Literature DB >> 31437171

Computational and experimental elucidation of Plasmodium falciparum phosphoethanolamine methyltransferase inhibitors: Pivotal drug target.

Jagbir Singh1,2, Sonam Vijay1, Rani Mansuri3, Ritu Rawal1, Kavita Kadian1, Ganesh Chandra Sahoo4, Mahesh Kumar2, Arun Sharma1.   

Abstract

INTRODUCTION: Plasmodium falciparum synthesizes phosphatidylcholine for the membrane development through serine decarboxylase-phosphoethanolamine methyltransferase pathway for growth in human host. Phosphoethanolamine-methyltransferase (PfPMT) is a crucial enzyme for the synthesis of phosphocholine which is a precursor for phosphatidylcholine synthesis and is considered as a pivotal drug target as it is absent in the host. The inhibition of PfPMT may kill malaria parasite and hence is being considered as potential target for rational antimalarial drug designing.
METHODS: In this study, we have used computer aided drug designing (CADD) approaches to establish potential PfPMT inhibitors from Asinex compound library virtually screened for ADMET and the docking affinity. The selected compounds were tested for in-vitro schizonticidal, gametocidal and cytotoxicity activity. Nontoxic compounds were further studied for PfPMT enzyme specificity and antimalarial efficacy for P. berghei in albino mice model.
RESULTS: Our results have identified two nontoxic PfPMT competitive inhibitors ASN.1 and ASN.3 with better schizonticidal and gametocidal activity which were found to inhibit PfPMT at IC50 1.49μM and 2.31μM respectively. The promising reduction in parasitaemia was found both in orally (50 & 10 mg/kg) and intravenous (IV) (5& 1 mg/kg) however, the better growth inhibition was found in intravenous groups.
CONCLUSION: We report that the compounds containing Pyridinyl-Pyrimidine and Phenyl-Furan scaffolds as the potential inhibitors of PfPMT and thus may act as promising antimalarial inhibitor candidates which can be further optimized and used as leads for template based antimalarial drug development.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31437171      PMCID: PMC6705855          DOI: 10.1371/journal.pone.0221032

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Despite several advances and progresses for the control of malaria, it is still an important global health problem. There is no significant fall in malaria burden globally from an estimated 239 cases in 2010 to 219 million new malaria cases in 2017 and thousands of death by malaria occurred globally[1]. It is surprising that the 80% of the burden is solely found in India and sub Saharan African countries as per WHO report 2018 [1]. In a current scenario, malaria treatment is relied on very few drugs. Spread of resistance to first line antimalarial drugs including artemisinin based combination therapy calls for the search and novel drug development [2]. Efforts are required to focus on novel inhibitor compounds that can specifically target and block parasite growth and transmission of plasmodium parasite. In plasmodium, lipids play significant roles in various metabolic processes starting from membrane biogenesis to signaling as well being essential for their survival and viability. Phosphatidylcholine (PC) is considered to be the major and essential phospholipid constituent of membranes that play a key role in parasite growth, proliferation and survivals.Biosynthesis of PC has also been found to be essential for survival of many other organisms such as Leishmania major, bacteria’s, and eukaryotes [3-5]. Therefore, the pathways of phospholipids biosynthesis are considered to be attractive targets for antimalarial drug discovery. PC synthesis occurs mainly by three routes de novo (CDP-choline), CDP- ethanolamine (kennedy pathway) and CDP-diacylglycrol pathway [6-7]. In case of malaria, parasite requires an active production of PC by alternative pathway i.e. serine decarboxylation pathway (SDPM) for synthesis of new membranes required for rapid proliferation of parasite during both intraerythrocytic and gametocyte development [8-9]. In plasmodium, an atypical step is the synthesis of phosphocholine from ethanolamine catalyzed by Phosphoethanolamine methyl transferase (PMT) and absence of this enzyme in mammals making an attractive antimalarial drug target. PMT gene knockout studies have shown complete inhibition of the PC biosynthesis from serine and caused serious defects in parasite survival and multiplication. However, when PfPMT was reintroduced into knock out strain, gametocyte differentiation was restored to wild type level [10]. It is known that PfPMT and plant methyltransferase (PEAMT) are homologues but only for three methylation steps i.e. plants PEAMT have two catalytic domains and PfPMT has one catalytic domain. This implies that same catalytic domain is being used for all triple methylations [11-13].Therefore; the inhibition of catalytic domain of PfPMT can lead to complete inhibition of SDPM pathway. Since PfPMT has been found to be expressed throughout the asexual and sexual phases of parasite life cycle and absence of its human orthologues therefore it may be used as target template for development of new antimalarial [14-16].Biochemical studies have demonstrated that human malaria parasite orthologs of PMT have similar structural as well as biochemical properties and inhibition profiles as plasmodium [17]. In the present study, we report the characterization and phylogenetic comparison of PfPMTgene and comparative analysis showed significant identity among SAM-dependent methyltransferase domains and motifs. To delineate this protein as a drug target, we undertook docking studies to identify the compounds inhibitors of PfPMT that were either interacting with crucial amino acids or occupying the catalytic dyad important for triple methylationthrough in vitro and in vivo efficacy studies in albino mice as well. We have aimed to project these antimalarial inhibitors against PMT which may prevent the function of target protein and synthesis of the phosphatidylcholine not only in Plasmodium falciparum but also in other studied Plasmodium orthologues. Our present study have identified that the Asinex compounds containing Pyridinyl-yrimidine and compounds containing Phenyl-Furan scaffolds as specific PMT inhibitors which may provide insights into the mechanism of blocking transmission of the malaria infection and may set as an imminent prospect to overcome the problem of antimalarial drug resistance.

Materials and methods

Ethical approval

Present study was approved by the Human Ethical Committee of National Institute of Malaria Research (NIMR), New Delhi. Written informed consent was documented and mandatorily sought from each patient prior to the sample collection. Parasite bank, NIMR is well established and routinely maintained. Animal experiments were conducted at Department of Animal Experiments, National JALMA Institute for Leprosy and Other Mycobacterial diseases (ICMR), Agra for ethical approval from the Animal Research Ethics Committee JALMA, Agra, India (Approval Id: JALMA/2018/10).

