Literature DB >> 31393263

Generation of human hepatic progenitor cells with regenerative and metabolic capacities from primary hepatocytes.

Takeshi Katsuda1, Juntaro Matsuzaki1, Tomoko Yamaguchi1,2, Yasuhiro Yamada3, Marta Prieto-Vila1, Kazunori Hosaka1, Atsuko Takeuchi4, Yoshimasa Saito2, Takahiro Ochiya1,5.   

Abstract

Hepatocytes are regarded as the only effective cell source for cell transplantation to treat liver diseases; however, their availability is limited due to a donor shortage. Thus, a novel cell source must be developed. We recently reported that mature rodent hepatocytes can be reprogrammed into progenitor-like cells with a repopulative capacity using small molecule inhibitors. Here, we demonstrate that hepatic progenitor cells can be obtained from human infant hepatocytes using the same strategy. These cells, named human chemically induced liver progenitors (hCLiPs), had a significant repopulative capacity in injured mouse livers following transplantation. hCLiPs redifferentiated into mature hepatocytes in vitro upon treatment with hepatic maturation-inducing factors. These redifferentiated cells exhibited cytochrome P450 (CYP) enzymatic activities in response to CYP-inducing molecules and these activities were comparable with those in primary human hepatocytes. These findings will facilitate liver cell transplantation therapy and drug discovery studies.
© 2019, Katsuda et al.

Entities:  

Keywords:  cell biology; cytochrome P450; hepatocyte; human; liver progenitor cell; liver repopulation; mouse; regenerative medicine; stem cells; transplantation

Mesh:

Year:  2019        PMID: 31393263      PMCID: PMC6731094          DOI: 10.7554/eLife.47313

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.713


Introduction

Expansion of functional human hepatocytes is a prerequisite for liver regenerative medicine. Human hepatocytes are currently regarded as the only competent cell source for transplantation therapy (Fisher and Strom, 2006); however, their availability is limited due to a shortage of donors. Moreover, the therapeutic application of hepatocytes is hampered by their inability to proliferate in vitro. To overcome this, researchers have sought to generate expandable cell sources as alternatives to primary hepatocytes. Such cell sources include embryonic stem cell- and induced pluripotent stem-cell-derived hepatic cells (Carpentier et al., 2014; Liu et al., 2011; Takebe et al., 2013; Woo et al., 2012; Zhu et al., 2014), lineage-converted hepatic cells (induced hepatic cells; (Du et al., 2014; Huang et al., 2014), and facultative liver stem/progenitor cells (LPCs) residing in adult liver tissue (Huch et al., 2015). However, while primary hepatocytes efficiently repopulate injured mouse livers (repopulation indexes (RIs) > 50%), the repopulation efficiency of these laboratory-generated hepatocytes is limited, with reported RIs generally less than 5% (reviewed in Rezvani et al., 2016). Researchers have also attempted to expand primary human hepatocytes (PHHs) in vitro. Several studies reported the expansion of these cells (Hino et al., 1999; Shan et al., 2013; Utoh et al., 2008; Walldorf et al., 2004; Yamasaki et al., 2006), suggesting that they are potentially applicable for transplantation therapy. However, the growth rate and proliferative lifespan of PHHs are limited. For example, Yoshizato’s group reported that PHHs can be cultured for several passages, but their growth rate is slow (population doubling time of 20–300 days) (Yamasaki et al., 2006). This finding indicates that culture of PHHs must be improved for the clinical application of these cells. We recently reported that a cocktail of small molecule signaling inhibitors reprograms rodent adult hepatocytes into culturable LPCs, named chemically induced liver progenitors (CLiPs) (Katsuda et al., 2017). Notably, rat CLiPs extensively repopulate chronically injured mouse livers without causing any tumorigenic features. Here, using the same strategy, we demonstrate that human infant hepatocytes can be also converted into proliferative LPC-like cells, which are named human CLiPs.

Results

Small molecules support expansion of PHHS

In a pilot study, we tested whether the combination of Y-27632 (Y), A-83–01 (A), and CHIR99021 (C), the chemical cocktail used to reprogram rodent hepatocytes, also induced proliferation of commercially available cryopreserved adult PHHs (APHHs) (donor information is summarized in (Table 1). In contrast with the basal culture medium (small hepatocyte medium (SHM)), culture in YAC-containing SHM (SHM+YAC) induced the proliferation of cells that morphologically resembled epithelial cells (Figure 1A). These cells were small and had a higher nucleus-to-cytoplasm ratio than hepatocytes, which is a typical morphological feature of LPCs. When colonies became densely packed, rat and mouse CLiPs exhibited a compact polygonal cell shape delimited by sharply defined refractile borders with bright nuclei in phase contrast images (Figure 1B and C). However, unlike rat and mouse CLiPs, the morphology of human cells did not clearly change after colonies became densely packed (Figure 1A). Although we did not perform further characterization, these proliferating cells likely arose from non-hepatic cells, such as biliary epithelial cells (BECs) or so-called liver epithelial cells, the origins of which are not well-defined (Mitaka et al., 1999). Thus, we speculated that human hepatocytes require additional proliferative stimuli. Therefore, we tested the ability of fetal bovine serum (FBS) to support the proliferation of these cells. One of three lots of APHHs formed proliferative and densely packed colonies, and exhibited a hepatocytic morphology upon culture in medium supplemented with YAC and 10% FBS (FYAC) (Figure 1D). By contrast, all three lots of APHHs formed proliferative colonies with hepatic morphologies upon culture in medium supplemented with AC and 10% FBS (FAC) (Figure 1E). However, the proliferative capacity of these hepatic colony-forming cells was limited, and the number of these cells markedly decreased after the first passage, while non-parenchymal cells (NPCs) with non-hepatic morphologies became the dominant population (data not shown).
Table 1.

Donor information of primary human hepatocytes (PHHs) used in this study.

