Dongping Xia1, Beibei Chen1, Xun Yang1. 1. Department of Respiratory, The Central Hospital of WuHan, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China.
Abstract
BACKGROUND: The present study aimed to evaluate the correlation of integrin alpha 7 (ITGA7) with patients' clinicopathological characteristics and survival profiles, as well as its influence on cell proliferation, apoptosis, and stemness in non-small-cell lung cancer (NSCLC). METHODS: A total of 397 NSCLC patients underwent surgical resection were included, and ITGA7 was measured in tumor tissues and adjacent tissues by immunohistochemistry. patients' clinical data were extracted from database, and follow-up records were reviewed. In cellular experiments, expression of ITGA7 was measured in NSCLC cell lines and normal human lung epithelial cell line by RT-qPCR. The influence of ITGA7 on cell activity was assessed by transfecting overexpression plasmids and knockdown plasmids of ITGA7 into A549 cells. RESULTS: Integrin alpha 7 was upregulated in tumor tissues compared with the adjacent tissues of NSCLC patients. Patients with ITGA7 high expression presented poorer pathological differentiation, larger tumor size, and more advanced TNM stage compared with patients with ITGA7 low expression. For survival profiles, both disease-free survival and overall survival were shorter in ITGA7 high expression patients compared with ITGA7 low expression patients. In cellular experiments, ITGA7 was upregulated in NCI-H1650, A549, HCC-827, and NCI-H1299 cells compared with normal human lung epithelial cells BEAS-2B. In addition, ITGA7 promoted cell proliferation, inhibited cell apoptosis, and facilitated cell stemness in A549 cells. CONCLUSION: Integrin alpha 7 correlates with poor clinicopathological characteristics and survival profiles, and it promotes cell proliferation, stemness but suppresses cell apoptosis in NSCLC.
BACKGROUND: The present study aimed to evaluate the correlation of integrin alpha 7 (ITGA7) with patients' clinicopathological characteristics and survival profiles, as well as its influence on cell proliferation, apoptosis, and stemness in non-small-cell lung cancer (NSCLC). METHODS: A total of 397 NSCLCpatients underwent surgical resection were included, and ITGA7 was measured in tumor tissues and adjacent tissues by immunohistochemistry. patients' clinical data were extracted from database, and follow-up records were reviewed. In cellular experiments, expression of ITGA7 was measured in NSCLC cell lines and normal human lung epithelial cell line by RT-qPCR. The influence of ITGA7 on cell activity was assessed by transfecting overexpression plasmids and knockdown plasmids of ITGA7 into A549 cells. RESULTS:Integrin alpha 7 was upregulated in tumor tissues compared with the adjacent tissues of NSCLCpatients. Patients with ITGA7 high expression presented poorer pathological differentiation, larger tumor size, and more advanced TNM stage compared with patients with ITGA7 low expression. For survival profiles, both disease-free survival and overall survival were shorter in ITGA7 high expression patients compared with ITGA7 low expression patients. In cellular experiments, ITGA7 was upregulated in NCI-H1650, A549, HCC-827, and NCI-H1299 cells compared with normal human lung epithelial cells BEAS-2B. In addition, ITGA7 promoted cell proliferation, inhibited cell apoptosis, and facilitated cell stemness in A549 cells. CONCLUSION:Integrin alpha 7 correlates with poor clinicopathological characteristics and survival profiles, and it promotes cell proliferation, stemness but suppresses cell apoptosis in NSCLC.