Sample collection

P. falciprum malaria +ve blood samples were collected using filter paper method. Briefly, by finger prick, blood (2–3 drops) of the patients visiting to the malaria Clinic at NIMR, Delhi was collected on 3 mm filter paper strips (Whatman International Ltd. Maidstone, UK). The Pf positive was confirmed by screening with microscope and Rapid Diagnostic Test kit Falci Vax (Zephyr Biomedicals, India).

PfPMT gene amplification

P. falciparum genomic DNA was isolated from blood samples using a QIAamp DNA Blood Mini Kit.Two set of primers Forward primer 5’ CTTAGAATCCTGTTTTGTTCC 3’ and Reverse primer 5’ CCACTAACTCTTTCATTAGCC 3’), second set (Forward primers 5’ GATCTGGTTTAGGAGGTGGT 3’ and Reverse primers 5’ GGAGGTATGTGTGTGTATTT 3’) were designed using Primer3 based on the nucleotide PfPMT 3D7 isolate and synthesized. cDNA was synthesized from whole RNA isolated from P. falciparum culture as per manufacturer instructions (Qiagen,Hilden, Germany). PfPMT gene PCR product was gel purified by exosap IT (Fermentas, CA, USA) and cloned in E.coli DH5α competent cells [18]. Sequencing at First BASE Laboratories SdnBhd (Selangor, Malaysia) confirmed the positive recombinant clones. DNA sequence chromatogram was further analyzed using FINCHTV and BioEdit tool [19].The amplified nucleotide sequence of Indian isolate of PfPMT gene (Ind_PfPMT) was submitted to NCBI Gen Bank and available with the accession numbers KX755406 for public domain use.

Sequence analysis

Sequence Ind_PfPMT, Plasmodium orthologues worldwide, other organisms and phosphatidylcholine ethanolamine N-methyltransferase (PtdEPMT) isoforms (BRENDA, EC no. 2.1.1.17) were aligned and using Multalin online server (http://multalin.toulouse.inra.fr/multalin/)[20].Plasmodium orthologous proteins of Ind_PfPMT and other species were retrieved From KEGG (http://www.genome.jp/kegg/) and EuPathDB (https://eupathdb.org/eupathdb/). Phylogenetic tree was constructed based on the neighbor joining method using MEGA6.0, at bootstrap confidence replication value 10,000 [21, 22]. Domains of all Plasmodium strains were compared using InterPro (http://www.ebi.ac.uk/interpro/) [23-24].

Inhibitor identification of PfPMT

Active site analysis and compound library enumeration

No mutation was found in amino acid sequences of Ind_PfPMT (India) and PfPMT 3D7 (PDB Id: 3UJ9), thus the crystal structure (PDB Id: 3UJ9) was used docking of compounds [25]. The potential active sites were analyzed from SiteMap with default settings applying OPLS_2005 force field where hydrophobicity kept more restrictive, which identified the cavities and scores them according to the site volume and site score. The active site Grid was generated using Glide module of Schrodinger v9.6 to screen the compounds [26-27]. Asinex database was browsed to develop the compound library.

Pre filtering, virtual screening and In-vitro analysis

Prior, to the virtual screening the compound library was filtered for the Druglikeness predictions. ADMET properties of the drug should be optimum to be absorbed and reached to the site of action. ADMET and toxicity (carcinogenicity, mutagenicity, Cyp2d6 prediction, and toxicity)was predicted using TOPKAT modules of discovery Studio v 3.5 (DS v3.5) [28]to remove the compounds with unfavorable ADMET properties at earlier stages [29-30] and were also analyzed forLipinski’ rule [31]. TOPKAT module uses quantitative structural toxicity relationship and similarity searching of the model’s database to identify the toxic properties of compounds as a query compound [32]. For Virtual Screening (VS), workflow of Schrodinger v9.6 was used for screening of compound library in three steps where the dataset size goes smaller at each stage [27]. The pEth/pCholine, endogenous substrate/product were used as docking control. Compounds with better XP Glide score than docking control were selected and binding energy was predicted using Prime MM-GBSA module of Schrodinger v9.6 applying OPLS_2005 force field [33]. For in-vitro analysis the Plasmodium falciparum parasite culture was maintained in RPMI1640 media supplemented with 5% sodium bicarbonate, 10% heat inactivated human serum. Ring stage parasitized cells were separated from 5% sorbitol. 1% of ring stage parasitized cells were maintained for in-vitro analysis of identified compound. The in-vitro antimalarial activity assay was performed [34] in 96 well-microtitre plates. The stock solution of each compound (250 μM) was prepared in 0.1% DMSO and the further serial dilutions of each compound were prepared.100 μl of each compound was pipette down in test wells in triplicate and control wells (without test compound) were incubated at 37°C in CO2 incubator. Blood Giemsa stained smear was prepared from control and microscopic was done for schizonts formation (1%) after 36–40 h of incubation. The % parasitemia was determined by counting a total of 200 asexual parasites (both live and alive) microscopically using chloroquine as the reference drug. The compounds with IC50 less than 5.0 μM were considered as primary hits.

Gametocidal and cytotoxicity activity

Gametes of Plasmodium falciparum RKL-9 strain were developed from synchronized ring stage of RKL-9 strain using hypoxanthine supplemented complete RPMI1640 mediafor gametocidal activity testing of primary hits. Hypoxanthine necessarily supplements media with purine which is important for development as well as maturation of gametocytes. Stock solutions of primary hits and standard drug primaquine (Sigma-Aldrich) were prepared. On 5–6 day gametocytes were produced and examined morphologically through the microscopy. The plate with 2–3% gametes were incubated at 37°C with primary hits in serial dilution for 48 hrs. Culture without test compound (primary hits) was kept as control. Thin smears were prepared and stained with 10% Giemsa and microscopy was done to examine the next stages of gametocyte (stages II and III). Activity at each concentration of primary hits was calculated in terms of % inhibition [35]. Human embryonic kidney cells 293 (HEK293) were developed using Dulbecco’s Modified Eagle’s Medium high glucose medium added with penicillin (1%) and supplemented with fetal bovine serum (5%) and placed in CO2 incubator at 37°C for carrying MTT (3-[4,5- dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide)toxicity assaybased on colorimetric assay.Before seeding five thousand cells into 96-well plate, were washed thrice with growth media and trypsinized. Cells with viability 98% were added with primary hits in different dilutions (10μM, 50μM, 100μM, 150μM, 200μM, 250μM) to the plate and incubated for 24 hours. After 24 hrs incubation MTT 5mg/ml was added to the plate and 4 hrs incubation was given. The supernatant was removed and added with DMSO to each well and the readings of absorbance were recorded at 580nm using Synergy/HTX MultiScan reader (BioTek) [36-37].The Lethal dose LD50 of each primary hits were calculated as mean from experiments in triplicate. Based on the LD50 and antimalarial IC50 of each inhibitor were used for selectivity index (SI) calculation.