Cell typeIPHHIPHHIPHHIPHHIPHHAPHHAPHHAPHHAPHHAPHH
LotFCLDUXJFCMRW187273HC7-4HC5-25HC1-14HC3-14187271
Age10 mo8 mo1 yr11 mo2 yr7 yr56 yr55 yr45 yr26 yr
SexFemaleMaleMaleMaleMaleMaleMaleMaleMaleMale
RaceHispanicCaucasianCaucasianCaucasianCaucasianCaucasianCaucasianCaucasianCaucasianCaucasian
Cause of deathAnoxia/drowningAnoxia/cardiovascularAnoxia/second to blunt injuryAsphyxiationN/AAnoxiaCerebrovascular AccidentAnoxiaCerebrovascular AccidentN/A
CMV---+N/A++--N/A
HIV----------
HBV-++-------
HCV----------
EBV-N/AN/AN/AN/AN/AN/AN/AN/AN/A
RPR-N/A--N/AN/AN/AN/AN/AN/A
HTLVN/AN/AN/A-N/AN/AN/A--N/A

IPH: Infant primary human hepatocyte; APH: adult primary human hepatocyte; CMV: cytomegarovirus; HIV: human immunodeficiency virus; HBV: hepatitis B virus; HCV: hepatitis C virus; EBV: Epstein-Barr virus; RPR: rapid plasma reagin; HTLV: human T-cell leukemia virus; N/A: information not available.

Figure 1.

Morphological changes of hepatocytes in response to small molecule stimuli with/without FBS.

(A) Phase contrast images of APHHs cultured in the presence of YAC, which are used to obtain rat and mouse CLiPs. Insets indicate representative magnified images. (B) Phase contrast images of rat CLiPs obtained by culture in the presence of YAC. The inset shows cells that spontaneously differentiated into mature hepatocyte (MH)-like cells in densely packed regions. (C) Phase contrast images of mouse CLiPs obtained by culture in the presence of YAC. The inset shows cells that spontaneously differentiated into MH-like cells in densely packed regions. (D) Phase contrast images of APHHs cultured in the presence of YAC and 10% FBS (FYAC). The inset shows cells that spontaneously differentiated into MH-like cells in densely packed regions. (E) Phase contrast images of APHHs cultured in FAC. Insets show cells that spontaneously differentiated into MH-like cells in densely packed regions.

Donor information of primary human hepatocytes (PHHs) used in this study. IPH: Infant primary human hepatocyte; APH: adult primary human hepatocyte; CMV: cytomegarovirus; HIV: human immunodeficiency virus; HBV: hepatitis B virus; HCV: hepatitis C virus; EBV: Epstein-Barr virus; RPR: rapid plasma reagin; HTLV: human T-cell leukemia virus; N/A: information not available.

Morphological changes of hepatocytes in response to small molecule stimuli with/without FBS.

(A) Phase contrast images of APHHs cultured in the presence of YAC, which are used to obtain rat and mouse CLiPs. Insets indicate representative magnified images. (B) Phase contrast images of rat CLiPs obtained by culture in the presence of YAC. The inset shows cells that spontaneously differentiated into mature hepatocyte (MH)-like cells in densely packed regions. (C) Phase contrast images of mouse CLiPs obtained by culture in the presence of YAC. The inset shows cells that spontaneously differentiated into MH-like cells in densely packed regions. (D) Phase contrast images of APHHs cultured in the presence of YAC and 10% FBS (FYAC). The inset shows cells that spontaneously differentiated into MH-like cells in densely packed regions. (E) Phase contrast images of APHHs cultured in FAC. Insets show cells that spontaneously differentiated into MH-like cells in densely packed regions. Next, considering the previous finding that PHHs derived from young donors are optimal for in vitro expansion (Walldorf et al., 2004; Yamasaki et al., 2006), we tested whether infant PHHs (IPHHs) expanded more efficiently in the presence of small molecules and FBS. Using IPHHs derived from a 10-month-old donor (lot FCL), we performed a mini-screen using all possible combinations of Y, A and C in 10% FBS-supplemented SHM. The water-soluble tetrazolium salt-based (WST) assay demonstrated that these cells proliferated in the presence of A, YA, AC and YAC (Figure 2A). Consistent with the observations made in APHHs (Figure 1E), these cells proliferated most efficiently in FAC and thus we used this medium in all subsequent experiments. Robust proliferation of hepatocytes was not supported by culture in the presence of AC or FBS alone, but was synergistically supported by culture in the presence of both AC and FBS (Figure 2B). Although proliferating cells cultured in FAC did not morphologically resemble hepatocytes when the cell density was low, they spontaneously acquired a hepatocyte-like morphology as colonies became densely packed (Figure 2C). This observation strongly suggests that human proliferative cells cultured in FAC more closely resembled rodent CLiPs than those cultured in the presence of YAC. Unlike APHHs, IPHHs proliferated efficiently and became the predominant population over 2 weeks of culture. Two other lots of IPHHs (lot DUX from an 8-month-old donor and lot JFC from a 1-year-old donor) (Table 1) also proliferated in this culture condition, although the proliferative capacity varied among the lots: FCL, DUX and JFC proliferated 49.2 ± 9.34 (at day 14), 46.2 ± 2.12 (at day 14) and 3.66 ± 0.321 (at day 12) folds, respectively (mean ± SEM, determined by two repeated experiments for each lot). We also confirmed by microscopy that FAC enabled two more donors (11 months and 2-year-old)-derived IPHHs and one juvenile donor (7-year-old)-derived hepatocytes to proliferate and spontaneously change their morphologies to hepatocyte-like ones in the densely packed region of the proliferating colonies (Figure 2—figure supplement 1).
Figure 2.

AC together with FBS support the expansion of IPHHs.