Lung cancer is the most commonly diagnosed cancer as well as the leading cause of cancer‐related death in China with approximately 85% being non–small‐cell lung cancer (NSCLC).1 The majority of NSCLCpatients are diagnosed with advanced or metastatic disease, and chemotherapy is the main therapeutic approach for them.1 During the past two decades, therapeutic advances have evolved from cytotoxic drugs to more sophisticated therapies including targeted therapies that are better tolerated and have led to improved survival in selected NSCLCpatients.2 However, there are about 80% of patients who are not eligible for current targeted therapy, and challenges remain in the low overall cure and survival rates of NSCLC.3 Therefore, efforts are still needed in identifying novel treatment targets that benefit wider population, overcoming the drug resistance and recurrence, and seeking better predictors for prognosis.Integrins, comprising of 18α and 8β subunits, are a family of heterodimeric adhesion receptors that bind multiple components of extracellular matrix and consequently organize the cytoskeleton and activate intracellular signaling.4 In tumor biology, integrins are implicated in tumor cell migration, invasion, and proliferation accounting for their interaction with extracellular matrix as well as in tumor microenvironment by mediating angiogenesis, lymphangiogenesis, desmoplasia, and inflammation in endothelial cells, perivascular cells, fibroblasts, and inflammatory cells.5, 6, 7 Recent evidences have also revealed the role of integrins on driving stem cells functions including tumor initiation, metastatic reactivation, resistance to oncogene, and immune‐targeted therapies.5 Integrin alpha 7 (ITGA7) binds in conjunction with integrin beta 1 subunit and acts as receptor for the extracellular matrix protein laminin.8 The oncogenic function and role in the regulation of stem cell‐like properties of ITGA7 have been revealed in several cancers including glioblastoma and esophageal squamous cell carcinoma.8, 9 Whereas in NSCLC, the role of ITGA7 remains to be discerned. In the present study, we measured the expression of tumor tissue ITGA7 in NSCLCpatients and evaluated its correlation with patients' clinicopathological characteristics and survival profiles, as well as its influence on NSCLC cell proliferation, apoptosis, and stemness.
METHODS
Patients
From January 2012 to December 2013, 397 NSCLCpatients treated with surgical resection at our hospital were included in this study. The screening criteria included (a) diagnosed as primary NSCLC by clinical and histological examinations, (b) underwent surgical resection without neoadjuvant therapy, (c) tumor and paired adjacent tissues removed from surgery were appropriately preserved and accessible; (d) medical data including follow‐up records were complete and available. The patients were excluded if they lost follow‐up or complicated with other malignancies. This study was approved by the Institutional Review Board of our Hospital, and the written‐informed consents or verbal agreements (with tape recording) were collected from patients or their guardians.
Data collection
Patients' clinical data were extracted from electronic database of our hospital, which included age, gender, tumor size, lymph node metastasis, TNM stage, pathological differentiation, and adjuvant treatments. The adjuvant treatments after resection were performed according to the TNM stage, surgical margin status, and other clinical conditions according to the National Comprehensive Cancer Network (NCCN) clinical practice guidelines in Oncology: Non‐Small Cell Lung Cancer (Version 2.2011).10 In addition, the follow‐up records of patients were reviewed to calculate the disease‐free survival (DFS) and overall survival (OS), with the last follow‐up date of December 31st, 2018. The median follow‐up duration was 40.0 months, and total follow‐up duration ranged from 2.0 months to 79.0 months. The DFS was calculated from the surgical resection to disease recurrence, disease progression, death, or last follow‐up, and the patients who lost follow‐up were censored on the date they were last examined. The OS was calculated from the surgical resection to death or last follow‐up, and the patients who lost follow‐up were censored on the date were last known to be alive.
