge, the dietary supplementation of 25(OH)D3 increased jejunal claudin-2 gene expression significantly and this treatment effect was linear (p < 0.05). 25(OH)D3 also tended to increase MUC2 and mRNA expression (p < 0.1). Interestingly, PEDV increased sucrase-isomaltase (SI) and occludin protein levels, but high doses 25(OH)D3 (155.5 μg 25(OH)D3/kg) inhibited these increase (Figure 2).
Table 6

Relative gene expression of intestinal barrier-related genes of weaned piglets fed the indicated 25(OH)D3 with PEDV challenge.

CON (PEDV−)PEDV ChallengeSEMp-Value
25(OH)D3 (μg/kg)5.55.543.080.5118.0155.525(OH)D3LinearQuadratic
MUC2 1.001.220.980.921.371.710.170.090.020.02
Occludin 1.001.100.831.071.231.630.280.350.110.20
ZO1 1.001.130.760.810.921.340.200.240.380.04
Claudin2 1.001.021.021.081.291.330.090.04<0.010.52

SEM, standard error.

Figure 2

Intestinal barrier related protein expression in the jejunal mucosa of weaned piglets fed indicated 25(OH)D3 dietary with PEDV challenge.

3.5. Innate Immune Gene Expression in Jejunum

PEDV induced a significant increase in the mRNA expression of RIGI, TLR2, MyD88, IL6, IL8, IFNλ1, and MxA compared to CON (Table 7, p < 0.05). However, a high dose of dietary 25(OH)D3 supplementation decreased TLR2, TLR9, MyD88, IL6, IL8, IFNλ1, STAT1, MxA, IFNAR1, and TRIF mRNA expression compared with CON-PEDV (Table 7, p < 0.05).
Table 7

Relative gene expression of innate immune in the jejunal mucosa of weaned piglets fed 25(OH)D3 as indicated with PEDV challenge.

CON (PEDV−)PEDV Challenge p 1 p 2
25(OH)D3 (μg/kg)5.55.5118.0155.5
RIG1 1.00 ± 0.203.07 ± 0.68 *1.94 ± 0.381.41 ± 0.300.020.09
MDA5 1.00 ± 0.201.27 ± 0.230.83 ± 0.090.73 ± 0.070.380.24
TLR2 1.00 ± 0.143.94 ± 0.72 *,a1.77 ± 0.54 b1.58 ± 0.37 b<0.010.02
TLR9 1.00 ± 0.201.40 ± 0.191.06 ± 0.120.81 ± 0.180.170.07
MyD88 1.00 ± 0.101.42 ± 0.12 *1.13 ± 0.121.16 ± 0.120.020.20
IFNα 1.00 ± 0.110.94 ± 0.131.02 ± 0.180.93 ± 0.130.720.9
IFNλ 1.00 ± 0.232.06 ± 0.32 *,a1.20 ± 0.25 b1.10 ± 0.10 b0.020.02
MxA 1.00 ± 0.242.96 ± 0.61 *,a1.72 ± 0.17 a,b1.05 ± 0.18 b0.010.02
IL6 1.00 ± 0.202.49 ± 0.52 *,a0.97 ± 0.28 b0.71 ± 0.18 b0.040.01
IL8 1.00 ± 0.202.73 ± 0.54 *,a1.53 ± 0.50 a,b0.95 ± 0.11 b0.020.03
STAT1 1.00 ± 0.171.25 ± 0.16 a0.92 ± 0.11 a,b0.67 ± 0.13 b0.310.03
IFNAR1 1.00 ± 0.191.64 ± 0.301.13 ± 0.190.86 ± 0.110.090.08
IFNLR1 1.00 ± 0.080.82 ± 0.061.10 ± 0.160.93 ± 0.120.090.36
TRIF 1.00 ± 0.121.20 ± 0.17a0.74 ± 0.17 b0.60 ± 0.08 b0.370.02
TRAF3 1.00 ± 0.190.96 ± 0.130.91 ± 0.180.76 ± 0.080.860.57

* Means different from CON (p < 0.05); a,b Means not sharing the same superscript differ at p < 0.05. The p1 means t-test between CON and CON-PEDV, and p2 value means multiple comparisons among the PEDV challenge groups.