(A) WST assay assessing the effects of various combinations of Y, A, and C together with 10% FBS on proliferation of 8-month-old IPHHs (lot FCL). Absorbance at 450 nm was determined at D14 and normalized against that at D0. Data are the mean ± SEM of two repeated experiments. (B) WST assay assessing the effects of AC and FBS on proliferation of IPHHs (lot FCL). Absorbance at 450 nm was determined at D14 and normalized against that at D0. Data are the mean ± SD of three technical replicates. (C) Phase contrast images showing the morphological changes of IPHHs (lot FCL) upon culture in FAC. Inset images show spontaneous hepatic differentiation in densely packed regions at D14. (D) Flow cytometric analysis of surface expression of LPC markers. Results of cells from lot FCL are shown as representative data (see also Figure 2—figure supplement 2A). (E) Heatmap showing expression of BEC/LPC marker genes, as assessed by microarray analysis. Each element represents normalized (log2) expression, as indicated by the color scale. Data are from three lots and two repeated experiments. Hierarchical clustering was performed based on Euclidean distance. (F) Expression levels of genes that were differentially expressed between cells cultured in the presence of FBS and those cultured in FAC are shown as mean ± SEM of three lots per time point (each value is determined as the mean of 2 repeated experiments for each lot). p-Values were calculated by the linear mixed model to account for the covariance structure due to repeated measures at different time points. The meanings of the various colors are described in the figure. (G) GSEA demonstrating enrichment of hepatic function-related gene sets in cells cultured in FAC in comparison with cells cultured in the presence of FBS at D14. p-Values indicate nominal p-values.

Phase contrast images of PHHs obtained from infant donors (four lots) and a juvenile donor (one lot). Regions with spontaneous hepatic differentiation are magnified.

(A) Flow cytometry of LPC surface markers for hCLiPs derived from lots DUX and JFC PHHs. (B) Flow cytometry of LPC surface markers for cryopreserved PHHs. The cells were thawed and stained with the designated antibodies before plating. To confirm that the surface proteins are preserved after a freeze/cell cycle, cells were stained with an antibody against DPP4, a general hepatocyte marker, as a positive control. (C) Flow cytometry of LPC surface markers in mouse adult hepatocytes. Primary hepatocytes were isolated from a wild type (WT) B6 mouse as a control or a RosaYFP/YFP mouse, which received retro-orbital injection of AAV-TBG-cre for genetically labeling the hepatocytes 1 month prior to cell isolation.

(A) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC in comparison with cells cultured in the presence of FBS at D14. (B) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC at D14 in comparison with D1 hepatocytes. (C) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in the presence of FBS at D14 in comparison with D1 hepatocytes.

Figure 2—figure supplement 1.

Proliferative colonies observed in infant and juvenile PHHs.

Phase contrast images of PHHs obtained from infant donors (four lots) and a juvenile donor (one lot). Regions with spontaneous hepatic differentiation are magnified.

AC together with FBS support the expansion of IPHHs.

(A) WST assay assessing the effects of various combinations of Y, A, and C together with 10% FBS on proliferation of 8-month-old IPHHs (lot FCL). Absorbance at 450 nm was determined at D14 and normalized against that at D0. Data are the mean ± SEM of two repeated experiments. (B) WST assay assessing the effects of AC and FBS on proliferation of IPHHs (lot FCL). Absorbance at 450 nm was determined at D14 and normalized against that at D0. Data are the mean ± SD of three technical replicates. (C) Phase contrast images showing the morphological changes of IPHHs (lot FCL) upon culture in FAC. Inset images show spontaneous hepatic differentiation in densely packed regions at D14. (D) Flow cytometric analysis of surface expression of LPC markers. Results of cells from lot FCL are shown as representative data (see also Figure 2—figure supplement 2A). (E) Heatmap showing expression of BEC/LPC marker genes, as assessed by microarray analysis. Each element represents normalized (log2) expression, as indicated by the color scale. Data are from three lots and two repeated experiments. Hierarchical clustering was performed based on Euclidean distance. (F) Expression levels of genes that were differentially expressed between cells cultured in the presence of FBS and those cultured in FAC are shown as mean ± SEM of three lots per time point (each value is determined as the mean of 2 repeated experiments for each lot). p-Values were calculated by the linear mixed model to account for the covariance structure due to repeated measures at different time points. The meanings of the various colors are described in the figure. (G) GSEA demonstrating enrichment of hepatic function-related gene sets in cells cultured in FAC in comparison with cells cultured in the presence of FBS at D14. p-Values indicate nominal p-values.
Figure 2—figure supplement 2.

Characterization of FAC-cultured proliferative human hepatic cells.

(A) Flow cytometry of LPC surface markers for hCLiPs derived from lots DUX and JFC PHHs. (B) Flow cytometry of LPC surface markers for cryopreserved PHHs. The cells were thawed and stained with the designated antibodies before plating. To confirm that the surface proteins are preserved after a freeze/cell cycle, cells were stained with an antibody against DPP4, a general hepatocyte marker, as a positive control. (C) Flow cytometry of LPC surface markers in mouse adult hepatocytes. Primary hepatocytes were isolated from a wild type (WT) B6 mouse as a control or a RosaYFP/YFP mouse, which received retro-orbital injection of AAV-TBG-cre for genetically labeling the hepatocytes 1 month prior to cell isolation.

Proliferative colonies observed in infant and juvenile PHHs.

Phase contrast images of PHHs obtained from infant donors (four lots) and a juvenile donor (one lot). Regions with spontaneous hepatic differentiation are magnified.

Characterization of FAC-cultured proliferative human hepatic cells.

(A) Flow cytometry of LPC surface markers for hCLiPs derived from lots DUX and JFC PHHs. (B) Flow cytometry of LPC surface markers for cryopreserved PHHs. The cells were thawed and stained with the designated antibodies before plating. To confirm that the surface proteins are preserved after a freeze/cell cycle, cells were stained with an antibody against DPP4, a general hepatocyte marker, as a positive control. (C) Flow cytometry of LPC surface markers in mouse adult hepatocytes. Primary hepatocytes were isolated from a wild type (WT) B6 mouse as a control or a RosaYFP/YFP mouse, which received retro-orbital injection of AAV-TBG-cre for genetically labeling the hepatocytes 1 month prior to cell isolation.

Cell-cycle-related gene expression analysis by GSEA.