Immunohistochemistry for ITGA7
The tumor tissues and paired adjacent tissues were removed by surgery, then were fixed in 10% neutral buffered formalin and embedded in paraffin wax. After approval by our hospital, the paraffin‐embedded and formalin‐fixed tissues were collected from sample storage room. Tissues were cut into 4 µm sections, then were deparaffinized by xylene, and rehydrated by graded ethanol, followed by antigen retrieval using microwave heating. After that, the sections were incubated with H2O2 to block endogenous peroxidase activity, then were incubated with 0.025% Triton X‐100 (Sigma‐Aldrich), followed by 10% normal goat serum (Sigma‐Aldrich) to prevent nonspecific binding. Subsequently, the sections were incubated overnight at 4°C with primary antibody of Mouse monoclonal to ITGA7 (1:50; Santa Cruz Biotechnology). Next day, the tissue sections were incubated with horseradish peroxidase‐conjugated Goat Anti‐Mouse IgG H&L antibody (1:2000; Abcam) for 60 minutes at 37°C. Finally, the tissue sections were stained by diaminobenzidine (DAB) (Dako), counterstained by hematoxylin (Sigma‐Aldrich), sealed by neutral resin (Sango Biotech), and were viewed on Nikon ECLIPSE E200 microscope (Nikon Instruments).
Assessment of ITGA7 expression
A semi‐quantitative scoring method was used to assess the expression of ITGA7 in the tumor and paired adjacent tissues according to IHC staining, which was based on the average intensity and percentage of positively stained tumor cells.11 The intensity of positively stained tumor cells was scored as follows: 0 (no staining), 1 (weak staining), 2 (moderate staining), and 3 (strong staining), and the percentage of positively stained tumor cells was scored as 0, 0%; 1, <25%; 2, 26 ~ 50%; 3, 51 ~ 75%; 4, >75%. The final IHC score was calculated by multiplying of staining intensity score and the proportion score. High expression of ITGA7 was defined as the total IHC score > 3, and the low expression of ITGA7 was defined as the total IHC score ≤ 3.
Cell culture
HumanNSCLC cell lines including NCI‐H358, NCI‐H1650, A549, HCC‐827, and NCI‐H1299 were obtained from Cell Bank of the Chinese Academy of Sciences (Chinese Academy of Sciences). Normal human lung epithelial cell line BEAS‐2B was purchased from American Type Culture Collection (ATCC). NCI‐H358, NCI‐H1650, HCC‐827, NCI‐H1299, and BEAS‐2B cell lines were cultured in 90% Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco) with 10% fetal bovine serum (FBS) (Gibco). A549 cell line was cultured in 90% Ham's F‐12K (Kaighn's) Medium with 10% FBS (Gibco). All cells were cultured in a humidified atmosphere of 95% air and 5% CO2 at 37˚C.
Determination of ITGA7 expression in cell lines
The mRNA and protein expressions of ITGA7 in NSCLC cell lines were determined by real‐time quantitative polymerase chain reaction (RT‐qPCR) and Western blot. Normal human lung epithelial cell line BEAS‐2B was used as control.
Transfection and detection
The overexpression plasmids and knockdown plasmids of ITGA7 were constructed by Shanghai Qeejen Bio‐Tech Co., Ltd (Shanghai Qeejen Bio‐Tech Co., Ltd) with pEX‐2 vector (NTCC) or pGPH1 (NTCC) vector, respectively. PEX‐2 vector and pGPH1 vector cloned with nonsense DNA fragment were also constructed as overexpression control plasmid and knockdown control plasmid. After construction, ITGA7 overexpression plasmid, overexpression control plasmid, ITGA7 knockdown plasmid, and knockdown control plasmid were transfected into A549 cells with the use of HilyMax (Dojindo), respectively. A549 cells transfected with overexpression control plasmid were named as NC‐over group; A549 cells transfected with ITGA7 overexpression plasmid were named as ITGA7‐over group; A549 cells transfected with knockdown control plasmid were named as NC‐knock group; and A549 cells transfected with ITGA7 knockdown plasmid were named as ITGA7‐knock group, respectively. After transfection, the expressions of ITGA7 mRNA and protein in A549 cells of each group were detected by qPCR and Western blot at 24 hours. Cell proliferation detection was performed with Cell Counting Kit‐8 (CCK‐8) at 0 hour, 24 hours, 48 hours, and 72 hours. Cell apoptosis rate was detected by Annexin V (AV)/propidium iodide (PI) assay at 48 hours. The percentages of CD133‐positive cells (CD133+) and CD44‐positive cells (CD44+) were determined by flow cytometry at 48 hours.
