Down-regulation of microRNA-429 alleviates myocardial injury of rats with coronary heart disease.

In recent years, the impact of microRNAs (miRNAs) on coronary heart disease (CHD) has been identified. This study was aimed to investigate the regulative role of microRNA (miR-429) in myocardial injury of rats with CHD. Expression of miR-429 in CHD patients and healthy people was detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR). The CHD rat models were injected with normal saline, mimics negative control (NC), miR-429 mimics, inhibitors NC and miR-429 inhibitors twice a week, for 4 weeks. Levels of inflammatory factors, oxidative stress indices as well as apoptosis of cardiomyocytes were determined by a series of assays. Expression of miR-429 was up-regulated in CHD patients. Reduced miR-429 could decline the expression of oxidative stress-related factors and inflammation-related factors, and inhibit the apoptosis of cardiomyocytes in rats with CHD. Moreover, the down-regulation of miR-429 could promote the expression of CrkL and repress activation of the MEK/ERK signaling pathway. This study reveals that restrained miR-429 could exert a protective impact on myocardial injury of rats with CHD by suppressing oxidative stress, inflammation reaction and apoptosis of cardiomyocytes. The function mechanisms may relate to the up-regulation of CrkL and inhibition of the MEK/ERK signaling pathway.

Introduction

Coronary heart disease (CHD) is the primary cause of death in developed countries and is a major cause of morbidity in developing countries. Three quarters of worldwide deaths that resulted from CHD happened in countries with low and middle income [1]. Some slicing algorithms of risk of CHD have been set, which were on the basis of distinct risk factors, and established in epidemiological researches, such as depression [2], diabetes [3], pulse pressure [4] and multiplex sibling history of CHD [5]. A non-coding small RNA is called as microRNA (miRNA), which generally contains about 20 nucleotides and has the ability to modulate some target genes [6]. In recent years, various miRNAs have been identified in human diseases, and some existing researches have reported that miRNAs were implicated in the development of CHD, such as miR-21 [7], miR-210 [8], and miR-224 [9]. Nevertheless, there remains little known about the relation between miR-429 and CHD.

Performed as one of the miRNAs, miR-429 has been proved to be associated with some human diseases, including hepatocellular carcinoma [10], non-small cell lung cancer [11] and prostate cancer [12]. The v-crk sarcoma virus CT10 oncogene homolog (avian)-like (CrkL) is one of the CRK adapter proteins, which consists of two spliced subtypes of CRK and is known as a critical molecule in chronic myeloid leukemia [13]. The relation between miR-429 and CrkL has been uncovered in a recent study that miR-429 could function as a tumor inhibitor in cervical cancer by targeting CrkL [14]. In addition, the extracellular signal-regulated kinase (ERK) signaling cascade is a central mitogen-activated protein pathway that contributes to the modulation of some cellular processes. The impact of mitogen-activated protein kinase/ERK kinase (MEK) has also been reported in a recent study, which was determined as a regulator of gliogenesis in the developing brain [15], and the MEK/ERK signaling pathway inactivation has been demonstrated to be able to repress the progression of human disease, such as transient global cerebral ischemia [16]. Moreover, there was a study revealed that miR-429 could suppress the tumor development by targeting CrkL in hepatocellular carcinoma through the inhibition of the Raf/MEK/ERK signaling pathway [17]. However, the correlation among CHD, miR-429 and its target gene CrkL has not been studied yet. Thus, this study was performed to determine the role of miR-429 in myocardial injury of CHD via regulating CrkL, and we inferred that reduced miR-429 could play a protective role in myocardial injury of CHD through the modulation of CrkL.

Materials and methods

Ethics statement

Written informed consents were obtained from all patients prior to the study. The protocols of this study were approved by the Ethic Committee of The second Affiliated Hospital of Anhui Medical University and based on the ethical principles for medical research involving human subjects of the Helsinki Declaration. Animal experiments were strictly in accordance with the Guide to the Management and Use of Laboratory Animals issued by the National Institutes of Health. The protocol of animal experiments was approved by the Institutional Animal Care and Use Committee of The second Affiliated Hospital of Anhui Medical University.

Study subjects

A total number of 50 CHD patients (aging 40–75 years old with a mean age of 60.12 ± 3.28 years) who received resection in the department of emergency of The second Affiliated Hospital of Anhui Medical University from January 2015 to January 2018 were collected, 34 males and 16 females. All the patients were diagnosed with CHD by coronary angiography. Fifty healthy people (aging 40–75 years old with a mean age of 60.21 ± 4.33 years) were collected as a control group, 27 males and 23 females. The patients were excluded from this study if they had valvular heart disease, acute or chronic infective disease, hematological diseases, tumor, peripheral vascular disease, liver and kidney dysfunction, systemic immunologic disease, chronic obstructive pulmonary disease, non-ischemic myocardial disease and diseases resulted from other factors, such as thoracalgia, severe dysfunction of vital organs, acute pericarditis, acute myocarditis, congenital heart disease, immune system disease, connective tissue disease, pulmonary embolus and cerebrovascular disease. There was no statistical difference in the gender and age of patients in the two groups (P > 0.05).

