| Literature DB >> 31467863 |
Yoshiko Okamura1,2, Laura Treu3, Stefano Campanaro4, Sena Yamashita1, Shota Nakai1, Hirokazu Takahashi1,2, Kenshi Watanabe1, Irini Angelidaki3, Tsunehiro Aki1,2, Yukihiko Matsumura5,2, Yutaka Nakashimada1,2.
Abstract
Reducing CO2 emissions is necessary to alleviate rising global temperature. Renewable sources of energy are becoming an increasingly important substitute for fossil fuels. An important step in this direction is the isolation of novel, technologically relevant microorganisms. Nitratireductor sp. strain OM-1 can convert volatile short-chain fatty acids in wastewater into 2-butenoic acid and its ester and can accumulate intracellularly esterified compounds up to 50% of its dried cell weight under nitrogen-depleted conditions. It is believed that a novel fatty acid biosynthesis pathway including an esterifying enzyme is encoded in its genome. In this study, we report the whole-genome sequence (4.8 Mb) of OM-1, which comprises a chromosome (3,977,827 bp) and a megaplasmid (857,937 bp). This sequence information provides insight into the genome organization and biochemical pathways of OM-1. In addition, we identified lipid biosynthesis pathways in OM-1, paving the way to a better understanding of its biochemical characterization.Entities:
Keywords: Biodiesel production; Ester synthesis; Nitratireductor; Short-chain fatty acid; Whole genome sequence
Year: 2019 PMID: 31467863 PMCID: PMC6712368 DOI: 10.1016/j.btre.2019.e00366
Source DB: PubMed Journal: Biotechnol Rep (Amst) ISSN: 2215-017X
Primer sets for real-time PCR.
| Gene name | Primer name | Primer sequence | Product length (bp) |
|---|---|---|---|
| FabI | NispOM1_01264-157F | gccgagaaagtgaactccaa | 221 |
| NispOM1_01264-377R | tccgtgaaggaatagcagga | ||
| FabB | NispOM1_01265-266F | aggaaggcgacatcaccaac | 218 |
| NispOM1_01265-483R | ggccgacgagatcgagtagt | ||
| FabA | NispOM1_01266-144F | tgagttcggaaagggctatg | 242 |
| NispOM1_01266-385R | tgccgtattcgaccttcttc | ||
| FabI | NispOM1_02078-4F | acaagtggcaatggcctgat | 247 |
| NispOM1_02078-250R | tctcgagcttctcgaacacc | ||
| FabD | NispOM1_02313-120F | gcagaagctttccagcatca | 216 |
| NispOM1_02313-335R | gtatcggccagcgagaacat | ||
| FabG | NispOM1_02314-217F | gatcgcagtgaagtcaagca | 234 |
| NispOM1_02314-450R | cacggaggtgatgttgatga | ||
| FabF | NispOM1_02317-56F | ttgaacatgggtggaagagc | 194 |
| NispOM1_02317-249R | agcaatgccgtaggtgatga | ||
| DesA | NispOM1_02462-156F | agtcgctgttgcaaatggat | 223 |
| NispOM1_02462-378R | gttacctgccgtagcgtgat | ||
| FabH | NispOM1_02523-175F | atgatcattctggccacgtc | 228 |
| NispOM1_02523-402R | gtcgttccagtcgagaatgc | ||
| FabF2 | NispOM1_02717-15F | cagctttggaagacccgtta | 160 |
| NispOM1_02717-174F | aaccagatcggcaagctcat | ||
| FabF2 | NispOM1_02718-28F | ggtatgggcatcgtttcctc | 250 |
| NispOM1_02718-277R | cctcgtcacccttcatgtcg | ||
| FabZ | NispOM1_02824-35F | aaagcctcgacatcatggac | 241 |
| NispOM1_02824-275R | ctctcatcacccgcattgtt | ||
| AccC | NispOM1_03058-64F | aaggagctcggcatccagac | 249 |