PfPMT expression, purification and enzymatic inhibition assay

PfPMT cDNA was synthesized and cloned using pET-24a expression vector. Positive pET24a clone was then transformed in BL21 (DE3) expression host for protein expression and purified. In LB medium expression strains were incubated at 37°C and added with Kanamycin (Kanamycin: 35mg/ml stock concentration).The culture was grown to an OD of 0.6 at 600 nm and induced with 1mM isopropyl-β-D- thiogalactopyranosidase (IPTG).Before and after induction samples were analyzed on SDS-PAGE (12%). The culture was pelleted down and suspended in 1X PBS. 1X PBS suspended pellet was subjected to sonication and was centrifuged after sonication at 10,000 rpm for 15 min at 4°C. Sonication supernatant and pellet were loaded on 12% SDS-PAGE for checking the protein of interest. SDS-PAGE analysis of 1X PBS sonication showed the presence of protein of interest in supernatant. The supernatant was further processed for protein purification using gel extraction protocol. Purified fractions were loaded on 12% SDS-PAGE and further confirmed by MALDI TOF MS/MS analysis. Native form of PfPMT was confirmed through assay which was performed in UV-transparent plates (acrylic, nonsterile, costar) using SAM-dependent methyltransferase assay Kit of G-Biosciences which works on the degradation of Adenosylhomocysteine (SAH) into urate and hydrogen peroxide by mixture of enzymes. 1mM SAH was used as positive control. The assay mixture was consisted with SAM methyltransferase assay buffer with phosphoethanolamine (pEth) 200μM, SAM 200μM, 2.5μM PfPMT, SAM enzyme mixture and SAM colorimetric mix in a total volume of 115μM. The functional concentration of phosphoethanolamine was confirmed according to the PfPMT assay developed by Bobenchik et al [38]. Finally, the rate of formation of hydrogen peroxide was measured by increase in absorbance at 510 nm. The Primary hits were dissolved in 1% DMSO solution and stock solution was prepared in H2O. The experiments of all primary hits were carried out in presence of native purified PfPMT protein and the absorbance was quantified at 510 nm. The absorbance of protein without inhibitors was considered as 100% protein activity. The absorbance at different concentrations of each primary hits were converted into % PfPMT inhibition and plotted against inhibitor concentration. Enzymatic assay was also performed at different increasing concentration of substrate pEth (50, 100, 150, 200, 250 μM) to determine the Ki value for enzyme kinetics.

In vivo studies

Animal experiment studies were carried out at JALMA, Agra, India with the grant of ethical approval from the Animal Research Ethics Committee. Compounds were procured from Asinex database with 98% HPLC purity and the analytical grade chemicals and reagents were used in the study. Triple distilled Millipore purified water (Millipore, USA) were used to prepare solutions. Male albino mice of twelve to sixteen months old, weight ranging 22 to 25 g used in study. Mice were exposed to the day/night light cycle of 12 hours period. Mice were monitored properly with plentiful dried food and water and their sanitation was carefully monitored every day (S1 Protocol). The parasite Plasmodium berghei (strain ANKA) is cryopreserved and stored at parasite bank ICMR-National Institute of Malaria Research, New Delhi. Two donor mice were infected with Plasmodium berghei parasite, administered intraperitoneally one week before the date of experiment to be conducted. The infected blood from donor mice was collected from tail bleeding method into heparinized tubes and parasitemia (≥15) was determined using microscopy. Mice were divided into three groups as test group, Positive control group and negative control group. Three mice for each group were used and each mouse was administered calculated volume of saline water (0.9% NaCl). 200μl of P. berghei infected RBCs (1×107 per 200μl) were given to each test mice to infect them. Dosages were calculated as per body weight and route of administration orally (gavage needle) and Intravenous (IV) and standard dose selected. Mice group with parasitized erythrocytes kept a positive control. One group of three mice were treated with chloroquine (CQ) as negative control and the test mice were administered with studied PfPMT inhibitors (test compounds) once a day. The first dose was administered on first day two hours later of the infection followed by other three doses each at 24 hours interval. On fifth day the blood sample was collected from tail bleeding, collected in tubes containing PBS and % parasitemia was checked using microscopy and % growth inhibition was calculated [39]. The mice were scarified through using CO2 to terminate the experiment [40].

Results and discussion

PfPMT gene amplification and sequence analysis

Analysis of sequenced Ind_PfPMT gene using FINCHTV showed that gene is carrying open reading frame of 801 bp coding nucleotide and Blastn analysis showed the 100% nucleotide identity with PfPMT3D7 implied the functional and structural conservation at gene as well as protein level too. Amino acid sequence analysis of Ind_PfPMT and its orthologues was done through the multiple sequence alignment (MSA) and Phylogenetic analysis. Since, phosphoethanolamine methytransferase (PMT) gene is absent in human, so the Blastp of Ind_PfPMT was done with human proteome and protein with sequence identity >20% was selected for sequence analysis. Human protein PtdEPMT isoforms (Table 1) with identity of 27% were used for analysis. The MSA showed 100% amino acid sequence identity with PfPMT3D7 and 66% with PvPMT isolates worldwide. Orthologues (PkPMT, PrPMT, PcPMT) also showed significant identity and sequence coverage with Ind_PfPMT.
Table 1

Depicted domain and motifs scan of PMT proteins of Plasmodium species.