Collection of general information and detection of serum parameters

General information of patients with CHD such as gender, age, and history of smoking, hypertension, and diabetes was collected. Fasting body weight (kg), body height (m), and body mass index (BMI) of the patients were examined. BMI = body weight/body height2 (kg/cm2). Then, the systolic blood pressure (SBP) and diastolic blood pressure (DBP) of the patients were evaluated. Meanwhile, fasting blood (15 mL) was obtained, of which 5 mL for detection of blood sugar and lipid, 5 mL for detection of C-reactive protein (CRP), creatine kinase MB (CK-MB) and troponin I (cTnI), and 5 mL for reverse transcription quantitative polymerase chain reaction (RT-qPCR) experiment. Fasting blood (5 mL) of all the experimental subjects was placed in anticoagulation test tubes by the clinical lab of The second Affiliated Hospital of Anhui Medical University, then the levels of blood sugar and lipid were determined, including serum total cholesterol (TC), triacylglycerol (TG), low-density lipoprotein cholesterin (LDL-C), high-density lipoprotein cholesterin (HDL-C) and fasting blood glucose (FPG). Fasting blood (5 mL) was additionally collected and centrifuged, the supernatant was preserved in a − 80°C refrigerator and then batched for inspection. The cTnI in serum was determined using double-sandwich enzyme-linked immunosorbent assay (BIOMERIENX Co., Ltd., France), CK-MB in serum was detected by continuous-flow ultraviolet spectrophotometry (Ransom Holding Co. USA), and CRP was evaluated by fluorescence immunoassay (the chemiluminescence apparatus and matched kit were from Shanghai Flash Spectrum Biotechnology Co., Ltd., Shanghai., China), the detections were under the guide of instructions.

Detection of coronary arteriography and genisini score

Coronary arteriography detections on all the patients were conducted by the emergency physicians in the department of emergency in The second Affiliated Hospital of Anhui Medical University. All the segments of the coronary artery could be developed through the femoral or radial artery, the degrees of coronary stenosis were measured by Gensini score. 1. Scores according to the most severe degree of coronary stenosis: 0 score, no stenosis; 1 score, ≤25%; 2 score, 26%-50%; 4 score, 51%-75%; 8 score, 76%-90%; 16 score, 91%-99%; 32 score, 100%. 2. Related coefficient according to different stenosis sites: left main coronary artery, × 5; anterior descending and circumflex proximal branches: × 2.5; anterior descending middle branch, × 1.5; anterior descending and circumflex distal branches, right coronary artery, the first and second diagonal branches and left ventricle postramus, × 1.0; the others: × 0.5. 3. Gensini score = the total of degree of coronary artery stenosis × relative coefficient of every coronary artery.

Animal grouping and establishment of CHD rat models

A total of 140 clean Sprague Dawley (SD) rats (aged 7 d, weighing 230–250 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and raised in quiet standard animal rooms with free access to food and water, the room temperature was 20.5 ± 1.2°C and humidity was 50.3 ± 3%. The steps of model establishment in each group were: the rats were fed with high-fat fodder during the first 8 w, then were continuously intraperitoneally injected with 30 U/kg pituitrin for 3 d. Rats in the control group were fed with normal fodder during the first 8 w, then were intraperitoneally injected with equal distilled water. After the establishment, three rats in the control group as well as the model group were randomly selected to be conducted with detection of heart and coronary artery tissues, the successful model establishment was decided by the pathology of coronary artery and heart. The 100 successfully established SD rat models were grouped into five groups: the CHD group (intravenously injected with normal saline), the mimics negative control (NC) group (intravenously injected with miR-429 mimics NC), the miR-429 mimics group (intravenously injected with miR-429 mimics), the inhibitors NC group (intravenously injected with miR-429 inhibitors NC), the miR-429 inhibitors group (intravenously injected with miR-429 inhibitors), 20 rats in each group, and 20 rats were set as the control group (intravenously injected with normal saline). The treatment of rats in each group was twice a week for 4 w. The specific recipes were: 5 nmol mimics NC, miR-429 mimics, inhibitors NC and miR-429 inhibitors were mixed up with 250 μL normal saline, then were intravenously injected in the rats by insulin needles.

Evaluation criterion of successful models

The successful rat models were with decreased weight, activity, and diet, slow response, dim fur and cyanosis of claws and lips. The changes of myocardial pathology were: swelling and disorder of cardiac myocytes, interstitial fibrosis of myocardium, partial areas were with evident focal necrosis and nuclear atrophy.

Detection of cardiac echocardiography in small animals

After the rats were treated with injection for 4 w, small animal ultrasonic imaging system (VisualSonics Inc., Toronto, Canada) was applied to measure the left ventricular end systolic diameter and left ventricular end diastolic diameter, then the score of left ventricular ejection fraction (LVEF) and the left ventricular fractional shortening (LVFS) were calculated. The mean of more than three consecutive cardiac cycles was adopted.