(A) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC in comparison with cells cultured in the presence of FBS at D14. (B) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC at D14 in comparison with D1 hepatocytes. (C) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in the presence of FBS at D14 in comparison with D1 hepatocytes.

Characterization of proliferating cells cultured in FAC

These proliferating cells expressed multiple surface markers of LPCs, including EPCAM, CD44, PROM1 (also known as CD133), CD24, and ITGA6 (Figure 2D, Figure 2—figure supplement 2A). It should be noted that PHHs before plating minimally expressed these LPC markers (Figure 2—figure supplement 2B). Although we used PHHs which underwent a freeze-thaw cycle, we confirmed that expression of DPP4/CD26, a general hepatocyte marker, was still preserved, supporting the validity of this flow cytometry analysis. We observed that PHHs were slightly positive for ITGA6, but this is likely to be a nature of primary hepatocytes, because lineage-traced mouse primary hepatocytes also exhibited a slight signal of Itga6, while none of the other analyzed LPC markers, Epcam, Prom1 and Cd24 were detected (Figure 2—figure supplement 2C). Next, we performed microarray-based transcriptome analysis of previously identified BEC/LPC marker genes to further characterize these cells. Expression of many of these genes was induced during the 2 weeks of culture (Figure 2E). Some of these genes, such as PROM1 and SPP1, were expressed at comparable levels regardless of whether cells were cultured in the presence of AC, suggesting that their expression was spontaneously induced by the basal culture conditions (Figure 2E). However, expression of multiple BEC/LPC marker genes, including EPCAM, SOX9, KRT19, TACSTD2, AXIN2 and PROX1, was increased in cells cultured in FAC (Figure 2E and F). Of these, expression of EPCAM, SOX9, and KRT19 was affected not only by the presence of AC but also by the culture duration, suggesting that AC-induced expression of these genes during in vitro culture. By contrast, expression of AXIN2 and PROX1 was maintained, but not increased, upon culture in the presence of AC. Gene signature enrichment analysis (GSEA) comparing cells cultured in the presence of FBS and those cultured in FAC demonstrated that the majority of gene sets enriched in the latter cells were related to hepatic function (Figure 2G, Supplementary file 1), suggesting that AC also helped to maintain the hepatocytic characteristics of cultured hepatocytes. Although cell-cycle-related gene sets were also identified by GSEA, their enrichment scores were relatively low (Figure 2—figure supplement 3A, Supplementary file 1). This is likely because cell proliferation was also increased in part by culture in FBS alone. Indeed, proliferation-related gene sets were enriched both in cells cultured in FBS only and in FAC compared with D1 hepatocytes (Figure 2—figure supplement 3B and C, Supplementary file 2, 3). In summary, two small molecules, AC, together with FBS, support the proliferation of hepatic epithelial cells with characteristics of both hepatocytes and LPCs/BECs.
Figure 2—figure supplement 3.

Cell-cycle-related gene expression analysis by GSEA.

(A) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC in comparison with cells cultured in the presence of FBS at D14. (B) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in FAC at D14 in comparison with D1 hepatocytes. (C) GSEA demonstrating enrichment of cell-cycle-related gene sets in cells cultured in the presence of FBS at D14 in comparison with D1 hepatocytes.

Comparison of IPHHs and APHHs in terms of their responsiveness to FAC

To investigate the difference regarding the responsiveness to FAC of IPHHs and APHHs, we compared their transpcriptome by microarray analysis. Hierarchical clustering of the whole transcriptome demonstrated that IPHHs cultured in FAC for 7 or 14 days formed a cluster distinct from those cultured in FBS (Figure 3A). In contrast, APHHs cultured in FAC for 7 or 14 days were not clearly separated from those cultured in FBS. These results suggest that APHHs are less sensitive to AC than IPHHs. GSEA indicated that many of the signaling pathways enriched for IPHHs cultured in FAC for 7 days compared with APHHs were cell-cycle-related pathways (Figure 3—figure supplements 1 and 2) (we avoided comparing cells at D14, because lot 187271 APHHs were severely contaminated with NPCs at D14, as shown in Figure 3—figure supplement 3, (iv)). In contrast, pathways enriched for APHHs included hepatic function-associated ones (Figure 3—figure supplements 1 and 2). These results suggest that APHHs were not susceptible to the pro-proliferative effect of AC. Intriguingly, we observed a relatively similar expression profile of LPC marker genes between IPHHs and APHHs (Figure 3B), except for EPCAM and ANPEP. We then asked whether APHHs indeed responded to A83-01 and CHIR99021. GSEA indicated enrichment of Wnt signaling in IPHHs compared with APHHs (nominal p-value=0.019), suggesting that APHHs less efficiently responded to CHIR99021 (Figure 3—figure supplements 1 and 4). In contrast, to our surprise, TGFβ signaling was enriched in IPHHs compared with APHHs (nominal p-value<0.001) (Figure 3—figure supplements 1 and 4). We further investigated the expression of individual genes which are known to be in the downstream of Wnt signaling (Russell and Monga, 2018) and TGFβ signaling (Cicchini et al., 2015; Fabregat and Caballero-Díaz, 2018) (Figure 3C and D). Both IPHHs and APHHs upregulated typical Wnt target genes in hepatocytes, such as GLUL and CYP1A2 in the presence of AC (Figure 3C). On the other hand, we found that LPC-related Wnt-target genes, AXIN2 and LGR5, were expressed at higher levels in IPHHs than APHHs (Figure 3C). We also confirmed that TGFβ downstream genes were downregulated in both IPHHs and APHHs treated with FAC compared with their FBS counterparts (Figure 3D). In addition, we confirmed that expression levels of some of these genes, for example VIM, SNAI1 and ZEB1, were higher in IPHHs than APHH, which explains the reason for the enrichment of TGFβ signaling in IPHHs by GSEA (Figure 3—figure supplements 1 and 4). Another signaling pathway enriched in IPHHs was mTORC1 signaling (Figure 3—figure supplement 4). mTORC1 is activated specifically in pericentral hepatocytes in a Wnt signaling-dependent manner, and suggested to regulate their growth in normal liver (Adebayo Michael et al., 2019). mTORC1 is also reported to be essential for BEC expansion during ductular reaction in regenerating liver as well as BEC organoid formation in vitro (Planas-Paz et al., 2019). In summary, although a more detailed analysis is needed, the low proliferative capacity of APHHs might be partly explained by their lower responsiveness to Wnt signaling.
Figure 3.