Plasmodium StrainNo. of amino acidsDomain (SAM dependent methyltransferase)Methyltransferase Motifs
PFPMT_Indian266(aa19 –aa265)aa 60–157
PFPMT3D7_1343000266(aa19 –aa265)aa 60–157
Prpmt_A0A060RY81_PLARE266(aa19 –aa265)aa60-157
PVPMT Sal1264(aa18 –aa262)aa57-154
PVPMT_India264(aa18 –aa262)aa57-154
PVPMT_Brazil264(aa18 –aa262)aa57-154
PkNH_B3L8G9264(aa24 –aa262)aa57-154
PVPMT_Mauritania I264(aa18 –aa262)aa57-154
PVPMT_North Korean264(aa18 –aa262)aa 57–154
PMT_P.inui San Antonio 1274(aa34—aa272)aa67-164
PCPMT.strainB_K6UVQ5258(aa25 -aa 256)aa51-148
The amino acids in the red background were found conserved both in plasmodium PMT and human phosphatidylcholine ethanolamine N-methyltransferase(PtdEPMT) isoforms. Besides the 27% of identity of PfPMT with PtdEPMT, none of the crucial residues except Tyr160 were found identical that implied the big difference within the binding pocket of both the proteins. Tyrosine residues Tyr19, Tyr-27, Tyr-160, Tyr-175, and Tyr-181 enclosed in blue boxes which are crucial for phosphoethanolamine/phosphocholine binding for biological function were found conserved throughout the plasmodium PMT orthologues. The arginine Arg179 and Lysine Lys247responsible for electrostatic interaction within the phophobase site were also found conserved. The residues Tyr19 and His132 essentialfor forming catalytic dyad between AdoMet and phosphobase were also found conserved among Plasmodium spps globally (Fig 1). Hence, Ind_PfPMT has excellent functional and structural conservation among demographic isolates of PMT protein orthologues that makes it a potential therapeutic target for structure based drug discovery. The entirely different binding pocket from PtdEPMT may be helpful in developing the PfPMT specific inhibitors without side effects to human.
Fig 1

Multiple alignments of Ind_PfPMTare depicted with its orthologs from Plasmodium and human PEMT (Phosphatidylcholine ethanolamine methyltransferase) enzyme isoforms.

Crucial amino acids for biological function of PfPMTare shown in blue boxes.

Multiple alignments of Ind_PfPMTare depicted with its orthologs from Plasmodium and human PEMT (Phosphatidylcholine ethanolamine methyltransferase) enzyme isoforms.

Crucial amino acids for biological function of PfPMTare shown in blue boxes. Phylogeny was studied separately to better understand the evolutionary relationship and global distribution of PMT protein among orthologues of Plasmodium worldwide and other spp. Phylogenetic tree revealed that all studied PMT protein members clustered into two major groups (Fig 2). Group 1 formed cluster of PMT protein of all Plasmodium spp. isolates globally and group 2 is a unique distant cluster of human phosphatidylcholine ethanolamine N-methyltransferase (PtdEPMT) isoforms. Group 1 was subdivided into two related clustered protein i.e. 1A and 1B. In subgroup 1A, human malaria parasite PMT of all Plasmodium vivax, P. knowlesiand nonhuman malaria parasite P. cynomolgi isolates formed a unique cluster. Ind_PfPMT was clustered with PfPMT3D7 and P. reichenowi in a group 1B. Phylogeny implied the close evolutionary relatedness between ind_PfPMT and Plasmodium PMT orthologues and a very distant relation with human PtdEPMT isofoms with very less sequence identity (Fig 2).
Fig 2

Phylogenetic analysis of Ind_PfPMT is shown with other pmt orthologues in Plasmodium species using neighbor joining method.

Phylogenetic analysis of PMT of Plasmodium with orthologues from other spp showed the peculiar distribution of PMT gene among different protozoan pathogens and plants. PMT gene has common ancestor to all the apicomplexans of group 1A and group 1B that revealed the close evolutionally relationship among PMT orthologues, fungi (group 2) and plant orthologues (group 1B). Humans PtdEPMT formed distant separate group (group 4) (Fig 3) which also revealed the distant relation with human PtdEPMT with negligible functional as well as structural conservation so, drug developed based upon Ind_PfPMT may be effective against different human Plasmodiumspecies globally without any side effects.
Fig 3

Phylogeny showed with all Plasmodium and other species orthologues from KEGG and EuPathDB along with human PtdEpmt.

Domain is a super secondary structural part called as catalytic unit of a protein. A protein can have multiple domains or whole protein can act as single domain. Domains can be comprised of different secondary structural motifs responsible for catalyzing specific function. Secondary structural analysis (Table 1) revealed that Ind_PfPMT and PfPMT3D7 were found to have 100% conserved methyltransferase motif and SAM dependent methyltransferase domain with significant identity with Plasmodium PMT orthologues which makes it an important drug target for structure based drug discovery (Fig 1). It has also been found that PfPMT3D7, PvPMT and PkPMT have significant sequence and structural similarity [17]. Hence, Ind_PfPMT may fulfill the thrust of potential drug effective globally based on structure based computational drug development, which may be effective against human infecting Plasmodium isolates worldwide.

Protein structure and compound library for docking

Since no mutation was found among Ind_PfPMT (Indian) isolate and reference gene (PfPMT3D7), Ind_PfPMT and PfPMT3D7 are structurally and functionally 100% identical. SAM bounded of PvPMT and PkPMT structures have shown hydrophobic PMT active site and having very similar structural folds with RMSD = 0.452 A°. The well conserved active sites of P. falciparum, P. vivax and P. knowlesi could potentially be inhibited by a common inhibitor which may act as an effective antimalarial drug globally [17].Hence, the crystal structure of PfPMT3D7 (PDB Id: 3UJ9) was used for virtual screening of compound library. Compound library was built from Asinex compound library.

Active site creation

Binding sites of (pCholine or pEth) and (AdoMet or AdoCys) are adjacent to each other and there catalytic dyad is formed between Tyr19 and His132 from pCholine/pEth and AdoMet/AdoCys binding sites respectively [25]. Active sites scored from SiteMap, the potential active site having site score 1.059 and drugscore 1.004 found with the bigger site volume (716.87). The important thing found with this site is the pCholine/pEth and AdoMet/AdoCys binding pockets are covered by the site. Grid was generated around this site and increased upto 12Ao in XYZ direction so that compound can move easily within the pocket and can generate ideal conformation.