Detection of related indicators

After the rats were treated with injection for 4 w, blood of right common carotid artery of random rats in each group was centrifuged (3600 r/min, 10 min), the supernatant was preserved at −20°C, the blood biochemical indexes (TC, TG, LDL-C, and HDL-C) were evaluated by a fully automatic biochemical analyzer (Bio-Rad Laboratories, Hercules, CA, USA). The expression of serum interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, CK-MB and cTnI was determined by enzyme-linked immunosorbent assay (ELISA) kits. Kits of IL-1β, IL-6, and TNF-α were purchased from Well Biological Science Co., Ltd. (Changsha, China), the kit of CK-MB was obtained from Cusabio Biotech Co., Ltd (Wuhan, China), kit of cTnI was acquired from Shenzhen Bio-Wonderful Technology Co., Ltd. (Shenzhen, China). The contents of superoxide dismutase (SOD) and malondialdehyde (MDA) were determined by chemical colorimetry on the basis of the instructions of SOD and MDA activity detection kits (NanJing JianCheng Bioengineering Institute, Nanjing, China). Colorimetry was conducted at 550 nm (SOD) and 532 nm (MDA) on a 722 grating spectrophotometer, the optical density (OD) was evaluated, and activity of SOD as well as the content of MDA was calculated.

Observation of rats’ cardiac mass index

Ten random rats in each group were conducted with blood collection from the right common carotid artery, then their hearts were separated, washed by normal saline and dried by filter paper. The heart mass (HM) and left ventricular mass (LVM) were, respectively, weighed by an electronic scales, the heart mass index (HMI) and left ventricular mass index (LVMI) were, respectively, calculated. HMI = HM/BM, LVMI = LVM/BM.

Collection of heart tissues and hematoxylin-eosin (HE) staining

Ten rats in each group were randomly euthanized and executed thoracotomy, the complete hearts were cut from the roots of the ascending aorta, then were washed by cold normal saline for 15 s, the atrial and pericardial tissues were removed. The myocardial tissues were harvested, one part of the myocardial tissues was conducted with HE staining, electron observation and terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) after fixation. The rest myocardial tissues were preserved at −80°C for RT-qPCR experiment and Western blot analysis.

The paraffin specimen of ventricle and myocardium were continuously sectioned along the ventricular long axis at a thickness of 4 μm, and the sections were attached on the positive charge adhesion glass slides and toasted at 60°C for 4 h. The glass slides were soaked in xylene for 10 min and dewaxed twice, then, respectively, rinsed once by graded ethanol at 100%, 95%, 90% and 70%, each time for 5 min. The sections were washed by sterile water for 2 min and stained by hematoxylin solution for 5 min with redundant dye liquor washed away, followed by color separation by hydrochloric acid ethanol for 30 s. The sections were soaked in sterile water for 15 min and stained by eosin for 2 min, then dehydrated by ethanol, respectively, at 70%, 90%, 95% and 100%, each for 2 min, soaked in xylene for 2 min × 2 times, sealed by neutral resins, observed and recorded by a microscope (Nikon Co., Ltd., Tokyo, Japan).

Observation of transmission electron microscope (TEM)

The myocardial tissues of rats in each group were cut into 1 mm3 pieces, then fixed by 2% glutaraldehyde for 3 h, washed by phosphate buffered solution (PBS) for 3 times, and fixed by 1% osmium acid for 2 h, dehydrated by graded ethanol and embedded by epoxy resin 618. Then, the pieces of myocardial tissues were sectioned by EM UC7 ultramicrotome (Leica Co., Ltd., Germany), double stained by uranium lead, observed and photographed by an H-7650 transmission electron microscope (Hitachi Co., Ltd., Tokyo, Japan).

Terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) staining

The paraffin specimens of ventricle and myocardium in each group were toasted at 60°C for 4 h, then stained according to the directions of TUNEL kit (Roche, Basel, Switzerland). The paraffin sections were conventionally dewaxed to water and successively soaked in 100%, 95%, 85% and 70% ethanol, each for 5 min, rinsed by PBS for 2 times, then added with protease K working fluid (2 μL 50 × protease K + 98 μL PBS) reacted at 37°C for 15–30 min, soaked in confining liquid (3% H2O2 insoluble in methanol), blocked for 10 min and each specimen was added with 50 μL Streptavidin-horseradish peroxidase (HRP) working solution and reacted in the dark for 30 min, rinsed by PBS for 3 times and added with 50–100 μL diaminobenzidine (DAB) working solution, reacted for 10 min, washed by PBS for 3 times, then observed and photographed under a light microscope, it was positive that the nuclei were stained to brown. Five fields were randomly selected in each section, and the number of positive cells was recorded, the apoptosis index (AI) = the number of apoptotic nuclei/total nuclei × 100%.

RT-qPCR

The total RNA of plasma of patients with CHD and healthy people as well as myocardial tissues of rats in each group were extracted by Trizol (Invitrogen, Carlsbad, CA, USA). The OD value and concentration of RNA were detected by ultraviolet spectrophotometry, RNAA260nm/A280nm at a range of 1.8–2.0 indicated a good purity. Then, the RNA was reversely transcripted to cDNA using miRcute miRNA First-Strand cDNA Synthesis Kit (Tiangen Biotech Co., Ltd., Beijing, China), RT-qPCR reaction was conducted on an ABI7500 fluorescence quantitative PCR instrument by SYBR premix Ex TaqTM Ⅱ PCR Kit (TaKaRa Biotech Co., Ltd., Dalian, China). The reaction was conducted by Prism® 7500 (Applied Biosystems, Inc., MA, USA). The PCR primers were designed and synthetized by Invitrogen, Carlsbad (CA, USA) (Table 1). U6 was selected as the internal reference of miR-429, and glyceraldehyde phosphate dehydrogenase (GAPDH) was selected as the internal reference of Bax, Bcl-2, caspase-3, IL-1β, IL-6, TNF-α, and CrkL. The data were analyzed by 2−ΔΔCt method [18].