| NispOM1_03058-312R | gccgatgaaggtgagattgt | ||
| FabH | NispOM1_03467-18F | gcaagaggcttcagacttcg | 248 |
| NispOM1_03467-265R | cgtcacgctcatagacatgg | ||
| PlsX | NispOM1_02522-94F | gcccgctttcttgtatacgg | 189 |
| NispOM1_02522-282R | atttttcaccgcttcgatgg | ||
| ー | NispOM1_02853-4F | aacaccatcctgtgctacgg | 228 |
| NispOM1_02853-231R | atggctcgtcagaagtgtcg | ||
| GlpK | NispOM1_02947-133F | gagcatgatcccgaagacat | 215 |
| NispOM1_02947-347R | tttttcagcgtttcgcacag | ||
| AccA | NispOM1_00687-131F | ccaaggatgcgctcatagaa | 232 |
| NispOM1_00687-362R | gtgtcattgcccttttcctg | ||
| TesB | NispOM1_00827-8F | cggccatgcaagacctactc | 225 |
| NispOM1_00827-232R | cctcgtagatgatcggaacg | ||
| TE | NispOM1_00935-97F | cttgcaaaccaggtcgaaat | 215 |
| NispOM1_00935-311R | atcacgatgtcggtgctctc | ||
| AccD | NispOM1_01103-77F | ggatcaaggatcccgagagt | 248 |
| NispOM1_01103-324R | gtcttccatgctggtcttgg | ||
| AccB | NispOM1_03057-20F | gggtcgatcagcaactcatt | 208 |
| NispOM1_03057-227R | gggctcttcttggcttcttc | ||
| 16S rRNA | 8F | agagtttgatcctggctcag | 529 |
| 536R | gwattaccgcggckgctg |
Fig. 1(A, B) SEM images of OM-1 cells. OM-1 cells were grown with 10 mM (A) and 0 mM (B) ammonium chloride. (C, D) GC chromatogram of total lipid extracts from OM-1 cells grown with 10 mM (B) and 0 mM (C) ammonium chloride. SEM, scanning electron microscopy; ATCC, American Type Culture Collection; GC, gas chromatography.
Fig. 2Circular view of chromosomal and megaplasmid sequences of OM-1. The circular display shows (from outside inward): (a) predicted CDSs localized on forward and reverse strands colored according to the COG classification, (b) genomic regions corresponding to integrated prophages, (c) GC content (%), and (d) GC skew (G + C/G—C). CDS, coding sequence; COG, Clusters of Orthologous Groups; GC, gas chromatography.
Genome statistics. Chr = chromosome; pl = megaplasmid.
| Attribute | Value |
|---|---|
| Genome size (bp) | 48,35,764 |
| DNA coding (%) | 89.2 |
| G + C content | 0.62 (chr); 0.61 (pl) |
| DNA scaffolds | 2 |
| Protein coding genes | 4561 |
| RNA genes | 60 |
| Genes with function prediction (eggNOG) | 4127 |
| Genes assigned to COGs | 4127 |
| CRISPR repeats | 3 |
Fig. 3Predicted metabolic pathways. (A) Fatty acid synthesis, (B) glycerolipid synthesis, and (C) hypothetical biosynthesis pathway for 2-butenoic acid ester. These pathways were drawn on the basis of the KEGG pathways map00061 and map00561 and the schematic pathway proposed by Liu et al. [15]. Pink and light-blue boxes denote compounds and enzymes, respectively. Predicted genes of OM-1 are shown by red letters. Inserted bar graphs showed relative gene expression under the nitrogen-supplemented and nitrogen-depleted conditions. Red and blue bars mean up-regulation under the nitrogen-depleted condition and down-regulation under the nitrogen-supplemented condition, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).
List of gene sets found in lipid synthesis pathways.
