New microsatellite markers for Xerophyta dasylirioides (Velloziaceae), an endemic species on Malagasy inselbergs.

PREMISE: Microsatellite markers were developed for Xerophyta dasylirioides (Velloziaceae), a species endemic to the Malagasy inselbergs, to explore the impact of its island-like distribution on genetic diversity and gene flow. METHODS AND
RESULTS: A total of 7110 perfect microsatellite loci were recovered by shotgun sequencing on an Illumina MiSeq platform. Primer pairs were designed for 40 arbitrarily selected loci. Fifteen primer pairs that generated distinct PCR products were used to genotype 80 individuals of X. dasylirioides from three inselberg populations. All markers were polymorphic, revealing two to 17 alleles in the overall sampling. Levels of observed and expected heterozygosity per locus ranged from zero to 1.000 and from zero to 0.850, respectively. Success rates of cross-amplification in 10 additional species of Xerophyta (X. croatii, X. decaryi, X. isaloensis, X. labatii, X. lewisiae, X. pinifolia, X. retinervis, X. setosa, X. spekei, X. tulearensis) ranged from zero to 70%.
CONCLUSIONS: Fifteen newly developed microsatellite markers provide a toolkit for assessing population genetic parameters of X. dasylirioides in its unique island-like habitats.

Inselbergs are isolated, often dome‐shaped monolithic rock outcrops (either single or groups) that mainly consist of granite or gneiss (Porembski, 2007). Because inselbergs are ecologically separated from the surrounding matrix, these ecosystems are often referred to as terrestrial or sky islands (Porembski and Barthlott, 2000; Emerson, 2002). Only a few plant species possess traits that enable them to grow successfully in inselberg habitats, which are usually characterized by high temperatures, strong aridity, rocky soils, and extreme nutrient deficiency. The Velloziaceae are desiccation‐tolerant vascular plants that are important floral elements on inselbergs and other rock outcrops in South America, Africa, and Madagascar (Mello‐Silva et al., 2011). Studies of Velloziaceae (e.g., Lousada et al., 2013) and Bromeliaceae (e.g., Barbará et al., 2007) in South America, as well as of Gesneriaceae in Asia (e.g., Hughes et al., 2007), have indicated that rates of genetic exchange between populations located on different inselbergs can be very low even when in close proximity, thus emphasizing the potential role of isolated rock outcrops as drivers of population differentiation and ultimately speciation.

Microsatellites are informative and versatile DNA‐based markers for the evaluation of intraspecific variation, population structure, and speciation (Selkoe and Toonen, 2006). Whereas microsatellite markers have been developed in two South American Vellozia Vand. species (Martins et al., 2012; Duarte‐Barbosa et al., 2014), no such markers are yet available for Velloziaceae from the Old World. The genus Xerophyta Juss. (Velloziaceae) contains approximately 30 desiccation‐tolerant species that are distributed from Madagascar to sub‐Saharan Africa and southwestern Arabia (Behnke et al., 2013). Xerophyta dasylirioides Baker is an endemic species on Madagascar, where it occurs on inselbergs mainly of the Central Highlands. The delimitation of taxa within the Velloziaceae is notoriously difficult, and little is known about genetic differentiation patterns among Xerophyta species and populations from African and Malagasy inselbergs. We developed 15 polymorphic microsatellite markers by next‐generation sequencing on an Illumina MiSeq platform to analyze the genetic diversity and population structure of X. dasylirioides in Madagascar and evaluate the significance of its island‐like distribution in terms of speciation. We also tested the transferability of these markers to eight other Xerophyta species from Madagascar (X. pinifolia Lam. ex Poir., X. decaryi Phillipson & Lowry, X. labatii Phillipson & Lowry, X. setosa Phillipson & Lowry, X. croatii Phillipson & Lowry, X. isaloensis Phillipson & Lowry, X. lewisiae Phillipson & Lowry, X. tulearensis (H. Perrier) Phillipson & Lowry) and two from continental Africa (X. spekei Baker, X. retinervis Baker; see Appendix 1).