Table 1.

Primer sequence.

Gene	Primer sequence (5ʹ→3ʹ)
miR-429	F: GGGGGTAATACTGTCTGGT
	R: TGCGTGTCGTGGAGTC
Bax	F: AAGCTGAGCGAGTGTCTCCGGCG
	R: GCCACAAAGATGGTCACTGTCTGCC
Bcl-2	F: CTCGTCGCTACCGTCGTGACTTCG
	R: CAGATGCCCGTTCAGGTACTCAGTC
caspase-3	F: AGAGCTGGACTGCGGTATTGAC
	R: GAACCATGACCCGTCCCTTG
IL-1β	F: ACGGGTTCCATGGTGAAGT
	R: CCTCTCAAGCAGAGCACAGA
IL-6	F: GATTGTATGAACAGCGATGAT
	R: AGAAACGGAACTCCAGAAGACC
TNF-α	F: GAAAGCATGATCCGAGATGT
	R: CAGGAATGAGAAGAGGCTGA
CrkL	F: ATCCCAGAACCTGCTCACG
	R: CAATGTCACCAACCTCCAAT
GAPDH	F: GAGTCAACGGATTTGGTCGT
	R: GACAAGATTCCCGTTCTCAG
U6	F: GCTTCGGCAGCACATATACTAAAAT
	R: CGCTTCACGAATTTGCGTGTCAT

Note: F, forward; R, reverse; miR-429, microRNA-429; IL-1β, interleukin (IL)-1β; TNF-α, tumor necrosis factor-α; GAPDH, glyceraldehyde phosphate dehydrogenase.

Western blot analysis

The protein expression of Bax, Bcl-2, caspase-3, CrkL, MEK, and ERK in myocardial tissues was evaluated using Western blot analysis. The total protein of myocardial tissues of rats in each group was extracted, and the protein concentration was determined by bicinchoninic acid (BCA) kit (Beyotime Biotechnology Co., Shanghai, China), then the proteins were transferred onto the membrane and sealed by skim milk powder. The proteins were added with primary antibodies Bax (1: 1000), Bcl-2 (1: 1000), caspase-3 (1: 500), CrkL (1: 50,000), MEK (1: 1000) and ERK (1: 10,000) (all from Abcam, Cambridge, MA, USA) and incubated overnight for more than 16 h, and the relative secondary antibodies were incubated. The proteins were then conducted with film development exposure, GAPDH (diluted at 1: 1000, Millipore Co., Ltd., MA, USA) was taken as the internal reference. The gray value was analyzed by Image J (National Institutes of Health, Maryland, USA) and the gray values of target bands and internal reference bands were selected for statistical analysis.

Luciferase activity assay

The binding sites of CrkL and relative miR-429 were confirmed by online prediction software http://www.targetscan.org, the primers were designed and synthetized by 3ʹ-untranslated region (3ʹUTR) sequence of CrkL, the restriction enzyme cutting sites of restriction enzyme Hind III and Spe I were introduced in the forward and reverse primers, and the mutation sequences of the binding sites were designed, the target sequence fragments were synthetized by Genscript Biomart Co., Ltd. (Nanjing, China). The obtained target products and pMIR-REPORT™ Luciferase carrier vectors were digested by restrictive endoenzyme Hind III and Spe I, and the products of trypsinization were recycled, connected by T4 DNA ligase and transformed with competent cells of Escherichia coli DH5α, then the plasmids were extracted, the right recombinant plasmids were appraised by enzyme digestion and sequence analysis. The 293T cells were seeded in 24-well plates at 1 × 105 cells/well. After the cells were cotransfected with recombinant plasmids and miR-429 mimics according to the groups for 48 h, the medium was discarded, each well was added with 100 μL cell lysis buffer of luciferase kit, after 30 min, cell lysis buffer (20 μL) was added with 100 μL LARⅡ, the fluorescence value (A) was measured, then added with 100 μL Stop&Glo reagent, the fluorescence value (B) was measured; A was taken as the internal reference, the luciferase activity C = B/A.

Statistical analysis

All data analyses were conducted using SPSS 21.0 software (IBM Corp. Armonk, NY, USA). The measurement data conforming to the normal distribution were expressed as mean ± standard deviation. The unpaired t-test was performed for comparisons between two groups and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups, and the Fisher’ s exact test was used for pairwise comparisons. The receiver operating characteristic (ROC) curve was used to evaluate the clinical efficiency in the diagnosis of CHD. Pearson correlation analysis was used to assess the relation between miR-429 and clinical indexes of patients with CHD. p value <0.05 was indicative of statistically significant difference.