Real‐time quantitative polymerase chain reaction
Total RNA was extracted using RNeasy Protect Mini Kit (Qiagen), followed by quality control with gel electrophoresis, and cDNA was reversely transcribed using RT‐PCR Quick Master Mix (Toyobo). The fluorescent quantification was conducted using SYBR® Green Realtime PCR Master Mix (Toyobo) in ABI 7900HT Real‐Time PCR System 7900 (Applied Biosystems). The thermal cycle parameters were as follows: 5 minutes under 95°C; 30 seconds under 94°C, and then 30 seconds under 61°C for 40 cycles. GAPDH was used as an internal reference, and ITGA7 mRNA expression was calculated by the method of 2−ΔΔCt. Primers were as follows: ITGA7, forward primer (5′‐3′): GCCACTCTGCCTGTCCAATG; reverse primer (5′‐3′): CGGAGGTGCTAAGGATGAGGTA; GAPDH, forward primer (5′‐3′): GACCACAGTCCATGCCATCAC; reverse primer (5′‐3′): ACGCCTGCTTCACCACCTT.
Western blot
Total protein was extracted by RIPA Lysis and Extraction Buffer (Thermo fisher scientific) and quantified using EZQ™ Protein Quantitation Kit (Invitrogen). After that, protein was mixed with E‐PAGE™ Loading Buffer (Invitrogen) and then loaded to NuPAGE™ 4%‐12% Bis‐Tris Protein Gels (Invitrogen) for electrophoresis. The separated protein was transferred to Tropifluor™ PVDF (polyvinylidene fluoride membrane) Membrane (Invitrogen) and blocked with 5% non‐fat‐dried milk in PBST for 1 hour at 37°C. The membrane was subsequently incubated in primary antibodies (ITGA7: Mouse monoclonal to ITGA7 [1:500; Santa Cruz Biotechnology]; GAPDH: Mouse monoclonal to GAPDH [1:5000; Abcam]) under 4°C overnight, and then in the secondary antibodies (Goat Anti‐Mouse IgG H&L (HRP) (1:10000; Abcam)) in 37°C for 1 hours. Novex™ECL Chemiluminescent Substrate Reagent Kit (Invitrogen) was used to illuminate the protein, the bands were visualized on X‐ray film (Kodak) and imaged by E‐Gel™ Imager System (Thermo fisher scientific).
Cell counting kit‐8 assay
A total of 10 μL CCK‐8 reagent (Dojindo) and 90 μL RPMI 1640 medium were added into the 96‐well plate, which was previous planted with A549 cells and incubated at 37°C under 95% air and 5% CO2. Then, cell proliferation ability was evaluated by the optical density (OD) value under ELx800 microplate reader (BioTek).
AV/PI assay
At 48 hours after transfection, cells were collected and suspended in phosphate buffer saline (PBS) (Sigma), then 5 μL AV and 10 μL PI (R&D) were added to the cell suspension and incubated for 15 minutes followed by the flow cytometry using BD FACS Canto II (BD). Flowjo Software 7.6 (FlowJo‐LLC) was used for data analysis.
CD44+CD133+ cell proportion detection
The percentage of CD44+CD133+ cells at 48 hours after transfection were detected by flow cytometry. At 48 hours after transfection, cells of each group were harvested and counted under an inverted microscope (Olympus). Pre‐rinsed cells were, respectively, incubated with Alexa Fluor® 647 conjugated CD133Mouse mAb (Flow Specific) (1:50 dilution, CST) and FITC conjugated CD44Rat mAb (1:100 dilution, CST) in incubation buffer at 37°C for an hour. Then, cells were collected, suspended in PBS, and were detected with FACS Canto II (BD). Data were analyzed by Flowjo Software 7.6 (FlowJo‐LLC).