4. Discussion

Early studies suggested that vitamin D exerts broad-spectrum antiviral effects, including inhibiting the replication of dengue virus [18], hepatitis C virus [19], rotavirus [9], and others. Due to the similarity in symptoms after rotavirus and PEDV infection in pigs, we carried out this study to investigate whether 25(OH)D3 could alleviate PEDV infection. We have previously demonstrated that increasing dietary 25(OH)D3 levels linearly increased serum 25(OH)D3 concentrations, but no treatment effects were observed in the growth performance of weaned pigs [20]. In the current study, PEDV challenge decreased ADG and ADFI, and resulted in severe diarrhea of the piglets. Previous studies have reported that PEDV infection reduced growth performance and resulted in severe diarrhea [21,22,23]. We have analyzed the PEDV-N gene in jejunum mucosa by PCR, and the results revealed that PEDV was prevalent in the PEDV-inoculated pigs, whereas CON treatments were negative for PEDV (Supplementary Materials). This suggested that the PEDV infection model was successfully established. In the current study, dietary 25(OH)D3 supplementation decreased diarrhea scores, and 155.5 μg 25(OH)D3/kg treatment showed the minimum diarrhea scores and diarrhea rate, which indicated that supplementation with a high dose of 25(OH)D3 might alleviate the symptoms of PEDV infection. The complement system is a part of the innate immune system, and not only participates in inflammation but also enhances the adaptive immune response [24]. In this study, serum C4 level was increased with PEDV challenge as compared with CON. We also found that serum IgM levels were increased by PEDV challenge. Immunoglobulins are the major secretory products of humoral immunity [25]. These results indicated that the PEDV infection activated the innate and humoral immune response. However, dietary 25(OH)D3 supplementation had no effect on serum C4 and IgM levels under the conditions of PEDV challenge. We inferred that 25(OH)D3 might exert an antiviral effect on intestinal mucosa, which is the main target of PEDV replication [26]. PEDV infection always leads to morphological changes of the small intestine with a reduction in villus height and damage to intestinal integrity [3,27]. In this study, we also found that villus height and VCR were decreased, and crypt depth was increased with PEDV challenge. In addition, serum DAO activity was also increased by PEDV challenge. Serum DAO activity is a marker of mucosal integrity [28]. These results indicated that PEDV induced morphological changes of jejunum and an increase in intestinal permeability. The 155.5 μg 25(OH)D3/kg 25(OH)D3 treatment was shown to be optimal in alleviating intestinal injury induced by PEDV. Therefore, this may be the reason why the 155.5 μg 25(OH)D3/kg treatment showed the minimum diarrhea scores and diarrhea rate among the treatments. Moreover, we found that claudin2 gene expression showed a linear response with increasing dietary 25(OH)D3 concentration, and 25(OH)D3 tended to increase MUC2 expression under the conditions of PEDV challenge. It suggested that high dose 25(OH)D3 supplementation could improve tight junction protein expression to maintain intestinal barrier integrity. Interestingly, levels of SI, an intestinal absorptive cell marker, were significantly increased by PEDV challenge. A previous study has shown that PEDV infection decreased goblet cells in intestinal villous [29]. Hence, we infer that PEDV infection could cause disorder differentiation of intestinal cells, which promotes the differentiation of intestinal stem cells to intestinal absorption cells, while decreasing differentiation to intestinal secretion cells. However, high dose 25(OH)D3 supplementation significantly reduced the SI expression induced by PEDV, which might be beneficial for maintaining normal intestinal function. We also found occludin expression was increased with PEDV challenge compared with CON, but 118.0 and 155.5 μg 25(OH)D3/kg groups inhibited this increase. Luo et al. [30] demonstrated that overexpression of occludin in target cells makes them more susceptible to PEDV infection, which indicated that occludin plays an essential role in PEDV infection. In the present study, we speculated that 155.5 μg 25(OH)D3/kg supplementation might ease PEDV infection through decreasing occludin expression. Innate immune response plays an important role in defense against viral infections in mammalian cells. During viral infection, the virus is recognized by pattern-recognition receptors (PRRs) including toll-like receptors (TLRs) and retinoic acid-inducible gene I (RIGI) or melanoma differentiation gene 5 (MDA5), then INFs and proinflammatory cytokines are produced for initiation of the inherent antiviral immune response [31,32]. Different types of IFNs bind to different receptors. Type I IFNs (IFN-α and IFN-β) signal through IFNAR1 and IFNAR2 to activate the JAK-STAT signaling pathway. And type III IFNs (IFN-λs) signal through IFNLR1 and IL10R2 to activate JAK-STAT signaling pathway to induce the expression of hundreds of interferon stimulating genes [31]. Unlike type I interferon receptors, which are seemingly ubiquitous, type III IFN receptors are confined to the mucosal epithelium [33]. Thus, IFN-λs mainly play an antiviral role in mucosal epithelial cells. In the current study, PEDV increased the PRR, inflammatory cytokine, and IFNλ expression in the jejunum mucosa. This indicates that the IFNs signaling pathway was activated by PEDV in the intestine of piglets. Since the high dose of 25(OH)D3 supplementation showed a better protective effect than the low dose groups, we investigated whether high dose supplementation could alleviate PEDV infection by regulating immunity. We found that a high dose of 25(OH)D3 inhibited the PRR, IFNλ, STAT1, and MxA expression. It was suggested that dietary 25(OH)D3 supplementation inhibited the activation of intestinal immunity induced by PEDV. Previous studies have shown that vitamin D attenuated rotavirus infection and reduced the viability of Mycobacterium tuberculosis through regulating autophagy and cathelicidin [9,34]. Therefore, we speculated that the suppression of the IFN signaling pathway from high dose supplementation of 25(OH)D3 might be due to decreased PEDV replication. In addition, we also found that high doses of 25(OH)D3 inhibited jejunal mucosa IL6 and IL8 mRNA expression compared with CON-PEDV. This suggested that high dose 25(OH)D3 supplementation might inhibit intestinal inflammation induced by PEDV. Reducing the expression of intestinal inflammatory cytokines is also beneficial in maintaining normal intestinal function.