Results

Comparison of general data between CHD patients and healthy controls

We compared the general data of the subjects, there was no statistically significant difference between the two groups in age, gender, BMI, smoking, alcohol consumption, diabetes, hypertension, TG, TC, LDL-C and FPG (all P > 0.05), while relative to the healthy people, patients with CHD have higher levels of CRP, CK-MB, cTnI and HDL-C (Table 2, all P < 0.05).

Table 2.

Comparison of general data between CHD patients and healthy controls.

Variables	Healthy controls (N = 50)	CHD patients (N = 50)	P value
Age (years old)	60.21 ± 4.33	60.12 ± 3.28	0.054
Male/female (cases)	27/23	34/16	0.218
BMI (kg/m2）	21.47 ± 2.38	22.19 ± 3.01	0.188
Smoking (yes/no)	28/22	32/18	0.541
Alcohol consumption (yes/no)	23/27	26/24	0.689
Diabetes (yes/no)	17/33	24/26	0.222
Hypertension (yes/no)	20/30	29/21	0.109
CRP (mg/L)	0.89 ± 0.20	4.58 ± 0.23	< 0.001
CK-MB (ng/mL)	2.59 ± 0.12	5.85 ± 0.52	< 0.001
cTnI (ng/mL)	0.10 ± 0.04	0.35 ± 0.04	< 0.001
TG (mmol/L)	1.68 ± 0.55	1.61 ± 0.40	0.992
TC (mmol/L)	4.31 ± 0.61	4.22 ± 0.54	0.437
LDL-C (mmol/L)	2.25 ± 0.58	2.51 ± 0.75	0.055
HDL-C (mmol/L)	1.22 ± 0.21	1.07 ± 0.12	< 0.001
FPG (mmol/L)	4.96 ± 0.68	4.89 ± 0.88	0.657

Note: BMI, body mass index; CRP, C-reactive protein; CK-MB, creatine kinase MB; cTnI, troponin I; TG, triacylglycerol; TC, cholesterol; LDL-C, low-density lipoprotein cholesterin; HDL-C, high-density lipoprotein cholesterin; FPG, fasting blood glucose. The measurement data were analyzed by Fisher’s exact test, and the independent sample t-test was performed for comparisons between two groups.

Mir-429 is highly expressed in patients with CHD

The expression of miR-429 in the two groups was detected using RT-qPCR, the results of which indicated that (Figure 1(a)): in comparison to the healthy people, miR-429 performed a high expression in the plasma of patients with CHD (P < 0.05). Then, the diagnostic efficiency of miR-429 to CHD patients was measured by ROC curve, the outcomes (Figure 1(b)) implied that the area under the curve (AUC) was 0.806, sensitivity was 0.860 and specificity was 0.700, showing that the expression of miR-429 in peripheral blood exerted a good predictive efficiency in the occurrence of CHD.

Figure 1.

MiR-429 is highly expressed in patients with CHD. a, expression of miR-429 in healthy people (N = 50) and CHD patients (N = 50) was detected by RT-qPCR; b, the diagnostic efficiency of miR-429 to CHD was analyzed by ROC curve; the measurement data were analyzed by t-test.

Correlation between mir-429 and clinical variables of CHD patients

In order to analyze the relation between miR-429 expression and clinical variables of CHD patients, Pearson correlation analysis was used to assess the correlation among miR-429 expression, Gensini score (r = 0.680, P < 0.001), CK-MB (r = 0.702, P < 0.001) and cTnI (r = 0.671, P < 0.001), the results suggested that (Figure 2) miR-429 expression was in positive relation with Gensini score, CK-MB and cTnI (all P < 0.05).

Figure 2.

Correlation between miR-429 and clinical variables of CHD patients a, the correlation between miR-429 expression and Gensini score of CHD patients (N = 50) was assessed by Pearson correlation analysis; b, the relation between miR-429 expression and CK-MB of CHD patients (N = 50) was measured by Pearson correlation analysis; c, the relation between miR-429 expression and cTnI of CHD patients (N = 50) was detected by Pearson correlation analysis.

Down-regulated miR-429 improved cardiac function of rats with CHD

LVEF as well as LVFS were calculated by a small animal ultrasonic imaging system, and we found that (Figure 3(a)) contrasted to the normal group, the LVEF and LVFS in the CHD group were considerably reduced (P < 0.05). No obvious difference could be observed in the tendency of LVEF and LVFS between the CHD group and the mimics NC group (P > 0.05). In contrast to the mimics NC group, the LVEF and LVFS were further declined in the miR-429 mimics group (P < 0.05). Compared to the inhibitors NC group, the LVEF and LVFS were remarkably heightened in the miR-429 inhibitors group (P < 0.05).

Figure 3.

Down-regulated miR-429 improved cardiac function of rats with CHD. a, ultrasonic cardiogram detection of LVEF and LVFS of rats in each group (N = 20); b, HMI and LVMI of rats in each group (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Ventricular mass indexes were applied to testify the impacts of HMI and LVMI in rats with CHD, and we found that (Figure 3(b)) the HMI and LVMI of rats in the CHD group were noticeably elevated relative to that in the normal group (P < 0.01). There was no apparent difference in HMI and LVMI among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). In contrast to the mimics NC group, HMI and LVMI in the miR-429 group were further increased in the miR-429 mimics group (P < 0.05). HMI and LVMI were reduced in the miR-429 inhibitors group, which was compared with the inhibitors NC group (P < 0.05).