| predicted_gene | Gene ID | seed_eggNOG_ortholog | seed_ortholog_evalue | eggNOG annotation | |
|---|---|---|---|---|---|
| FASN, FabD | NispOM1_02313 | 266779.Meso_1769 | 6E-168 | malonyl CoA-acyl carrier protein transacylase | |
| AccC (EC6.4.1.2) | NispOM1_03058 | 536019.Mesop_4689 | 1.5E-278 | acetyl-CoA carboxylase, biotin carboxylase | |
| FabB | NispOM1_01265 | 887898.HMPREF0551_1597 | 7.1E-163 | 3-ketoacyl-ACP synthase | |
| FabF | NispOM1_02317 | 266779.Meso_1766 | 4.7E-244 | Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP (By similarity) | |
| FABF2 | NispOM1_02717 | 266779.Meso_1318 | 1.6E-230 | synthase | |
| FABF2 | NispOM1_02718 | 266779.Meso_1319 | 1.5E-190 | 3-oxoacyl-(acyl carrier protein) synthase | |
| FabH | NispOM1_02523 | 266835.mlr8424 | 1E-183 | Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP. Catalyzes the first condensation reaction which initiates fatty acid synthesis and may therefore play a role in governing the total rate of fatty acid production. (By similarity) | |
| FabH | NispOM1_03467 | 856793.MICA_879 | 2.5E-116 | synthase | |
| FabG | NispOM1_02314 | 311402.Avi_1528 | 4.2E-144 | reductase | |
| FabA | NispOM1_01266 | 384765.SIAM614_27467 | 7.1E-106 | Catalyzes the dehydration of (3R)-3-hydroxydecanoyl- ACP to E-(2)-decenoyl-ACP and then its isomerization to Z-(3)- decenoyl-ACP. Can catalyze the dehydratase reaction for beta- hydroxyacyl-ACPs with saturated chain lengths up to 16 0, being most active on intermediate chain length (By similarity) | |
| FabZ | NispOM1_02824 | 266779.Meso_1390 | 4.4E-78 | Involved in unsaturated fatty acids biosynthesis. Catalyzes the dehydration of short chain beta-hydroxyacyl-ACPs and long chain saturated and unsaturated beta-hydroxyacyl-ACPs (By similarity) | |
| FabI | NispOM1_01264 | 266779.Meso_3937 | 2.5E-158 | Enoyl- acyl-carrier-protein reductase NADH | |
| FabI | NispOM1_02078 | 266779.Meso_0727 | 1.4E-162 | Enoyl- acyl-carrier-protein reductase NADH | |
| DesA | NispOM1_02462 | 287752.SI859A1_03518 | 4.3E-180 | Fatty Acid Desaturase | |
| PlsX (EC2.3.1.15) | NispOM1_02522 | 266779.Meso_1145 | 3.3E-198 | Catalyzes the reversible formation of acyl-phosphate (acyl-PO(4)) from acyl- acyl-carrier-protein (acyl-ACP). This enzyme utilizes acyl-ACP as fatty acyl donor, but not acyl-CoA (By similarity) | |
| EC2.3.1.22 | NispOM1_00796 | 266779.Meso_3211 | 1.3E-151 | Phospholipid glycerol acyltransferase | |
| EC2.3.1.158 | NispOM1_00796 | 266779.Meso_3211 | 1.3E-151 | Phospholipid glycerol acyltransferase | |
| EC2.7.1.30 | NispOM1_02497 | 266835.mll3568 | 1.1E-49 | Esterase (Lipase)-like protein | |
| Pgk (EC2.7.1.94) | NispOM1_00860 | 266779.Meso_3437 | 3.3E-215 | Phosphoglycerate kinase | |
| EC2.7.1.107 | NispOM1_00713 | 266779.Meso_3102 | 1.8E-103 | Diacylglycerol kinase | |
| EC3.1.1.3 | NispOM1_02853 | 266779.Meso_1627 | 1.7E-97 | Lipolytic protein, GDSL | |
| GppA (EC3.1.1.21) | NispOM1_02487 | 266779.Meso_1120 | 7.1E-255 | ppx gppa phosphatase | |