Pre filtering, virtual screening and invitro analysis

Since compounds which fulfill the parameters of Lipinski rule have better probability of druglikeness, so prefiltering of compounds before docking is a good approach. Compound library was pre filtered through Lipinski rule of five and ADMET using DSv3.5 and promiscuous compounds using false positive remover to save time and experimental cost. False positive remover identifies and eliminates the compounds with reactive functional groups like compounds containing sulfonamide, rhodanine, quinine, benzpyrenone and catechol as these promiscuous compounds have the probability of binding covalently nonspecifically within active pocket. According to the physicochemical parameters, a drug with high solubility may not able to cross membranes and highly lipophilic drug have dissolving problem. So, there should be optimum ratio between lipophilicity and water solubility according to the Lipinski rule of five. Therefore, the curated non-promiscuous compound with better Lipinki rules’5 were subjected for computational ADMET analysis. Since solubility plays significant role from dissolution to the drug action and according to the DS v3.5, for a druggable compound solubility must be ranging from extremely low solubility (−8.0) to an optimal solubility (0.0). Solubility levels 3 (good solubility) and 4 (optimal solubility) signified that selected five compounds have druggable solubility as given in Table 2. According to the DS v3.5, the lipophilicity (ALogp98) value should range between the −2.0 and 5.0 and PSA should not be more than 140Å for good intestinal absorption. Absorption level 0 and 1 suggested the good and moderate absorption probability respectively, which fulfill the druglikenss filters of cell permeability and may be absorbed in the intestine. On computational toxicity analysis, selected inhibitors of PfPMT showed no affinity for Cyp2d6 (Cytochrome enzyme) and plasma proteins. Thus, these may not be responsible for any kind of drug- drug interaction and retention of these compounds within the human body. These were also passed through the toxicity filter and found to have nontoxic properties as given in Table 2.
Table 2

Docking score and binding energy of selected compounds tabulated with interacting amino acids and Virtual ADME parameters as per Lipinski rule of five of selected compounds and virtual toxic physicochemical parameter analysis of selected compounds.

Compound IDASN.1ASN.2ASN.3
IUPAC name6-[Amino-2-(4-fluoro-phenyl)-ethyl]-pyridin-2-yl-1H-pyrimidin-4-one1-{2-[(5-Phenyl-furan-2-ylmethyl)-amino]-ethylamino}-propan-2-olN-[2-(3,4-Dimethoxy-phenyl)-ethyl]-2-[(tetrahydro-furan-2-ylmethyl)-amino]- acetamide
Mol. weight311.3308.8323.4
H_Acceptor546
H_Donor433
PSA84.958.956.9
LogP0.402.46-0.15
ROS Violation000
Solubility-2.3-3.0-0.84
Solubility level334
Absorption level000
CyP2D6 affinityFalseFalseFalse
MutagenicFalseFalseFalse
CarcinogenicFalseFalseFalse
TumergenicFalseFalseFalse
Glide XP score-12.3-9.81-9.66
Binding energy-110.2-98.4-96.8
IC50 (Schizonticidal)1.77μM3.93μM3.21μM
Hence, selected compounds were found to have well to optimum drug likeness properties and also found non-carcinogen, non-mutagen, and nontoxic were subjected for docking analysis using Schrodinger v9.6 through three consecutive docking stages based on precision and accuracy. The Asinex compound library was subjected for docking analysis based on precision and accuracy. The pCholine and pEth (docking control) were docked with PfPMT and found score -5.6 kcal/mol and -7.2 kcal/mol glideXP respectively and the Prime MMGB binding energy was calculated as -49.8 kcal/mol and—54.4 kcal/mol respectively. To minimize the computational error compounds with Glide XP score more than Glide XP cutoff ≤ -10 kcal/mol was considered as better compounds and further validated as per binding energy (Prime MMGB) of docking compounds. Compounds with binding energy cutoff ≤ -60kcal/mol, better than docking control were selected as hits and were found preferably thermodynamically stable conformation with lowest possible energy within the binding. Three hundred hits were found binding with crucial amino acids (Tyr amino acids) and amino acids (Tyr19 & His132) crucial for catalytic dyad within the PfPMT binding pocket were selected and clustered for selecting diverse chemotypes to test and different promising chemotypes. Clustering was done based on tanimoto coefficient similarity index using Canvas, Schrodinger v9.6. Hits were clustered into seven groups based on tanimoto groups containing chemotypes (Phenyl-tetrazolo-pyridin, Pyrrolo-pyridinyl, pyridinyl pyrimidine, furanyl- piperidine, morphaline, Benzoimidazol, phenoxychromen, phenyl- furan, etc.) and top scored druglike compound representative from each group were procured for in vitro analysis. All procured compounds were tested on parasite culture in triplicate and only three compounds (Fig 4) showed good schizonticidal activities on Plasmodium falciparum culture. IC50 was calculated based on parasite inhibition at different concentrations and compounds with IC50< 5μM were selected as primary hits for further analysis. Compounds formed binding with essential amino acids.
Fig 4

Structures of the three primary hits which showed good schizonticidal activity.

The primary hit ASN.1 occupied the substrate pocket, shown in surface view (Fig 5A). ASN.1 fluorine of benzene ring formed H-bonds with Lys 247 crucial for binding of substrate. Electrostatic interaction were formed with Tyr 160 and Asp 128 through π-cation bonding and also formed vanderwaal interactions with important tyrosine residues like Tyr 19, Tyr 175, Tyr 181 and other residues like His 132 and Arg 179 essential for biological function of PfPMT for substrate binding and catalytic dyad formation. Both the heterocyclic ring (pyridine and pyrimidine) packed performing hydrophobic interaction throughπ-alkyl bondinginto binding pocket (Fig 5B). Since, hydrophobic interactions are as crucial as hydrogen interaction so, the interaction of ASN.1 with crucial residues within binding pocket implied significance of interactions for schizonticidal activity at very low μM concentration IC50 at 1.77μM (Fig 5C).
Fig 5

(A) Interaction of primary hits (ASN.1) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against growth of Plasmodium falciparum parasite culture.