Statistical analysis
Statistical analyses were performed using SPSS 22.0 software (IBM), and figures were plotted using GraphPad Prism 7.00 (GraphPad Software) and Flowjo Software 7.6 (FlowJo‐LLC). Data were presented as mean ± standard deviation (SD) or count (percentage). Comparison between two independent samples was determined by t test or Chi‐square test; comparison between paired samples was determined by the McNemar's test; comparison among multiple independent samples was determined by one‐way analysis of variance (ANOVA) followed by Dunnett's multiple comparisons test. The DFS and OS were illustrated by Kaplan‐Meier curve. The difference of DFS and OS between groups was determined using Log‐rank test. P value < 0.05 was considered as significant.
RESULTS
Baseline characteristics
The mean age of total NSCLCpatient was 62.0 ± 10.7 years with 179 (45.1%) patients aged ≤60 years, and 218 (54.9%) patients aged >60 years (Table 1). As for gender, 297 (74.8%) patients were males and 100 (25.2%) patients were females. The detailed information about tumor size, lymph node metastasis, pathological differentiation, and TNM stage were listed in Table 1.
Table 1
Characteristics of total patients, ITGA7 high expression, and ITGA7 low expression patients
Items
Total patients (N = 397)
ITGA7 low expression patients (n = 174)
ITGA7 high expression patients (n = 223)
P value
Age (y), mean ± SD
62.0 ± 10.7
62.3 ± 10.9
61.7 ± 10.5
0.583
Age, No. (%)
≤60 y
179 (45.1)
82 (47.1)
97 (43.5)
0.471
>60 y
218 (54.9)
92 (52.9)
126 (56.5)
Gender, No. (%)
Male
297 (74.8)
124 (71.3)
173 (77.6)
0.150
Female
100 (25.2)
50 (28.7)
50 (22.4)
Tumor size (cm), mean ± SD
5.4 ± 2.1
5.0 ± 2.0
5.7 ± 2.2
0.001
Tumor size, No. (%)
≤5 cm
221 (55.7)
109 (62.6)
112 (50.2)
0.013
>5 cm
176 (44.3)
65 (37.4)
111 (49.8)
Lymph nodes metastasis, No. (%)
No
244 (61.5)
116 (66.7)
128 (57.4)
0.060
Yes
153 (38.5)
58 (33.3)
95 (42.6)
Pathological differentiation, No. (%)
Well/moderate
304 (76.6)
143 (82.2)
161 (72.2)
0.020
Poor
93 (23.4)
31 (17.8)
62 (27.8)
TNM stage, No. (%)
I/II
257 (64.7)
125 (71.8)
132 (59.2)
0.009
III
140 (35.3)
49 (28.2)
91 (40.8)
Comparisons were determined by t test or Chi‐square test.
Abbreviations: ITGA7, integrin subunit alpha 7; SD, standard deviation.
Characteristics of total patients, ITGA7 high expression, and ITGA7 low expression patientsComparisons were determined by t test or Chi‐square test.Abbreviations: ITGA7, integrin subunit alpha 7; SD, standard deviation.
Expression of ITGA7 in tumor tissues and adjacent tissues
Examples about the expression of ITGA7 in tumor tissues and adjacent tissues were shown (Figure 1A). There were 56.2% of patients whose tumor tissues presented ITGA7 high expression, and 43.8% of patients whose tumor tissues presented ITGA7 low expression. Regarding adjacent tissues, 34.8% of patients' adjacent tissues were with ITGA7 high expression and 65.2% of patients' adjacent tissues were with ITGA7 low expression (Figure 1B). Further analysis illustrated that ITGA7 was upregulated in tumor tissues compared with the adjacent tissues in NSCLCpatients (P < 0.001).