METHODS AND RESULTS

Genomic DNA was extracted from lyophilized leaves of one individual plant of X. dasylirioides (JR1432; see Appendix 1) using a modified cetyltrimethylammonium bromide (CTAB) method (Štorchová et al., 2000). A 5‐μg DNA aliquot was used for library preparation. DNA was sheared to generate fragments of on average 600‐bp length, followed by adapter and barcode ligation according to Meyer and Kircher (2010). The library was size‐selected by gel electrophoresis, and fragment size distribution and DNA concentration were evaluated on an Agilent BioAnalyzer High Sensitivity DNA Chip and using the Qubit DNA Assay Kit in a Qubit 2.0 fluorometer (Thermo Fisher Scientific, Darmstadt, Germany). The final library was sequenced on an Illumina MiSeq platform (Illumina, San Diego, California, USA) generating 250‐bp paired‐end reads. After removal of adapters and low‐quality reads, a total of 6,980,938 clean reads were obtained. These were de novo assembled into 321,971 contigs using CLC Genomic Workbench version 3.2.0 (CLC bio, Aarhus, Denmark). Using the MISA module (Thiel et al., 2003) and considering a minimum of 10 repeat units for di‐, eight for tri‐, seven for tetra‐, six for penta‐, and five for hexanucleotide repeats, respectively, a total of 7110 perfect microsatellites were detected. For the initial screening, 40 loci were arbitrarily selected for the design of microsatellite‐flanking primers using BatchPrimer3 (You et al., 2008). The criteria for primer design were (1) product size from 100 to 300 bp; (2) primer size from 18 to 23 bp; (3) annealing temperature from 50°C to 70°C; and (4) GC content of primers between 30% and 70% (Wöhrmann and Weising, 2011).

DNA amplifications were performed in 10‐μL reactions containing 5 ng of template DNA, 1× Mango‐Taq reaction buffer (Bioline, Luckenwalde, Germany), 2.5 mM MgCl2, 0.2 mM dNTPs, 0.05 units of Taq DNA polymerase (Mango‐Taq, Bioline), and 0.5 μM of each primer. Forward primers were fluorescently labeled with FAM, VIC, NED, or PET (Applied Biosystems, Foster City, California, USA; see Table 1). All loci were amplified using a touchdown PCR program with an initial denaturation at 94°C for 6 min; followed by a 12‐cycle touchdown of 94°C for 45 s, 62–50°C for 30 s, and 65°C for 45 s; 18 additional cycles at 94°C for 45 s, 50°C for 30 s, and 65°C for 45 s; and a final elongation at 65°C for 10 min.

Table 1

Characteristics of 15 microsatellite markers developed for Xerophyta dasylirioides from Malagasy inselbergs

Locus	Primer sequence (5′–3′)	Repeat motif	Fluorescent label	Allele size range (bp)	T a (°C)	GenBank accession no.
Xeda_01	F: AGTTCGGCTCGATTACACTA	(CTCGAA)7	FAM	106–124	55	MG407664
	R: GCGAGTCTAAACAACTTTCCT
Xeda_04	F: TCGATTAGCAATATAGCATCC	(ATGTGG)5	NED	38–42	55	MH427346
	R: CCACTAAGCGTAATAATGTTTG
Xeda_12	F: ATTCTCATGCACAAGGAATTA	(TAT)17	PET	105–117	55	MH427347
	R: TGAAGAAAACAAGATTTGAGG
Xeda_13	F: GAAAAAGACAAACACACAAGC	(TAT)15	VIC	74–107	55	MG407665
	R: GTTGCTCAGGGAGGTAATAAT
Xeda_15	F: TAAAGAGATGCTGAGAAGGAG	(GAA)12	NED	123–144	55	MG407665
	R: TTTCGCCTCGATATTATTACA
Xeda_18	F: TCAAATCAAATTAACAGCTGAG	(TCT)11	PET	121–136	55	MG407667
	R: CTCTCTCTCGTTCTCGTTCTT
Xeda_20	F: TCTTTATCACGTCCATGATTC	(CTT)11	FAM	104–116	55	MG407668
	R: TGGATTCAGAATAAACCTGAG
Xeda_23	F: CTTTACGGCTATTCGTGTATG	(TGA)10	NED	128–146	55	MH427348
	R: CGTATAAGAATCAGGCATCTG
Xeda_25	F: AACATCATCCCCCAATTT	(TCC)10	VIC	144–159	55	MG407669
	R: TTTTTCATCTTGGGGTTTAGT
Xeda_26	F: AAGAAGATGAGAAAGGTGAGC	(GAA)10	NED	177–198	55	MG407670
	R: GTTAATCAAGGAAGCCTGTCT
Xeda_28	F: AGGATAAGCATGGTTTACTGA	(CGG)10	PET	152–167	54	MG407671
	R: AAAACAATGGTCTCTCTTCG
Xeda_31	F: TGTGACAGAAAGAGACACAGA	(AG)32	FAM	144–188	55	MG407672
	R: TGTGGAGCCTTTACTTGATAA
Xeda_34	F: TAATGCACTTTCAAAACTTCC	(CT)25	PET	114–156	55	MH427349
	R: AGGTATGACCCCTTTCTATTG
Xeda_39	F: CAAGCCTGCTGACTAGATAAA	(GA)15	FAM	164–212	55	MH427350
	R: CACCTAGGCCTTTAGTACCTC
Xeda_40	F: ATCGTCGATCTATCATTCAAA	(AG)25	VIC	104–142	55	MG407673
	R: ATCTCTCTCTTCCTCTCAACC

T a = annealing temperature.