(A) Interaction of primary hits (ASN.1) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against growth of Plasmodium falciparum parasite culture. The Primary hit ASN.2 found to be occupied within binding pocket of both the substrate and co substrate, SAM (Fig 6A). In ASN.2 chlorine of the benzene ring and furan provided hydrophobic interaction through the alky and π-alkyl bonds with leucine 133, 141 and isoleucine 62, 111 and 130 amino acids within the hydrophobic core of binding pocket.Vander wall interaction formed with tyrosine residues like tyr19, 160, 175 and Tyr 181 and other amino acids His132, Lys 247, Arg 179responsible for substrate binding as well as catalytic dyad formation (Fig 6B). Furan ring also showed π- anion interaction and hydrophobic interaction throughπ-alkyl bonding with inhibitor. Interactions showed may prevent the formation of catalytic dyad and substrate binding which may be the reason of good inhibition of schizonts at low micromolar concentration (IC50 = 3.93μM)(Fig 6C).
Fig 6

(A) Interaction of primary hits (ASN.2) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against Plasmodium falciparum growth.

(A) Interaction of primary hits (ASN.2) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against Plasmodium falciparum growth. Primary hit ASN.3 showed good interaction within the binding pocket by occupying crucial amino acids (Fig 7A).The oxygen of furan heterocyclic ring formed hydrogen bonds with crucial amino acids Tyr19 for binding with substrate for catalyzing the function. Vander wall interaction formed with His132, Tyr 181, Lys 247, Arg 179 and Hydrophobic interaction by furan ring throughπ-alkyl bonding with Tyr 160 crucial amino acids binding of substrate and for catalytic dyad which may be the reason of good inhibition of schizonts at low micromolar concentration (Fig 7B). The good schizonticidal activity at 3.21μM low micromolar concentration may be because of the good interaction within the binding pocket occupied key essential amino acids (Fig 7C).
Fig 7

(A) Interaction of primary hits (ASN.3) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against growth of Plasmodium falciparum.

(A) Interaction of primary hits (ASN.3) is shown in element color ball and stick in surface view within the active pocket of PfPMT. (B) 2D interaction with amino acids within five Å of interaction.(C) Schizonticidal activity (IC50)against growth of Plasmodium falciparum. The docking analysis implied better affinity for the PfPMT that the three compounds interact with crucial amino acids which may prevent the binding of substrate and also the transmethylation of phosphoethanolamine within the binding pocket. Different chemotypes were tested against P. falciparum culture and showed low to significant inhibitory activity where primary hits containing pyridinyl pyrimidine (ASN.1) and phenyl- furan (ASN.2 & ASN.3) chemotypes as substructure showed good inhibitory activity against PfPMT. Three primary hits showed good interaction with target protein and formed hydrogen bonds with crucial conserved amino acids for transmethylation as well as inhibition (IC50< 5μM) on Plasmodium falciparum culture (Table 2).

Gametocidal activity and cytotoxicity assay

Primary hits were again tested for gametocidal activity and cytotoxicity activity before protein inhibition assay. Primary hits were added in serial dilution to the RKL-9 gametocytes culture at time of first stage of gametocytes growth and IC50 was calculated (Fig 8). Primary hits which could inhibit the development of further stages of gametocytes at concentration below 5 μM were kept for further analysis. Primary hit ASN.1 and ASN.3 showed the better gametocyte inhibition with IC50 3.1μM (Fig 8A), and 3.8μM (Fig 8B) respectively. Hence, the significant gametocidal activity at lower micromolar concentration (<5μM) confirmed the dual activity of compounds that these compounds showed the significant activity growth (asexual development stage) and multiplication stage (gametocyte development). Primary hits (ASN.1and ASN.3) were kept for further study and ASN.2 was eliminated (Table 3).
Fig 8

Showed gametocidal activity of primary hits against RKL-9 strain in terms of IC50 (A, B). MTT toxicity of primary hits against HEK-293 cells with P *** (p>0.001) (C, D).

Table 3

The activity of inhibitors towards gametocytes, cell cytotoxicity and inhibition kinetics (Km and Ki) of PfPMT protein.

CompoundIDGametocidalIC50CytotoxicityLD50InhibitionEC50KmKi
ASN.13.1μM191.0 μM1.49 μM52.4 μM1.2 μμM
ASN.33.8 μM176.2 μM2.31 μM80.2 μM2.2 μM
Showed gametocidal activity of primary hits against RKL-9 strain in terms of IC50 (A, B). MTT toxicity of primary hits against HEK-293 cells with P *** (p>0.001) (C, D). Colorimetric analysis based toxicity of Primary hits was tested for human cell lines using MTT assay against kidney cell line (HEK-293). Primary hits were tested at different concentrations (10μM, 50μM, 100μM, 150μM, 200μM, 250μM) (Fig 8). Five thousand HEK-293 cells were embedded with different concentration of primary hits and fortunately, primary hits ASN.1 and ASN.3 were found nontoxic even at higher concentration with very high LD50 concentration 191.0 μM (Fig 8C) and 176.2 μM (Fig 8D) respectively and better selectivity index 1005.26 and 54.8 respectively as per Eq 1. More than 50% of HEK-293 cells were found viable even at 150μM. Even the 90% of cells were viable at 10μM (much higher than the schizonticidal IC50), found safer implied that the primary hits had good selectivity index. In the insilico toxicity analysis, these hits free of any reactive functional group were also found nontoxic (non-carcinogenic, non-mutagenic and non-tumorgenic) Hence, our computational results were found to be correlated with experimental data. The high selectivity index implied the better therapeutic safety of inhibitors and no toxicity entailed the use of these hits as antimalarial. The primary hits with better Gametocidal effect and safety index were taken for further experimental analysis.

PFPMT expression, purification and enzymaticinhibitionassay

PfPMT was cloned using pET-24a expression vector and expressed in BL21 (DE3). Expression host was purified using gel extraction protocol and presence of purified fractions was checked on 12% SDS-PAGE. Purified protein was confirmed by MALDI TOF MS/MS analysis and recombinant PfPMT protein band was observed at the expected 30 KDa (Fig 9).
Fig 9

Protein Expression Checking (Pf-PMT), Loaded on12%SDS-PAGE.