Figure 1
Expression of ITGA7. A, Example of IHC measurement of ITGA7 in tumor tissues and adjacent tissues. B, Percentage of patients with ITGA7 high or low expression in their tumor tissues and adjacent tissues. Comparison between paired samples was determined by the McNemar's test, and P < 0.05 was considered significant. ITGA7, Integrin alpha 7; IHC, immunohistochemistry
Expression of ITGA7. A, Example of IHC measurement of ITGA7 in tumor tissues and adjacent tissues. B, Percentage of patients with ITGA7 high or low expression in their tumor tissues and adjacent tissues. Comparison between paired samples was determined by the McNemar's test, and P < 0.05 was considered significant. ITGA7, Integrin alpha 7; IHC, immunohistochemistry
Correlation of ITGA7 with clinicopathological characteristics
Total NSCLCpatients were divided into ITGA7 low expression (N = 174) and ITGA7 high expression (N = 223) patients according to the cutoff value of IHC score (Table 1). No difference in age, gender, or lymph node metastasis was observed between the two groups of patients (all P > 0.05). However, patients with ITGA7 high expression presented larger tumor size, poorer pathological differentiation, and more advanced TNM stage compared with patients with ITGA7 low expression (all P < 0.05).
Correlation of ITGA7 with survival profiles
The DFS was lower in ITGA7 high expression patients compared with ITGA7 low expression patients (P < 0.001; Figure 2A). And OS was also decreased in ITGA7 high expression patients compared with ITGA7 low expression patients (P = 0.002; Figure 2B).
Figure 2
Survival profiles between patients with ITGA7 high expression and low expression. A, Comparison of DFS between patients with ITGA7 high expression and low expression. B, Comparison of OS between patients with ITGA7 high expression and low expression. The DFS and OS were illustrated by Kaplan‐Meier curve. The difference of DFS and OS between groups was determined using Log‐rank test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7; DFS, disease‐free survival; OS, overall survival
Survival profiles between patients with ITGA7 high expression and low expression. A, Comparison of DFS between patients with ITGA7 high expression and low expression. B, Comparison of OS between patients with ITGA7 high expression and low expression. The DFS and OS were illustrated by Kaplan‐Meier curve. The difference of DFS and OS between groups was determined using Log‐rank test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7; DFS, disease‐free survival; OS, overall survival
Expression of ITGA7 in NSCLC cell lines
The relative mRNA expression of ITGA7 was increased in NCI‐H1650 (P < 0.001), A549 (P < 0.001), HCC‐827 (P < 0.05), and NCI‐H1299 (P < 0.01) cell lines but similar in NCI‐H358 cell line compared with human normal lung epithelial cell line BEAS‐2B (P > 0.05; Figure 3A). In addition, the protein expression of ITGA7 was increased in NCI‐H1650, A549, HCC‐827, and NCI‐H1299 cell lines but similar in NCI‐H358 cells compared with BEAS‐2B cells as well (Figure 3B).
Figure 3
Expression of ITGA7 in NSCLC cell lines. A, Comparison of ITGA7 mRNA expression between NSCLC cell lines and human normal lung epithelial cell line BEAS‐2B. B, Comparison of ITGA7 protein expression between NSCLC cell lines and human normal lung epithelial cell line BEAS‐2B. Comparison was determined by one‐way ANOVA followed by Dunnett's multiple comparisons test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7; NSCLC, non–small‐cell lung cancer; ANOVA, analysis of variance
Expression of ITGA7 in NSCLC cell lines. A, Comparison of ITGA7 mRNA expression between NSCLC cell lines and human normal lung epithelial cell line BEAS‐2B. B, Comparison of ITGA7 protein expression between NSCLC cell lines and human normal lung epithelial cell line BEAS‐2B. Comparison was determined by one‐way ANOVA followed by Dunnett's multiple comparisons test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7; NSCLC, non–small‐cell lung cancer; ANOVA, analysis of variance
The effect of ITGA7 on cell proliferation, apoptosis, and stemness in A549 cells
The relative mRNA expression as well as protein expression of ITGA7 were increased by ITGA7 overexpression while decreased by ITGA7 knockout (both P < 0.001), indicating successful transfections (Figure 4A, 4B). Cell proliferation was promoted by ITGA7 overexpression while suppressed by ITGA7 knockout at 48 hours (P < 0.05) and 72 hours (P < 0.01) after transfection (Figure 4C). Cell apoptosis was reduced by ITGA7 overexpression and enhanced by ITGA7 knockout at 48 hours after transfection (all P > 0.05; Figure 4D, 4E). In addition, the percentage of CD44+CD133+ cells was raised by ITGA7 overexpression (P < 0.01) but reduced by ITGA7 knockout (P < 0.05) at 48 hours after transfection (Figure 4F, 4G).