PCR products were electrophoresed on an ABI Prism 3100 sequencer (Applied Biosystems) along with a fluorescently labeled internal size standard (GeneScan 600 LIZ Size Standard; Applied Biosystems). Allele sizes were determined manually using Peak Scanner Software version 1.0 (Applied Biosystems). Numbers of alleles and levels of observed and expected heterozygosity were calculated with GenAlEx version 6.5 (Peakall and Smouse, 2012). GENEPOP version 4.2 (Raymond and Rousset, 1995) was used to test for deviations from Hardy–Weinberg equilibrium and for linkage disequilibrium among markers, using the default values of Markov chain parameters suggested by the program.

Marker cross‐amplifications were initially tested in five X. dasylirioides individuals (including JR1432 as a positive control). Out of the 40 primer pairs developed, 15 primer pairs that yielded distinct, polymorphic, and easy‐to‐score PCR products were selected for genotyping 30, 30, and 20 individuals of X. dasylirioides from three Malagasy inselberg populations (see Appendix 1 for details and geographical coordinates). Genomic DNA of these plants was extracted from silica gel–dried leaf material according to Štorchová et al. (2000). Locus characteristics, primer sequences, and GenBank accession numbers of the 15 selected microsatellite loci are listed in Table 1, and population genetic parameters are summarized in Table 2. Allele numbers ranged from two to 17 alleles per locus (average = 7.0). Levels of observed and expected heterozygosity ranged from zero to 1.000 and from zero to 0.850, respectively. All but two individuals had different multilocus genotypes, ruling out clonal growth. However, some loci proved to be monomorphic and homozygous in one or two populations (Table 2). Significant deviations (P < 0.05) from Hardy–Weinberg equilibrium were observed in all three populations. There was no evidence of linkage disequilibrium for any locus pair.

Table 2

Genetic variation of 15 microsatellite loci in three natural populations of Xerophyta dasylirioides from Madagascar inselbergsa

Locus	Angavokely (N = 30)			Andronovelona (N = 30)			Quarry II (N = 20)
	A	H o	H e	A	H o	H e	A	H o	H e	A m
Xeda_01	2	0.700b	0.455	1	0.000	0.000	2	0.050	0.049	3
Xeda_04	2	0.500	0.375	2	0.621b	0.428	2	0.950b	0.499	2
Xeda_12	1	0.000	0.000	1	0.000	0.000	1	0.000	0.000	2
Xeda_13	9	0.700	0.783	1	0.000	0.000	1	0.000	0.000	10
Xeda_15	6	0.800	0.737	6	0.567	0.538	2	0.200	0.180	7
Xeda_18	2	0.367	0.455	4	0.138b	0.628	2	0.000b	0.388	5
Xeda_20	1	0.000	0.000	2	0.067b	0.358	3	0.053b	0.467	4
Xeda_23	3	0.333	0.339	4	0.767	0.675	3	0.550	0.626	6
Xeda_25	3	0.467	0.456	5	0.467	0.462	1	0.000	0.000	5
Xeda_26	2	0.214	0.191	3	0.200b	0.331	2	0.000b	0.305	4
Xeda_28	3	0.633	0.615	3	0.267b	0.518	1	0.000	0.000	5
Xeda_31	6	0.739b	0.683	9	0.700b	0.850	6	0.611	0.765	17
Xeda_34	5	0.379b	0.719	9	0.600b	0.841	2	0.150	0.219	14
Xeda_39	4	1.000b	0.559	3	1.000b	0.589	2	1.000b	0.500	7
Xeda_40	6	0.423b	0.541	9	0.429b	0.786	2	0.105b	0.432	14
Mean	4	0.484	0.461	4.133	0.388	0.467	2.133	0.245	0.295	7
Total	55	–	–	62	–	–	32	–	–	105

— = not applicable; A = number of alleles; A m = mean number of alleles across all 80 Xerophyta dasylirioides samples; H e = expected heterozygosity; H o = observed heterozygosity; N = number of individuals sampled.

Voucher and locality information are provided in Appendix 1.

Significant departure from Hardy–Weinberg equilibrium (chi‐square, P < 0.05).

We also tested cross‐species transferability of these 15 markers in one individual each of eight other Malagasy species, one individual of the African species of X. spekei, and five individuals of the African species X. retinervis (Appendix 1, Table 3), using the same PCR protocol as described above. The success rates for cross‐amplifications ranged from zero to 70%, depending on the locus–species combination (Table 3). Cross‐amplification in the Malagasy species was clearly more efficient than in the two African species, in which only two markers could be amplified in X. retinervis (Xeda_12 and Xeda_23). Both microsatellite loci turned out to be monomorphic across the individuals of X. retinervis tested (Table 3). The limited cross‐amplification between African and Malagasy species is in accordance with expectations from the long‐lasting isolation of Madagascar from continental Africa.