Comparative analysis of responsiveness to FAC of IPHHs and APHHs.

(A) Hierarchical clustering for whole transcriptome of IPHHs (red) and APHHs (blue). Two lots of APHHs (HC5-25 and 187271) and three lots of IPHHs were compared. (B) Gene expression of LPC marker genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. (C) Gene expression of Wnt signaling downsteam genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. (D) Gene expression of TGFβ signaling downsteam genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. FBS_i, FAC_i, FBS_a and FAC_a below each panel denote IPHHs cultured in FBS and FAC, and APHHs cultured in FBS and FAC, respectively.

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

Note that HC5-25 APHHs formed progenitor-like colonies partly, while 187271 APHHs did not. Proliferating cells in 187271 culture were only non-hepatic cells as determined by microscopic observation. FCL IPHHs (referred to ‘batch2’ in (A)) were cultured in the same batch of experiment.

Figure 3—figure supplement 1.

GSEA comparing IPHHs and APHHs cultured in FAC for 7 days (KEGG database).

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

Figure 3—figure supplement 2.

GSEA comparing IPHHs and APHHs cultured in FAC for 7 days (Hallmark database).

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

Figure 3—figure supplement 3.

Morphological changes of APHHs and IPHHs which were cultured in FAC medium.

Note that HC5-25 APHHs formed progenitor-like colonies partly, while 187271 APHHs did not. Proliferating cells in 187271 culture were only non-hepatic cells as determined by microscopic observation. FCL IPHHs (referred to ‘batch2’ in (A)) were cultured in the same batch of experiment.

Figure 3—figure supplement 4.

Individual plots of GSEA results for TGFβ, Wnt and mTORC1 signaling pathways.

Comparative analysis of responsiveness to FAC of IPHHs and APHHs.

(A) Hierarchical clustering for whole transcriptome of IPHHs (red) and APHHs (blue). Two lots of APHHs (HC5-25 and 187271) and three lots of IPHHs were compared. (B) Gene expression of LPC marker genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. (C) Gene expression of Wnt signaling downsteam genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. (D) Gene expression of TGFβ signaling downsteam genes was compared between IPHHs and APHHs at D1 and D7 of culture in FBS or FAC. Data are the mean ± SEM. FBS_i, FAC_i, FBS_a and FAC_a below each panel denote IPHHs cultured in FBS and FAC, and APHHs cultured in FBS and FAC, respectively.

GSEA comparing IPHHs and APHHs cultured in FAC for 7 days (KEGG database).

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

GSEA comparing IPHHs and APHHs cultured in FAC for 7 days (Hallmark database).

Pathways enriched (nominal p-value<0.05) in IPHHs compared to APHHs are shown.

Morphological changes of APHHs and IPHHs which were cultured in FAC medium.

Note that HC5-25 APHHs formed progenitor-like colonies partly, while 187271 APHHs did not. Proliferating cells in 187271 culture were only non-hepatic cells as determined by microscopic observation. FCL IPHHs (referred to ‘batch2’ in (A)) were cultured in the same batch of experiment.

Hepatic differentiation capacity of the proliferative cells

A hepatic differentiation capacity is an important feature of LPCs, particularly for their potential use as a candidate cell source for transplantation therapy. To investigate the hepatic differentiation capacity of these proliferative cells, we passaged and cultured them in the presence of oncostatin M (OSM), dexamethasone and Matrigel, which induce maturation of LPCs into hepatocytes (Kamiya et al., 2002). As noted in Figure 2C, the proliferative cells spontaneously acquired hepatic morphologies when they reached 100% confluency, even in the absence of hepatic maturation inducers (Figure 4A, Figure 4—figure supplement 1A, middle panels for each lot). However, this morphological change was more evident in the presence of hepatic maturation inducers (Figure 4A, Figure 4—figure supplement 1A, right panels for each lot). In particular, cells acquired a polygonal and cytoplasm-rich morphology, which is similar to that of PHHs (Figure 4B). Accordingly, microarray analysis confirmed that expression of representative hepatic marker genes, including ALB, TDO2 and SERPINA1 was increased after hepatic maturation induction (Figure 4C). However, the expression levels of these genes were not markedly changed in cells from lot JFC. This is presumably because expression of hepatic maturation genes was already high in these cells even before hepatic induction. In contrast with the hepatic marker genes, expression of the BEC/LPC marker genes including SOX9, KRT19, and KRT7 was decreased, suggesting that the proliferative cells lost their BEC/LPC phenotype and acquired a mature hepatic phenotype (Figure 4—figure supplement 1B). Hierarchical cluster analysis of genes that were differentially expressed between cells cultured in the presence of hepatic maturation inducers (Hep-i(+)) and cells cultured for the same duration in the absence of hepatic maturation inducers (Hep-i(-)) indicated that the characteristics of Hep-i(+) cells were relatively similar to those of PHHs (Figure 4D). Overrepresented pathways in Hep-i(+) cells in comparison with Hep-i(-) cells were associated with the immune response and metabolic processes (Figure 4E), both of which are important functions of the liver. These findings were further validated by GSEA (Figure 4F, Supplementary file 4). By contrast, overrepresented pathways in Hep-i(-) cells in comparison with Hep-i(+) cells were associated with developmental processes and morphogenesis, implying that Hep-i(-) cells were functionally immature compared with Hep-i(+) cells (Figure 4—figure supplement 1C). In addition, cell cycle-related genes were overrepresented in Hep-i(-) cells (Figure 4—figure supplement 1D, Supplementary file 5), which is consistent with the general notion that progenitor cells have a greater proliferative capacity than cells with a more mature phenotype. Taken together, proliferative cells derived from human hepatocytes via culture in FAC lost their immature phenotype and acquired a mature hepatocyte-like phenotype in response to hepatic maturation inducers. Thus, we hereafter designate these proliferative cells as human CLiPs (hCLiPs).
Figure 4.