Down-regulated miR-429 attenuates blood lipids and myocardial injury in rats with CHD

Related indexes of rats in each group were determined using fully automatic biochemical analyzer and ELISA, the outcomes unraveled that (Figure 4) contrasted to the normal group, the expression of TC, TG, LDL-C, CK-MB, and cTnI was heightened, while HDL-C was declined in the CHD group (all P < 0.05). There was no evident difference in TC, TG, LDL-C, HDL-C, CK-MB and cTnI among the CHD group, the mimics NC group and the inhibitors NC group (all P > 0.05). Contrasted to the mimics NC group, the expression of TC, TG, LDL-C, HDL-C, CK-MB, and cTnI was further elevated, while the expression of HDL-C was further lowered in the miR-429 mimics group (all P < 0.05). In comparison to the inhibitors NC group, expression of TC, TG, LDL-C, HDL-C, CK-MB, and cTnI was reduced, while the expression of HDL-C was increased in the miR-429 inhibitors group (all P < 0.05).

Figure 4.

Down-regulated miR-429 attenuates blood lipids and myocardial injury in rats with CHD. a, expression of TC, TG, LDL-C and HDL-C of rats in each group (N = 10); b, expression of CK-MB of rats in each group (N = 10); c, expression of cTnI of rats in each group (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Down-regulated miR-429 alleviates inflammation of rats with CHD

Expression of IL-1β, IL-6 and TNF-α was detected using ELISA and RT-qPCR, and we found that (Figure 5) the expression of IL-1β, IL-6 and TNF-α was elevated in the CHD group, which was compared with the normal group (all P < 0.05). No notable difference could be observed in the expression of IL-1β, IL-6 and TNF-α in the CHD group, the mimics NC group and the inhibitors NC group (all P > 0.05). Relative to the mimics NC group, the expression of IL-1β, IL-6 and TNF-α was further heightened in the miR-429 mimics group (all P < 0.05). In comparison to the inhibitors NC group, the expression of IL-1β, IL-6 and TNF-α was declined in the miR-429 inhibitors group (all P < 0.05).

Figure 5.

Down-regulated miR-429 alleviates inflammation of rats with CHD. a, mRNA expression of IL-1β, IL-6 and TNF-α of rats in each group (N = 10); b, protein expression of IL-1β, IL-6 and TNF-α of rats in each group (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Down-regulated miR-429 attenuates oxidative stress of rats with CHD

The contents of SOD and MDA of rats in each group were examined by colorimetric method, the outcomes revealed that (Figure 6) in contrast to the normal group, the activity of SOD was lowered and the content of MDA was elevated in the CHD group (P < 0.05). There was no observable difference in the expression of SOD and MDA among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). Relative to the mimics NC group, the activity of SOD was lowered and the content of MDA was elevated in the miR-429 mimics group (P < 0.05). The activity of SOD was heightened and the content of MDA was reduced in the miR-429 inhibitors group, which was compared with the inhibitors NC group (P < 0.05).

Figure 6.

Down-regulated miR-429 attenuates oxidative stress of rats with CHD. a, expression of SOD of rats in each group (N = 10); b, expression of MDA of rats in each group (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Down-regulated miR-429 mitigates the development of CHD in rats

The pathological changes of myocardial tissues of rats in each group were evaluated by HE staining, and we found that (Figure 7(a)) the cardiomyocytes in the normal group had clear boundaries and outline with a normal arrangement and there was no rupture and swelling, and no necrocytosis and atrophy. While there were swelling and disordered arrangement of cardiomyocytes, myocardial interstitial fibrosis, nuclear atrophy and scattered myocardial infarctions in the CHD group. The pathological changes of the mimics NC group and the inhibitors NC group were in line with the CHD group. There were multitudinous cardiomyocytes with swelling, disorder and unclear outlines, together with myocardial interstitial fibrosis, nuclear atrophy and more myocardial infarctions in the miR-429 mimics group. While there were alleviated welling, ordered arrangement and clear outlines of cardiomyocytes, and attenuated myocardial interstitial fibrosis, less nuclear atrophy as well as myocardial infarctions in the miR-429 inhibitors group.

Figure 7.

Down-regulated miR-429 mitigates the development of CHD in rats. a, HE staining of rats’ myocardial tissues in each group (× 100, N = 10); b, results of electron microscopy observation of rats’ myocardial tissues in each group (× 5000, N = 10).