Table 3

Cross‐amplification of primers developed in Xerophyta dasylirioides in 10 other species of Xerophyta.a, b

Locus	XePin	XeDec	XeLab	XeSet	XeCro	XeIsa	XeLew	XeTul	XeSpe	XeRet1	XeRet2	XeRet3	XeRet4	XeRet5	Total
Xeda_01	112	–	106/112	112	–	112	112	112	–	–	–	–	–	–	6
Xeda_04	–	–	–	–	–	–	–	–	–	–	–	–	–	–	0
Xeda_12	123	–	–	105	105*	–	–	–	–	126*	–	–	–	–	4
Xeda_13	95	74*	71	62/86	86/98	–	74	–	–	–	–	–	–	–	6
Xeda_15	–	–	120/123	120/126	–	–	–	–	–	–	–	–	–	–	2
Xeda_18	–	130	–	–	127	–	–	–	–	–	–	–	–	–	2
Xeda_20	–	116	–	–	–	110	–	116*	–	–	–	–	–	–	3
Xeda_23	137	–	–	–	–	–	–	–	–	140	140	140	–	–	4
Xeda_25	153	141	–	153	–	153	–	–	–	–	–	–	–	–	4
Xeda_26	183	201	201	183	–	–	189	–	–	–	–	–	–	–	5
Xeda_28	152*	155	–	152	–	–	155	161*	–	–	–	–	–	–	5
Xeda_31	154*	158*	166	176	186	–	168	154	–	–	–	–	–	–	7
Xeda_34	–	138/166	–	–	–	–	–	–	–	–	–	–	–	–	1
Xeda_39	–	–	–	–	–	–	–	–	–	–	–	–	–	–	0
Xeda_40	–	–	–	–	–	–	–	116	–	–	–	–	–	–	1

– = no amplification; * = weak amplification; Malagasy species: XePin = Xerophyta pinifolia; XeDec = X. decaryi; XeLab = X. labatii; XeSet = X. setosa; XeCro = X. croatii; XeIsa = X. isaloensis; XeLew = X. lewisiae; XeTul = X. tulearensis; African species: XeSpe = X. spekei; XeRet = X. retinervis.

Values represent single PCR products with allele size in base pairs.

Voucher and locality information are provided in Appendix 1.

CONCLUSIONS

We developed 15 new nuclear microsatellite markers for the desiccation‐tolerant plant X. dasylirioides, an endemic to Madagascar. The novel markers display high levels of polymorphism among 80 individual plants derived from three inselberg populations and thus provide a promising toolbox for assessing the genetic diversity and population structure of X. dasylirioides. These markers are expected to contribute to our understanding of the significance of inselbergs regarding species diversification on terrestrial islands.

Species	Voucher specimen accession no.a	Collection locality / source	Geographic coordinates	N
X. dasylirioides Baker	JR1432	Botanischer Garten Rostock	NA	1
X. dasylirioides	JR1463–JR1492	Madagascar, Angavokely	18°55′17″S, 47°44′19″E	30
X. dasylirioides	JR1493–JR1522	Madagascar, Andronovelona	18°38′05″S, 47°16′58″E	30
X. dasylirioides	JR1523–JR1542	Madagascar, Quarry II	18°30′44″S, 47°11′04″E	20
X. pinifolia Lam. ex Poir.	P5458	Madagascar/IPMB Heidelberg	NA	1
X. decaryi Phillipson & Lowry	P6669	Madagascar, Toliara/IPMB Heidelberg	NA	1
X. labatii Phillipson & Lowry	P6671	Madagascar, Fianarantsoa/IPMB Heidelberg	NA	1
X. setosa Phillipson & Lowry	P6675	Madagascar, Fianarantsoa/IPMB Heidelberg	NA	1
X. croatii Phillipson & Lowry	P6668	Madagascar, Fianarantsoa/IPMB Heidelberg	NA	1
X. isaloensis Phillipson & Lowry	P6651	Madagascar, Fianarantsoa/IPMB Heidelberg	NA	1
X. lewisiae Phillipson & Lowry	P6652	Madagascar, Fianarantsoa/IPMB Heidelberg	NA	1
X. tulearensis (H. Perrier) Phillipson & Lowry	P6802	Madagascar, Toliara/IPMB Heidelberg	NA	1
X. spekei Baker	P6425	Africa, Tanzania/IPMB Heidelberg	NA	1
X. retinervis Baker	P6276, P6419, P6563,	Africa, Swaziland/IPMB Heidelberg	NA	5
	P6678, P6686

IPMB Heidelberg = Institut für Pharmazie und Molekulare Biotechnologie der Universität Heidelberg; N = number of individuals; NA = data not available.

Voucher deposited at the Department of Botany, University of Rostock (ROST), Rostock, Germany.