Figure 4
ITGA7 promoted cell proliferation, suppressed apoptosis, and enhanced stemness in A549 cells. A, ITGA7 mRNA expression after transfection. B, ITGA7 protein expression after transfection. C, Cell proliferation after transfection. D, E, Cell apoptosis after transfection. F, G, Proportion of CD133+CD44+ cells after transfection. Comparison between two independent samples was determined by t test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7
ITGA7 promoted cell proliferation, suppressed apoptosis, and enhanced stemness in A549 cells. A, ITGA7 mRNA expression after transfection. B, ITGA7 protein expression after transfection. C, Cell proliferation after transfection. D, E, Cell apoptosis after transfection. F, G, Proportion of CD133+CD44+ cells after transfection. Comparison between two independent samples was determined by t test. P value < 0.05 was considered as significant. ITGA7, Integrin alpha 7
DISCUSSION
Integrin alpha 7 was observed to be correlated with poor pathological differentiation, large tumor size, advanced TNM stage, and unfavorable survival profiles in NSCLCpatients. In vitro experiments displayed that ITGA7 promoted cell proliferation, inhibited cell apoptosis, and increased the percentage of CD44+CD133+ cells in A549 cells.Integrins are adhesion receptors that not only connect cells to the extracellular matrix or counter receptors on other cells, but also modulate the downstream signaling transduction that are responsible for tumor formation and progression.12, 13, 14, 15 As for ITGA7, its implication in cancers varies from malignancy types. For example, ITGA7 is previously shown to act as tumor suppressor in prostate cancer, mesothelioma, melanoma, and leiomyosarcoma through preventing cell proliferation and inducing cell death.16, 17, 18, 19 In the contrast, ITGA7 promotes growth and invasiveness of glioblastoma stem‐like cells, and inhibition of ITGA7 leads to tumor engraftment of glioblastoma; it correlates with poor differentiation and lymph node metastasis in esophageal squamous cell carcinomapatients.8, 20 In addition, activation of ITGA7 is correlated with metastasis, recurrence, and reduced survival in colorectal cancerpatients.21 Although the function of ITGA7 is still unclear in NSCLC, there has been study illustrating that the activation of integrin beta 1 (ITGB1), with whom ITGA7 binds and forms a heterodimeric adhesion receptor, and its downstream signaling molecules FAK and ERK promote resistance to apoptosis, enhance cell migration, and invasion of lung cancer cells.22 In addition, the FAK/AKT singling pathway, which is activated by ITGA7 is responsible for lung cancer cell migration and invasion as well.9 These suggest the potential tumor promotive role of ITGA7 in lung cancer. And in the present work, we discovered that ITGA7 was upregulated in NSCLCtumor tissues compared with adjacent tissues and was correlated with poor pathological differentiation, large tumor size, and advanced TNM stage in NSCLCpatients, which was in line with the previous evidence in glioblastoma and esophageal squamous cell carcinoma. The following are the possible explanations. ITGA7 along with ITGB1 forms an adhesion receptor, which activates the FAK/AKT signaling pathway and the subsequent downstream genes that regulate cell cycle, thus, promotes proliferation and invasion of NSCLC cells, and thereby correlates with larger tumor size and advanced TNM stage in NSCLCpatients. Meanwhile, ITGA7 may enhance the stemness of cancer cells, thereby lead to poor differentiation of NSCLCpatients, which is validated in our following cellular