FAC-cultured proliferative cells differentiate into mature hepatocytes in vitro.

(A) Phase contrast images showing the morphological changes of FAC-cultured human proliferative cells (lot FCL) treated with (Hep-i(+)) or without (Hep-i(-)) hepatic maturation-inducing factors. Also see Figure 4—figure supplement 1A for lots DUX and JFC. (B) Phase contrast images of PHHs for reference. (C) Quantified expression of hepatic function-related genes in hCLiPs derived from the three lots with or without hepatic induction and in PHHs. Data are shown as mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (D) Hierarchical clustering based on Canberra distance of 990 genes that were differentially expressed (≥2 fold change on average for the three lots and p<0.05 by the paired t-test) between Hep-i(-) and Hep-i(+). Data were obtained from two repeated experiments for each lot of hCLiPs and from one experiment for each lot of PHHs. (E) Biological processes overrepresented in Hep-i(+) cells in comparison with Hep-i(-) cells, as identified using BiNGO, a Cytoscape plug-in. p-value is calculated by the default setting of the plug-in. (F) GSEA demonstrating enrichment of hepatic function-related gene sets in Hep-i(+) cells in comparison with Hep-i(-) cells. p-Values indicate nominal p-values.

(A) Phase contrast images showing the morphological changes of hCLiPs derived from lots DUX and JFC upon hepatic maturation. (B) Quantified expression of BEC/LPC marker genes in hCLiPs derived from the three lots with or without hepatic maturation and in PHHs. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (C) Biological processes overrepresented in Hep-i(-) cells in comparison with Hep-i(+) cells, as identified using BiNGO, a Cytoscape plug-in. p-Value is calculated by the default setting of the plug-in. (D) GSEA demonstrating enrichment of cell-cycle-related gene sets in Hep-i(-) cells in comparison with Hep-i(+) cells. (E) GSEA demonstrating enrichment of CYP-associated metabolic pathways in Hep-i(+) cells in comparison with Hep-i(-) cells.

Figure 4—figure supplement 1.

Characterization of proliferative human hepatic cells following hepatic maturation.

(A) Phase contrast images showing the morphological changes of hCLiPs derived from lots DUX and JFC upon hepatic maturation. (B) Quantified expression of BEC/LPC marker genes in hCLiPs derived from the three lots with or without hepatic maturation and in PHHs. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (C) Biological processes overrepresented in Hep-i(-) cells in comparison with Hep-i(+) cells, as identified using BiNGO, a Cytoscape plug-in. p-Value is calculated by the default setting of the plug-in. (D) GSEA demonstrating enrichment of cell-cycle-related gene sets in Hep-i(-) cells in comparison with Hep-i(+) cells. (E) GSEA demonstrating enrichment of CYP-associated metabolic pathways in Hep-i(+) cells in comparison with Hep-i(-) cells.

FAC-cultured proliferative cells differentiate into mature hepatocytes in vitro.

(A) Phase contrast images showing the morphological changes of FAC-cultured human proliferative cells (lot FCL) treated with (Hep-i(+)) or without (Hep-i(-)) hepatic maturation-inducing factors. Also see Figure 4—figure supplement 1A for lots DUX and JFC. (B) Phase contrast images of PHHs for reference. (C) Quantified expression of hepatic function-related genes in hCLiPs derived from the three lots with or without hepatic induction and in PHHs. Data are shown as mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (D) Hierarchical clustering based on Canberra distance of 990 genes that were differentially expressed (≥2 fold change on average for the three lots and p<0.05 by the paired t-test) between Hep-i(-) and Hep-i(+). Data were obtained from two repeated experiments for each lot of hCLiPs and from one experiment for each lot of PHHs. (E) Biological processes overrepresented in Hep-i(+) cells in comparison with Hep-i(-) cells, as identified using BiNGO, a Cytoscape plug-in. p-value is calculated by the default setting of the plug-in. (F) GSEA demonstrating enrichment of hepatic function-related gene sets in Hep-i(+) cells in comparison with Hep-i(-) cells. p-Values indicate nominal p-values.

Characterization of proliferative human hepatic cells following hepatic maturation.

(A) Phase contrast images showing the morphological changes of hCLiPs derived from lots DUX and JFC upon hepatic maturation. (B) Quantified expression of BEC/LPC marker genes in hCLiPs derived from the three lots with or without hepatic maturation and in PHHs. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (C) Biological processes overrepresented in Hep-i(-) cells in comparison with Hep-i(+) cells, as identified using BiNGO, a Cytoscape plug-in. p-Value is calculated by the default setting of the plug-in. (D) GSEA demonstrating enrichment of cell-cycle-related gene sets in Hep-i(-) cells in comparison with Hep-i(+) cells. (E) GSEA demonstrating enrichment of CYP-associated metabolic pathways in Hep-i(+) cells in comparison with Hep-i(-) cells.

Expression and activities of drug-metabolizing enzymes in hCLiP-derived hepatocytes