5. Conclusions

In summary, the results of the current study indicate that dietary supplementation of 155.5 μg/kg 25(OH)D3 alleviated the severity of diarrhea of piglets infected with PEDV by improving the intestinal structure and immune response, and maintaining regular intestinal function.
  32 in total

1.  Butyrate promotes slow-twitch myofiber formation and mitochondrial biogenesis in finishing pigs via inducing specific microRNAs and PGC-1α expression1.

Authors:  Yong Zhang; Bing Yu; Jie Yu; Ping Zheng; Zhiqing Huang; Yuheng Luo; Junqiu Luo; Xiangbing Mao; Honglin Yan; Jun He; Daiwen Chen
Journal:  J Anim Sci       Date:  2019-07-30       Impact factor: 3.159

2.  In situ hybridization for the detection and localization of porcine epidemic diarrhea virus in the intestinal tissues from naturally infected piglets.

Authors:  O Kim; C Chae
Journal:  Vet Pathol       Date:  2000-01       Impact factor: 2.221

3.  N-Acetylcysteine supplementation alleviates intestinal injury in piglets infected by porcine epidemic diarrhea virus.

Authors:  Lei Wang; Jia Zhou; Yongqing Hou; Dan Yi; Binying Ding; Jiaqian Xie; Yue Zhang; Hongbo Chen; Tao Wu; Di Zhao; Chien-An Andy Hu; Guoyao Wu
Journal:  Amino Acids       Date:  2017-03-03       Impact factor: 3.520

4.  Effects of dietary 25-hydroxyvitamin D3 supplementation on growth performance, immune function and antioxidative capacity in weaned piglets.