The changes of ultrastructure of myocardial tissues in CHD rats were observed by an electron microscope, the outcomes revealed that (Figure 7(b)) there were ordered myocardial fibers and clear light and shade of myocardial tissues; regularly shaped mitochondrion, complete cell membranes, dense and regular ridges, integral nuclear membranes and evenly distributed chromatin in the myocardium of rats in the normal group. The myocardial fibers of myocardial tissues were disorderly arranged in the CHD group, together with partial myofilament rupture and absence, sarcomere contracture, rupture and condensation of mitochondrion, degradation of edges and dilatation of sarcoplasmic reticulum of the cardiomyocytes. The changes of ultrastructure in the mimics NC group and the inhibitors NC group were in accordance with the CHD group. Relative to the mimics NC group, there were further disordered arrangement of myocardial fibers of myocardial tissues, condensation, and swelling of mitochondrion, rupture of most cell membranes, degradation of edges, much karyopyknosis and aggravated chromatin margination of the cardiomyocytes of rats in the miR-429 mimics group. Contrasted to the inhibitors NC group, there were orderly arranged myocardial fibers of myocardial tissues, regular cardiomyocytes morphology, order arrangement of sarcoplasmic reticulum, well-formed sarcomere, mild swelling of partial mitochondrion, fuzzy structures of edges and mild dilatation of sarcoplasmic reticulum in the miR-429 inhibitors group.

Down-regulated miR-429 suppresses apoptosis of myocardial tissues

According to the outcomes of TUNEL staining (Figure 8(a)), the number of apoptotic cardiomyocytes in the CHD group was apparently increased in contrast to the normal group (P < 0.05). No visible difference in the number of apoptotic cardiomyocytes could be observed among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). Relative to the mimics NC group, the number of apoptotic cardiomyocytes in the miR-429 mimics group was further increased (P < 0.05). The number of apoptotic cardiomyocytes in the miR-429 inhibitors group was reduced, which was compared with that of the inhibitors NC group (P < 0.05).

Figure 8.

Down-regulated miR-429 suppresses apoptosis of cells in myocardial tissues. a, positive expression of apoptotic cells and the number of positive cells of rats’ myocardial tissues in each group, which were detected by TUNEL staining (N = 10); b, Protein bands of Bax, Bcl-2 and caspase-3 of rats’ myocardial tissues in each group; c, protein expression of Bax, Bcl-2 and caspase-3, which was detected by Western blot analysis (N = 10); d, expression of Bax, Bcl-2 and caspase-3 of rats’ myocardial tissues in each group, which was detected by RT-qPCR (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Expression of Bax, Bcl-2 and caspase-3 was determined by RT-qPCR and Western blot analysis, we found that (Figure 8(b–d)) in contrast to the normal group, the expression of Bax and caspase-3 was evidently elevated and expression of Bcl-2 was declined in the CHD group (all P < 0.05). There was no significant difference in the expression of Bax, Bcl-2 and caspase-3 among the CHD group, the mimics NC group and the inhibitors NC group (all P > 0.05). Contrasted to the mimics NC group, the expression of Bax and caspase-3 was ulteriorly elevated and expression of Bcl-2 was reduced in the miR-429 mimics group (all P < 0.05). In comparison to the inhibitors NC group, the expression of Bax and caspase-3 was significantly lowered and expression of Bcl-2 was heightened in the miR-429 inhibitors group (all P < 0.05).

Down-regulated miR-429 promotes cell expression and represses activation of the MEK/ERK signaling pathway

Expression of miR-429 of rats’ myocardial tissues in each group was evaluated using RT-qPCR, the results indicated that (Figure 9(a)) miR-429 expression in the CHD group was apparently elevated in comparison to that in the normal group (P < 0.05), and there was no evident difference in miR-429 expression among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). Relative to the mimics NC group, the expression of miR-429 was further heightened in the miR-429 mimics group (P < 0.05). MiR-429 expression in the miR-429 inhibitors group was considerably reduced, which was contrasted to the inhibitors NC group (P < 0.05).

Figure 9.

Down-regulated miR-429 promotes CrkL expression and represses activation of the MEK/ERK signaling pathway (N = 10). a, expression of miR-429 and CrkL of rats in each group by RT-qPCR; b, protein bands of CrkL, MEK and ERK of rats’ myocardial tissues in each group; c, protein expression of CrkL, MEK and ERK, which was detected by Western blot analysis (N = 10), * P < 0.05 vs the normal group; # P < 0.05 vs the mimics NC group; & P < 0.05 vs the miR-429 inhibitors group. The data were all measurement data, and expressed as mean ± standard deviation. One-way ANOVA was used for comparisons among multiple groups, LSD-t method was used for pairwise comparisons after one-way ANOVA.

Expression of CrkL of rats’ myocardial tissues in each group was measured by RT-qPCR and Western blot analysis, we found that (Figure 9(a–c)) the expression of CrkL in the CHD group was decreased relative to the normal group (P < 0.05). There was no observable difference in the expression of CrkL among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). In comparison to the mimics NC group, the expression of CrkL was ulteriorly declined in the miR-429 mimics group (P < 0.05). In contrast to the inhibitors NC group, the expression of CrkL was elevated in the miR-429 inhibitors group (P < 0.05).

Expression of MEK and ERK was detected using Western blot analysis, the outcomes of which implied that (Figure 9(b–c)) contrasted to the normal group, expression of MEK and ERK in the CHD group was apparently elevated (P < 0.05), and there was no evident difference in expression of MEK and ERK among the CHD group, the mimics NC group and the inhibitors NC group (P > 0.05). Relative to the mimics NC group, the expression of MEK and ERK was further heightened in the miR-429 mimics group (P < 0.05). Expression of MEK and ERK in the miR-429 inhibitors group was considerably reduced, which in contrast to the inhibitors NC group (P < 0.05).