Cytochrome P-450 (CYP) enzymes play a central role in the metabolic functions of the liver. Thus, we investigated the metabolic functions of hCLiP-derived hepatocytes. As noted in the previous section, overrepresented pathways in Hep-i(+) cells were associated with metabolism (Figure 4E and F, Supplementary file 5). In addition, pathways involving CYPs were enriched in Hep-i(+) cells, as characterized by GSEA using both the KEGG and Reactome databases, although the p-values for these gene sets were not lower than 0.05 (Figure 4—figure supplement 1E). A heatmap revealed that expression of several CYP genes was higher in Hep-i(+) cells than in Hep-i(-) cells (Figure 5A). These genes included CYP2B6, CYP2D6, CYP2E1, CYP2C9 and CYP3A4, which play crucial roles in metabolic functionality of the human liver (Martignoni et al., 2006). The enzymatic activities of multiple CYPs were investigated by liquid chromatography tandem mass spectrometry (LC-MS/MS) using a cocktail of substrates (Figure 5B) (Ohtsuki et al., 2012). This revealed that the enzymatic activities of CYP1A2, CYP2C19, CYP2C9, CYP2D6 and CYP3A were comparable, if not the same, in Hep-i(+) cells derived from lots FCL and JFC as in PHHs, but were lower in Hep-i(+) cells derived from lot DUX (Figure 5B). Expression of CYP1A2, CYP2B6 and CYP3A4 is induced in hepatocytes via transcriptional activation in response to certain chemicals. Thus, we investigated whether the expression and activities of these CYPs were increased in hCLiP-derived hepatocytes treated with prototypical inducers of each CYP isoform, namely, omeprazole (aryl hydrocarbon receptor ligand) for CYP1A2, phenobarbital (indirect activator of constitutive active androstane receptor) for CYP2B6 and CYP3A4, and rifampicin (pregnane X receptor ligand) for CYP3A4. These CYP genes were markedly upregulated in cells derived from the three lots in response to the corresponding inducer (Figure 5—figure supplement 1A,B). Although enzymatic activities of these CYPs were increased in both Hep-i(-) and Hep-i(+) cells upon treatment with the corresponding inducer, these increases were relatively larger in the latter cells (Figure 5C, Figure 5—figure supplement 1C), consistent with the changes in gene expression (Figure 5—figure supplement 1B). We also directly quantified CYP protein expression by mass spectrometry. Protein expression of CYP1A2 and CYP3A4 in hCLiP-derived hepatocytes was increased in response to the corresponding inducer (Figure 5D). In addition, activities of the phase II enzymes sulfotransferase (SULT) and UDP-glucuronosyltransferase (UGT) were comparable in hCLiP-derived hepatocytes and PHHs (Figure 5E). These results demonstrate that hCLiPs differentiate into cells that are metabolically mature after induction of hepatic maturation and thus are potentially applicable for drug metabolism studies.
Figure 5.

hCLiP-derived hepatocytes exhibit CYP enzymatic activity.

(A) Heatmap showing expression of CYP genes that were differentially expressed between Hep-i(-) and Hep-i(+) cells (≥1.5 fold change), as assessed by microarray analysis. Fold change was calculated using the mean values of three donor-derived CLiPs (experiments were repeated twice for each donor-derived CLiPs). Hierarchical clustering was performed based on Euclidean distance. (B) Basal enzymatic activities of major CYPs in Hep-i(-) cells, Hep-i(+) cells, and PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Data were obtained from two repeated experiments for each lot of hCLiPs and from one experiment for each lot of PHHs. (C) Inducibility of CYP1A2, CYP2B6, and CYP3A activities. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (D) LC-MS/MS analysis of the intracellular protein levels of CYP1A2 and CYP3A4 in Hep-i(-) and Hep-i(+) cells treated with inducers or the corresponding vehicle. Data are from one experiment for each lot of hCLiPs. (E) Enzymatic activities of the phase II enzymes UGT and SULT, as assessed by LC-MS/MS analysis using a cocktail of substrates. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs.

(A) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Data are shown as one representative experiment. (B) Summary of the inducibility of CYP mRNA expression in the individual experiments shown in (B). Data are obtained from one experiment for lot JFC and two repeated experiments for DUX and FCL except CYP3A4 (RF/MeOH) in which all data are obtained from one experiment. (C) Summary of the inducibility of CYP enzymatic activities in the individual experiments shown in (Figure 3C). Data are obtained from two repeated experiments. p-Values are obtained by paired student’s t-test.

Figure 5—figure supplement 1.

Inducibility of CYP1A2 and CYP3A4 in Hep-i(+) cells.

(A) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Data are shown as one representative experiment. (B) Summary of the inducibility of CYP mRNA expression in the individual experiments shown in (B). Data are obtained from one experiment for lot JFC and two repeated experiments for DUX and FCL except CYP3A4 (RF/MeOH) in which all data are obtained from one experiment. (C) Summary of the inducibility of CYP enzymatic activities in the individual experiments shown in (Figure 3C). Data are obtained from two repeated experiments. p-Values are obtained by paired student’s t-test.

hCLiP-derived hepatocytes exhibit CYP enzymatic activity.

(A) Heatmap showing expression of CYP genes that were differentially expressed between Hep-i(-) and Hep-i(+) cells (≥1.5 fold change), as assessed by microarray analysis. Fold change was calculated using the mean values of three donor-derived CLiPs (experiments were repeated twice for each donor-derived CLiPs). Hierarchical clustering was performed based on Euclidean distance. (B) Basal enzymatic activities of major CYPs in Hep-i(-) cells, Hep-i(+) cells, and PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Data were obtained from two repeated experiments for each lot of hCLiPs and from one experiment for each lot of PHHs. (C) Inducibility of CYP1A2, CYP2B6, and CYP3A activities. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. (D) LC-MS/MS analysis of the intracellular protein levels of CYP1A2 and CYP3A4 in Hep-i(-) and Hep-i(+) cells treated with inducers or the corresponding vehicle. Data are from one experiment for each lot of hCLiPs. (E) Enzymatic activities of the phase II enzymes UGT and SULT, as assessed by LC-MS/MS analysis using a cocktail of substrates. Data are the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs.

Inducibility of CYP1A2 and CYP3A4 in Hep-i(+) cells.

(A) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Data are shown as one representative experiment. (B) Summary of the inducibility of CYP mRNA expression in the individual experiments shown in (B). Data are obtained from one experiment for lot JFC and two repeated experiments for DUX and FCL except CYP3A4 (RF/MeOH) in which all data are obtained from one experiment. (C) Summary of the inducibility of CYP enzymatic activities in the individual experiments shown in (Figure 3C). Data are obtained from two repeated experiments. p-Values are obtained by paired student’s t-test.