(1)–Before induction sample (whole cell extract). (2)– 16 hours after induction sample (whole cell extract). (3)– 4 hours after induction sample (whole cell extract), M–Protein Marker.

Protein Expression Checking (Pf-PMT), Loaded on12%SDS-PAGE.

(1)–Before induction sample (whole cell extract). (2)– 16 hours after induction sample (whole cell extract). (3)– 4 hours after induction sample (whole cell extract), M–Protein Marker. Purified PfPMT protein assayed using kit was found to be functional which was further used for assaying the primary hits to identify the inhibitors. This assay depends upon the transmethylation of phosphoethanolamine (pEth) into phosphocholine (pCholine) by PfPMT transferring three methyls of SAM and formation of S-Adenosylhomocysteine (AdoHcy: tridemethylated SAM). Rapid degradation of AdoHcy by AdoHcy Nucleosidase gets into S-Ribosylhomocysteine and adenine where adenine deaminase acts on adenine produces hypoxanthine which is rapidly gets converted into urate and hydrogen peroxide (H2O2) by xanthine oxidase. Rate of production of H2O2 was measured by increase in absorbance at 510 nm with the help of colorimetric reagent 3,5-dichloro-2-hydroxybenzensulfonic acid (DHBS). PfPMT assay was run over 30 minutes and increase in absorbance at 510 nm was recorded and change in absorbance was also recorded in absence of PfPMT. PfPMT inhibition assay to identify inhibitors was carried out at varying concentration of hits and calculated the EC50 of the hits using Prism GraphPad 5.0. ASN.1and ASN.3 was inhibited at very low μM conc. 1.49μM (Fig 10A) and 2.31μM (Fig 10B) with p value < 0.05 implied that these may be specific inhibitors of PfPMT. Kinetics of PfPMT reaction was studied by increasing the conc. of substrate pEth and Vmax and Km were calculated.
Fig 10

SAM dependent inhibitor assay and kinetics of PfPMT at 510nm (A) EC50 of ASN.1 inhibitor against PfPMT with P* (0.05) (C) inhibitor kinetics of the ASN.1 with 134.6 μM and (B) EC50 of ASN.3 inhibitor with P* (D) inhibitor kinetics of the ASN.3 with 150 μM.

SAM dependent inhibitor assay and kinetics of PfPMT at 510nm (A) EC50 of ASN.1 inhibitor against PfPMT with P* (0.05) (C) inhibitor kinetics of the ASN.1 with 134.6 μM and (B) EC50 of ASN.3 inhibitor with P* (D) inhibitor kinetics of the ASN.3 with 150 μM. Primary hits were assayed with established PfPMT assay and showed significant inhibition of PfPMT at 510 nm at very low micromolar concentration. For the kinetics of these primary hits, the hits concentration was kept fixed at varying concentrationof substrate. The Michaelis Menten kinetic plot was plotted for experimental values to determine the mode of PfPMT inhibition by inhibitors. Vmax and Km values of PfPMT from experimental values were calculated in presence and absence of inhibitors and correlated to calculate the Ki values of inhibitors (Fig 10). In presence of inhibitor, ASN.1 [Km(app)] was found 134.2 μM much higher than (Km) in absence of inhibitor (52.4 μM) at equal Vmax (0.101) whereas Ki (Inhibition constant) was found to be 1.2 μM. Km(app) and Km of inhibitor which is less than the EC50 of PfPMT (Fig 10C). [Km(app)] and(Km) for ASN.3 was also found 150μM and 80.2μM respectively (Fig 10D) at equal Vmax (0.102) with Ki value 2.2 μM which is again less than the EC50 of PfPMT (Table 3). Inhibitors which had Vmax equal to the substrate pEthanolamine and as these inhibitors were interacting with the crucial amino acids within the substrate binding cavity in the binding orientation similar to the substrate that signified the competitive mode of inhibition of ASN.1.

In vivo efficacy

The primary hits with good inhibitory activity and safety index were also studied for efficacy in mice in terms of % growth inhibition of parasitaemia. The mean % parasitaemia and % growth inhibition of parasite of PfPMT inhibitors was calculated based on the fifth day of dosing at 50mg/Kg, 10mg/Kg oral dosage and 5mg/Kg, 1mg/Kg IV dosage. The inhibitors which reduced the parasite growth ≥30% were considered as active and data of two tested inhibitors found active against P. berghei presented (Table 4). The groups of oral dose (50mg/Kg) of inhibitors reduced parasite growth more than 30% where ASN.1 reduced more than 50% of the parasite growth and also showed significant growth inhibition (32.5%) at 10mg/Kg. Intravenous (IV) dosage of this inhibitor greatly affected the parasite growth with 73.1% and 59.8% inhibition at 5mg/Kg and 1mg/Kg IV dosage respectively. Inhibitor ASN.3 also showed the significant activity at 50mg/Kg with 30.36% growth inhibition and both IV dosages with highest activity 49.4% growth inhibition at 5mg/Kg IV dosage. ASN.1 showed good potency both at oral as well as IV dosages implied the better druglikeness but ASN.3 could only reduce the growth of parasite better at IV dosages that may be because of pharmacokinetic problem of the ASN.3 which can be optimized and improved. Hence, the schizonticidal activities of both the PfPMT inhibitors confirmed the good in-vivo antimalarial potency at lower micromolar concentration.
Table 4

Efficacy of PfPMT inhibitors in P. bergheiinfected mice in terms of % growth inhibition.