| GlpK (EC3.1.1.23) | NispOM1_02947 | 266835.mll0700 | 8.5E-265 | Key enzyme in the regulation of glycerol uptake and metabolism (By similarity) | |
| AccA | NispOM1_00687 | 266779.Meso_3061 | 2.6E-179 | Component of the acetyl coenzyme A carboxylase (ACC) complex. First, biotin carboxylase catalyzes the carboxylation of biotin on its carrier protein (BCCP) and then the CO(2) group is transferred by the carboxyltransferase to acetyl-CoA to form malonyl-CoA (By similarity) | |
| AccB | NispOM1_03057 | 765698.Mesci_3558 | 7.9E-63 | Acetyl-CoA carboxylase, biotin carboxyl carrier protein | |
| * | AccC | NispOM1_03058 | 536019.Mesop_4689 | 1.5E-278 | acetyl-CoA carboxylase, biotin carboxylase |
| AccD | NispOM1_01103 | 266779.Meso_0663 | 7.5E-170 | Component of the acetyl coenzyme A carboxylase (ACC) complex. Biotin carboxylase (BC) catalyzes the carboxylation of biotin on its carrier protein (BCCP) and then the CO(2) group is transferred by the transcarboxylase to acetyl-CoA to form malonyl- CoA (By similarity) | |
| * | FabD | NispOM1_02313 | 266779.Meso_1769 | 6E-168 | malonyl CoA-acyl carrier protein transacylase |
| * | FabH | NispOM1_02523 | 266835.mlr8424 | 1E-183 | Catalyzes the condensation reaction of fatty acid synthesis by the addition to an acyl acceptor of two carbons from malonyl-ACP. Catalyzes the first condensation reaction which initiates fatty acid synthesis and may therefore play a role in governing the total rate of fatty acid production. Possesses both acetoacetyl-ACP synthase and acetyl transacylase activities. Its substrate specificity determines the biosynthesis of branched- chain and or straight-chain of fatty acids (By similarity) |
| * | FabH | NispOM1_03467 | 856793.MICA_879 | 2.5E-116 | synthase |
| * | FabG | NispOM1_02314 | 311402.Avi_1528 | 4.2E-144 | reductase |
| * | FabA | NispOM1_01266 | 384765.SIAM614_27467 | 7.1E-106 | Catalyzes the dehydration of (3R)-3-hydroxydecanoyl- ACP to E-(2)-decenoyl-ACP and then its isomerization to Z-(3)- decenoyl-ACP. Can catalyze the dehydratase reaction for beta- hydroxyacyl-ACPs with saturated chain lengths up to 16 0, being most active on intermediate chain length (By similarity) |
| TesB | NispOM1_00827 | 266779.Meso_3238 | 6.8E-154 | acyl-CoA thioesterase | |
| TE | NispOM1_00935 | 216596.RL4529 | 4.7E-80 | acyl-CoA thioesterase i | |
* Genes were listed in both Fig. 3A and C.
Comparison of the number of thioesterase Nitratireductor sp. OM-1with other genus Nitratireductor.
| Number | OM-1 | EBB | NL21 | RA22 | RR328 | UMTGB | C115 | CGMCC | PHT3B | ZZ-1 | ES061 |
|---|---|---|---|---|---|---|---|---|---|---|---|
| thioesterase | 12 | 10 | 10 | 12 | 5 | 9 | 9 | 9 | 10 | 9 | 10 |
| Reference strains: | |||||||||||
| EBB | |||||||||||
| NL21 | |||||||||||
| RA22 | |||||||||||
| RR328 | |||||||||||
| UMTGB | |||||||||||
| C115 | |||||||||||
| CGMCC | |||||||||||
| PHT3B | |||||||||||
| ZZ1 | |||||||||||
| ES061 | |||||||||||
Gene expression involved in lipid synthesis under the nitrogen-sufficient and nitrogen-depleted conditions.