Crkl is a target gene of miR-429

The binding sites of CrkL and relative miR-429 as well as their sequences in 3ʹ-UTR were confirmed by an online prediction software Target Scan (Figure 10(a)). To testify that it was the binding sites predicted by miR-429 that resulted in the changes of luciferase activity, we, respectively, designed mutation sequence which was without miR-429 binding sites and the wild sequence to insert in the reporter plasmid. The 293T cells were co-transfected with miR-429 mimics and wild recombinant plasmid (Wt-miR-429/CrkL) or mutation recombinant plasmid (Mut-miR-429/CrkL) by dual luciferase reporter gene assay, according to the results, there was no evident impacts of miR-429 mimics on the luciferase activity of the Mut-miR-429/CrkL plasmids, while miR-429 mimics resulted in a broad reduction of luciferase activity in the Wt-miR-429/CrkL plasmids (P < 0.05) (Figure 10(b)).

Figure 10.

CrkL is a target gene of miR-429. a, the binding sites of CrkL and relative miR-429 were predicted by Target Scan; b, the results of dual luciferase reporter gene assay, this experiment was repeated for three times. * P < 0.05 vs the Wt + NC group.

Discussion

CHD remains one of the leading causes of death in the world [19]. In recent years, it has been testified that miRNAs, which were characterized as small non-coding RNAs, played the role of leading molecules in the RNA silencing [20]. Additionally, there were several recent researches have confirmed the role of miR-429 in some human diseases, such as gastric cancer [21] and hepatocellular carcinoma [22]. Nevertheless, there is little known about miR-429 and CrkL in CHD. Thus, this research was focused on the effects of miR-429 and its target gene CrkL on CHD, and we have found from the results that the down-regulation of miR-429 could play a protective role in myocardial injury of CHD by suppressing oxidative stress, inflammation reaction and apoptosis of cardiomyocytes in rats with CHD by targeting CrkL.

One of the findings in this study illustrated that miR-429 was highly expressed in the serum of CHD patients. In accordance with this result, a previous study has confirmed that miR-429 performed a high expression in human prostate cancer [12]. Another research has also revealed that miR-429 was up-regulated in hepatocellular carcinoma tissues [10]. One more vital result of this study was that the down-regulation of miR-429 could apparently improve cardiac function and attenuate myocardial injury. There was little known about the relation between miR-429 and cardiac and cerebral vascular diseases, but we can still find the impacts of miR-429 on biological functions or pathological injury in other human diseases. For example, an extant literature has unearthed that the overexpressed miR-429 could alleviate intestinal barrier function in diabetes via restraining the expression of occludin [23]. What is more, Xiao et al. have unraveled in their study that inhibited miR-429 could attenuate oxygen-glucose deprivation/reoxygenation-induced neuronal injury through GATA-binding protein 4 [24]. We have also found in this study that restrained miR-429 could relieve the inflammation in CHD by repressing the expression of inflammation-related factors IL-1β, IL-6, and TNF-α. It is in line with this finding that the down-regulation of miR-429 was found to be able to reduce the lipopolysaccharide-induced pulmonary inflammatory response [25].

More than the above findings, our research has demonstrated that reduced miR-429 could alleviate the oxidative stress by modulating oxidative stress factors, such as up-regulating the expression of SOD and repressing the expression of MDA. Similar to this finding, a recent research has discovered that miR-141 and miR-200a, which were also the members of miR-200 family, functioned as a controller of the oxidative stress response by targeting p38α in the progression of ovarian tumor [26]. Another result of this study revealed that the down-regulation of miR-429 could suppress the apoptosis of cardiomyocytes. Consistent with this result, up-regulated miR-429 was proved to have the ability of promoting apoptosis in esophageal carcinoma via targeting Bcl-2 as well as SP-1 [27]. It has been also demonstrated that overexpressed miR-429 could induce apoptosis in hepatitis B virus-related hepatocellular carcinoma [28]. Besides, there was another essential finding that CrkL is a target gene of miR-429 and down-regulated miR-429 was able to promote the expression of CrkL and represses activation of the MEK/ERK signaling pathway. A similar result could also be found in previous research, in which the authors have provided evidence to prove that the repression of miR-429 contributed to the up-regulation of CrkL expression [14]. Additionally, it has been verified that miR-429 could restrain the progression of hepatocellular carcinoma through targeting CrkL by inactivating the Raf/MEK/ERK signaling pathway [17]. All of these data were conducive to the proving of the mechanism and function of miR-429, CrkL and the MEK/ERK signaling pathway in human diseases.

In conclusion, our study provides evidence that the down-regulation of miR-429 could alleviate the oxidative stress and inflammation reaction of rats with CHD. Furthermore, down-regulated miR-429 has the ability to suppress the apoptosis of cardiomyocyte, resulting in a protective impact on the myocardium of CHD rats. These findings would contribute to the treatment of CHD. Nevertheless, more efforts are needed to be carried on to further identify the function mechanisms of miR-429 in the progression of CHD.