experiments. Besides, the impact of ITGA7 on survival profiles of NSCLCpatients was evaluated in our study, which observed that patients with ITGA7 high expression achieved poorer survival profiles compared with patients with ITGA7 low expression. This can be due to that ITGA7 is associated with poor pathological differentiation, large tumor size, and advanced TNM stage in NSCLCpatients, which are well‐studied risk factors for prognosis. In addition, ITGA7 may facilitate the stemness of cancer cells and development of drug resistance; hence, results in poor treatment response and high recurrence, which contributes to unfavorable survival profiles in NSCLCpatients.23 And this was consistent with a previous study showing that ITGA7 is negatively correlated with survival profiles in glioblastomapatients as well.8 However, the number of NSCLCpatients in this study was relatively small, thus a larger sample size was needed to further validate our findings.Recent studies have revealed that integrin signaling drives cell proliferation and induces multiple stem cell functions, including tumor initiation, epithelial plasticity, metastatic reactivation, and resistance to targeted therapies. As a typical example, ITGA7 and CD90 are co‐expressed in esophageal squamous cell carcinoma cells, and it is associated with elevated expression of epithelial‐mesenchymal transition features, as well as increased abilities to self‐renew, differentiate and resist chemotherapy.20 In glioblastoma, ITGA7 facilitates cell proliferation and invasiveness of glioblastoma stem‐like cells and inhibiting of ITGA7 results in delay in cell invasion.8 Additionally, ITGA7 drives resistance to rapamycin (mTOR) inhibitor temsirolimus in metastatic renal cell carcinoma cells.23 These in vitro studies illuminate the cellular function of ITGA7 in several cancers, while the effect of ITGA7 on cell activity in NSCLC remains to be explored. In our cellular experiments, we found that ITGA7 promoted cell proliferation, inhibited cell apoptosis, and increased the percentage of CD44+CD133+ cells. And here are several possible reasons for that. ITGA7 may activate the mitotic cycle, enhance the adhesion and motility of cancer cells, thereby promotes proliferation in NSCLC cells. It is also shown to induce AKT phosphorylation and protect the mitochondria from collapse, hence stops cytochrome c release to the cytoplasm and caspase‐9, caspase‐3, and PARP cleavage, which explains why ITGA7 suppresses cell apoptosis. Additionally, ITGA7 increases the percentage of CD44+CD133+ cells, and this may be due to that ITGA7 activates stemness properties via FAK/MAPK/ERK signaling pathway, hence raises the percentage of CD44+CD133+ cells.24, 25 However, this needs further validation in NSCLC cell lines.24, 25 The in vitro data implied the oncogenic role of ITGA7 in NSCLC cells and supported our clinical findings in NSCLCpatients.In conclusion, ITGA7 correlates with poor pathological differentiation, large tumor size, advanced TNM stage, and unfavorable survival profiles, and it promotes cell proliferation, stemness, but suppresses cell apoptosis in NSCLC.
Authors: Ulla von Verschuer; Roland Schnell; Hans Werner Tessen; Jochen Eggert; Adrian Binninger; Lisa Spring; Martina Jänicke; Norbert Marschner Journal: Lung Cancer Date: 2017-09-12 Impact factor: 5.705
Authors: Kandice R Levental; Hongmei Yu; Laura Kass; Johnathon N Lakins; Mikala Egeblad; Janine T Erler; Sheri F T Fong; Katalin Csiszar; Amato Giaccia; Wolfgang Weninger; Mitsuo Yamauchi; David L Gasser; Valerie M Weaver Journal: Cell Date: 2009-11-25 Impact factor: 41.582