| Gene ID | N (+) | N (-) | ratio | ||||
|---|---|---|---|---|---|---|---|
| ΔCt | ΔΔCt | expression ratio | ΔCt | ΔΔCt | expression ratio | N (-)/N (+) | |
| 1264 | 32.70 ± 0.00 | 17.19 ± 0.60 | 6.68797E-06 | 28.83 ± 0.37 | 19.29 ± 0.42 | 1.56544E-06 | 0.23 |
| 1265 | 26.64 ± 0.23 | 11.13 ± 0.83 | 0.000446207 | 24.66 ± 0.17 | 15.12 ± 0.22 | 2.81794E-05 | 0.06 |
| 1266 | 33.98 ± 0.09 | 18.47 ± 0.69 | 2.75408E-06 | 31.12 ± 0.08 | 21.58 ± 0.13 | 3.20094E-07 | 0.12 |
| 2078 | 43.17 ± 1.71 | 27.66 ± 2.31 | 4.73168E-09 | 43.56 ± 0.10 | 34.02 ± 0.15 | 5.76056E-11 | 0.01 |
| 2313 | 30.35 ± 0.08 | 14.84 ± 0.68 | 3.42153E-05 | 30.02 ± 0.22 | 20.48 ± 0.27 | 6.83763E-07 | 0.02 |
| 2314 | 46.77 ± 0.42 | 31.26 ± 1.02 | 3.88868E-10 | 46.92 ± 0.27 | 37.38 ± 0.32 | 5.61053E-12 | 0.01 |
| 2317 | 36.81 ± 0.05 | 21.30 ± 0.65 | 3.87312E-07 | 35.17 ± 0.86 | 25.63 ± 0.91 | 1.92576E-08 | 0.05 |
| 2462 | 41.16 ± 1.18 | 25.65 ± 1.78 | 1.90584E-08 | 42.08 ± 0.15 | 32.54 ± 0.20 | 1.6069E-10 | 0.01 |
| 2523 | 35.94 ± 0.54 | 20.43 ± 1.14 | 7.07876E-07 | 36.82 ± 0.09 | 27.28 ± 0.14 | 6.13623E-09 | 0.01 |
| 2717 | 35.74 ± 0.27 | 20.23 ± 0.87 | 8.13136E-07 | 34.88 ± 0.13 | 25.34 ± 0.18 | 2.36268E-08 | 0.03 |
| 2718 | 33.42 ± 013 | 17.91 ± 0.73 | 4.06025E-06 | 34.22 ± 0.18 | 24.68 ± 0.23 | 3.73323E-08 | 0.01 |
| 16S(control) | 15.51 ± 0.60 | 0 | 1 | 9.54 ± 0.05 | 0 | 1 | 1.00 |
| 2824 | 31.65 ± 0.76 | 15.22 ± 2.28 | 2.62013E-05 | 33.58 ± 0.12 | 19.10 ± 0.61 | 1.77962E-06 | 0.07 |
| 3058 | 29.36 ± 0.16 | 12.94 ± 1.68 | 0.000127696 | 30.46 ± 0.03 | 15.98 ± 0.52 | 1.55255E-05 | 0.12 |
| 3467 | 30.82 ± 0.24 | 14.39 ± 1.77 | 4.67394E-05 | 28.22 ± 0.39 | 13.74 ± 0.88 | 7.3342E-05 | 1.57 |
| 2522 | 35.14 ± 0.66 | 18.71 ± 2.18 | 2.332E-06 | 35.06 ± 0.61 | 20.58 ± 1.10 | 6.37974E-07 | 0.27 |
| 2853 | 29.87 ± 0.23 | 13.44 ± 1.75 | 9.02946E-05 | 32.25 ± 0.03 | 17.77 ± 0.52 | 4.47401E-06 | 0.05 |
| 2947 | 44.03 ± 1.18 | 27.60 ± 2.7 | 4.93262E-09 | 44.63 ± 0.41 | 30.15 ± 0.90 | 8.39355E-10 | 0.17 |
| 687 | 47.54 ± 0.61 | 31.11 ± 2.13 | 4.32974E-10 | 41.97 ± 0.60 | 27.49 ± 1.09 | 5.32342E-09 | 12.30 |
| 827 | 34.74 ± 1.25 | 18.31 ± 2.13 | 3.08778E-06 | 33.50 ± 1.27 | 19.02 ± 1.76 | 1.88109E-06 | 0.61 |
| 935 | 39.11 ± 0.86 | 22.68 ± 2.39 | 1.49329E-07 | 35.13 ± 0.71 | 20.65 ± 1.20 | 6.07758E-07 | 4.07 |
| 1103 | 43.69 ± 0.04 | 27.26 ± 1.56 | 6.22189E-09 | 33.75 ± 0.23 | 19.27 ± 0.72 | 1.5818E-06 | 254.23 |
| 3057 | 36.00 ± 0.66 | 19.57 ± 2.19 | 1.28928E-06 | 37.45 ± 0.52 | 22.97 ± 1.01 | 1.21714E-07 | 0.09 |
| 16S(control) | 16.43 ± 1.52 | 0 | 1 | 14.48 ± 0.49 | 0 | 1 | 1.00 |
| Real-time PCR was performed in duplicate tubes. | |||||||
| expression ratio = 2^-ΔΔCt | |||||||