DayDay 5th (Oral)Day 5th (IV)
Dosage50mg/Kg (Oral)10mg/Kg (Oral)5mg/Kg (IV)1mg/Kg (IV)
%Parasitemia%Growth inhibition%Parasitemia%Growth inhibition%Parasitemia%Growthinhibition%Parasitemia%Growth inhibition
ASN.114.2±1.7355.0621.3±1.932.58.5±0.3173.112.7±1.3259.8
ASN.321.5±0.8430.3627.6±1.712.615.2±1.049.418.1± 0.2242.05

Negative control (% parasitaemia) = 0.012±0.0

Positive control (% parasitaemia) = 31.6±0.48

Negative control (% parasitaemia) = 0.012±0.0 Positive control (% parasitaemia) = 31.6±0.48

Conclusion

The continuous usage of first line of antimalarial drugs often leads to resistance problem calls for the need for search and novel drug development. New drug development is however difficult but identification of a potential drug target is essential for structure based drug development. The PfPMT needed for PC synthesis through SDPM pathway during both intraerythrocytic cycle and gametocyte development fulfills the urge of plausible drug target and use it for structure based drug development of new antimalarial. The amplified Ind_PfPMT was found to be fully conserved in comparison with PfPMT 3D7 strain. The significant domain identification and sequence conservation was also found with human infecting Plasmodium orthologues more importantly among AdoMet binding and phosphobase domains. The phylogenetic analysis revealed the close evolutionary relatedness with functional as well as structural conservation among plasmodium. The human PEMT isoforms were found to be evolved independently and distantly. Hence, the enzyme PfPMT has been identified as an important drug targetwhich may be used to develop common antimalarial against human infecting Plasmodium species worldwide. The druglike compounds procured based on affinity sorted based on interaction affinity with target protein and crucial amino acids for biological function of protein. The schizonticidal testing provided three primary hits ASN.1, ASN.2 and ASN.3 with IC50 1.77μM, 3.93μM and 3.21μM respectively, and significant gametocidal activity with 3.1μM, 6.2μM and 3.8μM respectively below the five μM concentrations. The primary hits ASN.1 and ASN.3 with heterocyclic furan, pyridine, and pyrimidine chemo types were found nontoxic to HEK-293 cells. The PfPMT was inhibited at very low μM concentration and the protein kinetics demonstrated the competitive mode of inhibition of ASN.1 and ASN.3. The IV dose of both ASN.1 and ASN.3 showed good growth inhibition of P. Berghei in mice. The 50mg/kg oral dosing of ASN.1 and ASN.3 implied the good in vivo efficacy for P. beghei. Hence, PfPMT inhibitors ASN.1 and ASN.3 have been found to have good druglike properties and interaction with crucial amino acids. In conclusion, these inhibitors have good probability to be a good antimalarial and may be optimized to improve the bioactivity and may also be used as template for structure based drug designing.

Checklist_Arrive_PLOS.

The protocol designed and implemented to carry out the in vivo experiments in mice. (DOC) Click here for additional data file.
  35 in total

1.  Prediction of drug absorption using multivariate statistics.

Authors:  W J Egan; K M Merz; J J Baldwin
Journal:  J Med Chem       Date:  2000-10-19       Impact factor: 7.446

Review 2.  Domains, motifs and clusters in the protein universe.

Authors:  Jinfeng Liu; Burkhard Rost
Journal:  Curr Opin Chem Biol       Date:  2003-02       Impact factor: 8.822

3.  ELM server: A new resource for investigating short functional sites in modular eukaryotic proteins.

Authors:  Pål Puntervoll; Rune Linding; Christine Gemünd; Sophie Chabanis-Davidson; Morten Mattingsdal; Scott Cameron; David M A Martin; Gabriele Ausiello; Barbara Brannetti; Anna Costantini; Fabrizio Ferrè; Vincenza Maselli; Allegra Via; Gianni Cesareni; Francesca Diella; Giulio Superti-Furga; Lucjan Wyrwicz; Chenna Ramu; Caroline McGuigan; Rambabu Gudavalli; Ivica Letunic; Peer Bork; Leszek Rychlewski; Bernhard Küster; Manuela Helmer-Citterich; William N Hunter; Rein Aasland; Toby J Gibson
Journal:  Nucleic Acids Res       Date:  2003-07-01       Impact factor: 16.971

4.  Prediction of aqueous solubility of a diverse set of compounds using quantitative structure-property relationships.

Authors:  Ailan Cheng; Kenneth M Merz
Journal:  J Med Chem       Date:  2003-08-14       Impact factor: 7.446

5.  DNA sequencing with chain-terminating inhibitors. 1977.

Authors:  F Sanger; S Nicklen; A R Coulson
Journal:  Biotechnology       Date:  1992

6.  cDNA cloning of phosphoethanolamine N-methyltransferase from spinach by complementation in Schizosaccharomyces pombe and characterization of the recombinant enzyme.

Authors:  M L Nuccio; M J Ziemak; S A Henry; E A Weretilnyk; A D Hanson
Journal:  J Biol Chem       Date:  2000-05-12       Impact factor: 5.157

7.  The isolation and characterization in yeast of a gene for Arabidopsis S-adenosylmethionine:phospho-ethanolamine N-methyltransferase.

Authors:  C P Bolognese; P McGraw
Journal:  Plant Physiol       Date:  2000-12       Impact factor: 8.340

8.  Molecular and biochemical characterization of a cold-regulated phosphoethanolamine N-methyltransferase from wheat.

Authors:  Jean-Benoit Frenette Charron; Ghislain Breton; Jean Danyluk; Ingrid Muzac; Ragai K Ibrahim; Fathey Sarhan
Journal:  Plant Physiol       Date:  2002-05       Impact factor: 8.340

Review 9.  Regulation of mammalian cell membrane biosynthesis.

Authors:  A Lykidis; S Jackowski
Journal:  Prog Nucleic Acid Res Mol Biol       Date:  2001

10.  A pathway for phosphatidylcholine biosynthesis in Plasmodium falciparum involving phosphoethanolamine methylation.

Authors:  Gabriella Pessi; Guillermo Kociubinski; Choukri Ben Mamoun
Journal:  Proc Natl Acad Sci U S A       Date:  2004-04-08       Impact factor: 11.205

View more
  2 in total

Review 1.  Progress and challenges in the use of fluorescence-based flow cytometric assays for anti-malarial drug susceptibility tests.

Authors:  Kasem Kulkeaw
Journal:  Malar J       Date:  2021-01-21       Impact factor: 2.979

2.  A Hyperthermoactive-Cas9 Editing Tool Reveals the Role of a Unique Arsenite Methyltransferase in the Arsenic Resistance System of Thermus thermophilus HB27.

Authors:  Giovanni Gallo; Ioannis Mougiakos; Mauricio Bianco; Miriam Carbonaro; Andrea Carpentieri; Anna Illiano; Pietro Pucci; Simonetta Bartolucci; John van der Oost; Gabriella Fiorentino
Journal:  mBio       Date:  2021-12-07       Impact factor: 7.867

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.