Authors:  Jiwen Yang; Gang Tian; Daiwen Chen; Ping Zheng; Jie Yu; Xiangbing Mao; Jun He; Yuheng Luo; Junqiu Luo; Zhiqing Huang; Bing Yu
Journal:  Arch Anim Nutr       Date:  2019-02       Impact factor: 2.242

5.  Dietary vitamin D supplementation attenuates immune responses of pigs challenged with rotavirus potentially through the retinoic acid-inducible gene I signalling pathway.

Authors:  Ye Zhao; Bing Yu; Xiangbing Mao; Jun He; Zhiqing Huang; Ping Zheng; Jie Yu; Guoquan Han; Xiaofang Liang; Daiwen Chen
Journal:  Br J Nutr       Date:  2014-05-15       Impact factor: 3.718

6.  Outbreak of porcine epidemic diarrhea in suckling piglets, China.

Authors:  Rui-Qin Sun; Ru-Jian Cai; Ya-Qiang Chen; Peng-Shuai Liang; De-Kun Chen; Chang-Xu Song
Journal:  Emerg Infect Dis       Date:  2012-01       Impact factor: 6.883

Review 7.  Vitamin D and immune function.

Authors:  Barbara Prietl; Gerlies Treiber; Thomas R Pieber; Karin Amrein
Journal:  Nutrients       Date:  2013-07-05       Impact factor: 5.717

8.  Porcine epidemic diarrhea virus reduces feed efficiency in nursery pigs.

Authors:  S M Curry; E R Burrough; K J Schwartz; K J Yoon; S M Lonergan; N K Gabler
Journal:  J Anim Sci       Date:  2018-02-15       Impact factor: 3.159

9.  Differential gene modulation of pattern-recognition receptor TLR and RIG-I-like and downstream mediators on intestinal mucosa of pigs infected with PEDV non S-INDEL and PEDV S-INDEL strains.

Authors:  G Temeeyasen; A Sinha; L G Gimenez-Lirola; J Q Zhang; P E Piñeyro
Journal:  Virology       Date:  2017-12-14       Impact factor: 3.616

10.  Porcine epidemic diarrhea virus induces caspase-independent apoptosis through activation of mitochondrial apoptosis-inducing factor.

Authors:  Youngnam Kim; Changhee Lee
Journal:  Virology       Date:  2014-06-05       Impact factor: 3.616

View more
  5 in total

1.  Impact of dietary vitamin D3 supplements in nursery diets on subsequent growth and bone responses of pigs during an immune challenge.

Authors:  Morgan McCue; Jamie L Reichert; Thomas D Crenshaw
Journal:  J Anim Sci       Date:  2019-12-17       Impact factor: 3.159

2.  Systematic review of animal-based indicators to measure thermal, social, and immune-related stress in pigs.

Authors:  Raúl David Guevara; Jose J Pastor; Xavier Manteca; Gemma Tedo; Pol Llonch
Journal:  PLoS One       Date:  2022-05-05       Impact factor: 3.752

3.  Dietary 25-Hydroxyvitamin D3 Supplementation Modulates Intestinal Cytokines in Young Broiler Chickens.

Authors:  Gerardo A Abascal-Ponciano; Samuel F Leiva; Joshua J Flees; Luis P Avila; Jessica D Starkey; Charles W Starkey
Journal:  Front Vet Sci       Date:  2022-07-11

Review 4.  Controversial Effects of Vitamin D and Related Genes on Viral Infections, Pathogenesis, and Treatment Outcomes.

Authors:  Choongho Lee
Journal:  Nutrients       Date:  2020-03-30       Impact factor: 5.717

Review 5.  Host Factors Affecting Generation of Immunity Against Porcine Epidemic Diarrhea Virus in Pregnant and Lactating Swine and Passive Protection of Neonates.

Authors:  Stephanie N Langel; Qiuhong Wang; Anastasia N Vlasova; Linda J Saif
Journal:  Pathogens       Date:  2020-02-18
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.