Long-term expansion of hCLiPs

Long-term culture of hepatocytes or LPCs with a sustained proliferative capacity is of great interest for liver regenerative medicine and drug discovery studies. Thus, we investigated the feasibility of long-term culture of hCLiPs. Cells derived from lots FCL and DUX could be serially passaged until at least passage 10 (P10) without growth arrest (Figure 6A) or obvious morphological changes (Figure 6—figure supplement 1A). The population doubling times of FCL and DUX hCLiPs were 1.27 ± 0.0066 and 1.43 ± 0.0086 d, respectively (mean ± SEM, determined by three repeated experiments for each lot). However, non-hepatic cells with a fibroblast-like morphology were also observed (Figure 6—figure supplement 1A, arrows), and the percentage of these cells varied among repeated experiments for each lot, as assessed by flow cytometric analysis of the epithelial-cell surface marker proteins EPCAM and CD24 (Figure 6—figure supplement 1B). Cultures of cells from lot JFC contained more fibroblast-like cells than cultures of cells from lots FCL and DUX (Figure 6—figure supplement 1A). Upon culture of cells from lot JFC, the percentage of fibroblastic cells increased with the passage number and fibroblastic cells overwhelmed hCLiPs by P5, as assessed by microscopic observation (n = 3 repeated experiments) (Figure 6—figure supplement 1A) and flow cytometric analysis of LPC markers (n = 1 experiment) (Figure 6—figure supplement 1B). However, when EPCAM+ cells were sorted from primary hCLiPs at the first passage, proliferative epithelial cells were observed for at least the next three passages (total of four passages) with their population doubling time 1.24 d (n = 1 experiment) between P1 and P4 (Figure 6A, Figure 6—figure supplement 1A), confirming the proliferative capacity of hCLiPs obtained from lot JFC. Although expression of surface markers varied among experimental batches at later passages (Figure 6—figure supplement 1B), it was relatively stable up to P5 in cells derived from lots FCL and DUX (Figure 6—figure supplement 1B). We also investigated the karyotype of cells derived from lots FCL and DUX at P7 (Figure 6B). hCLiPs derived from lot JFC were contaminated by an increased percentage of fibroblast-like cells; therefore, we karyotyped FACS-sorted EPCAM+ cells (at the first passage) which were then passaged four times after sorting (Figure 6B). None of the analyzed cells exhibited any chromosomal abnormality (20 cells analyzed per lot) and all the analyzed cells were diploid (50 cells analyzed per lot) (Figure 6B). This implies that hCLiPs were derived from diploid hepatocytes, which is consistent with our previous observations in rat CLiPs (Katsuda et al., 2017). We further investigated transcriptomic changes in hCLiPs derived from lots FCL and DUX between P0 and P10 using cells from the experimental batches that maintained higher levels of EPCAM and CD24 expression (Figure 6—figure supplement 1B) (experimental batch #3 and #2 for lots DUX and FCL, respectively). A heatmap of genes that were differentially expressed between P0 and P10 showed that the phenotype of hCLiPs gradually changed (Figure 6—figure supplement 1C). As indicated on the right in Figure 6—figure supplement 1C, genes whose expression decreased included those related to hepatic functions, indicating that hCLiPs lost their hepatic phenotypes during repeated passage. Nonetheless, the heatmap suggested that hCLiPs retained at least some of their original characteristics until approximately P5 (Figure 6—figure supplement 1C). Thus, we investigated the hepatic phenotype of hCLiPs at P3 and P5. qRT-PCR analysis of hCLiPs derived from each lot indicated that absolute expression levels of hepatic genes consistently decreased as the passage number increased (Figure 6C). Nevertheless, hCLiPs derived from each lot, particularly lots FCL and DUX, could undergo hepatic differentiation (Figure 6C). Immunocytochemistry revealed that Hep-i(+) cells derived from lot FCL expressed hepatic marker proteins at P3 (Figure 6—figure supplement 1D). We also investigated CYP enzymatic activities in these cells. Although the CYP enzymatic activities clearly decreased upon repeated passage, the basal activities of these enzymes, with the exception of CYP2C19, were maintained at P3 and P5 (Figure 6D). Induction of CYP3A enzymatic activity in response to rifampicin and phenobarbital was relatively stable even at P3 and P5, especially in Hep-i(+) cells (Figure 6E). In summary, functional decline of hCLiP-derived hepatocytes during continuous culture is unavoidable; however, CYP3A, the most important CYP in human drug metabolism, is still induced in these cells.
Figure 6.

hCLiPs stably expand in vitro and retain their hepatic differentiation ability.

(A) Growth curves of hCLiPs from P0–10 (lots FCL and DUX) or P0–four or P0–5 (lot JFC). Each curve represents data obtained in independent experiments. Data in each plot indicate the cumulative cell numbers at each time point normalized against that at D0 (set to one cell). (B) Representative chromosomal images of hCLiPs derived from the three lots, as assessed by Q-band karyotyping. (C) qRT-PCR analysis of hepatocyte-specific genes at P1, P3, and P5. Data are normalized against ACTB expression, and shown as mean ± SEM of two repeated experiments except JFC cells at P5 (n = 1). (D) Basal enzymatic activities of major CYPs in Hep-i(-) and Hep-i(+) cells at P3 and P5, as well as in PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Data are shown as one experiment or the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. N.d. indicates ‘not detected’. (E) Inducibility of CYP1A2, CYP2B6, and CYP3A activities at P3 and P5. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Data are shown as one experiment or the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. N.d. indicates ‘not detected’.

(A) Phase contrast images of hCLiPs upon serial passage. Arrows indicate cells with a fibroblast-like morphology. (B) Surface marker profiling of hCLiPs upon serial passage. Data are from three repeated experiments for cells derived from lots FCL and DUX and from one experiment for cells derived from lot JFC. (C) Hierarchical clustering based on Euclidean distance of genes that were differentially expressed between hCLiPs at P10 and those at P0. Probes were ranked by the weighted average difference method (Kadota et al., 2008), and the top 5% (2445 probes) were defined as differentially expressed genes. (D) Immunocytochemistry of hepatic function-related proteins in hCLiPs at P3 after hepatic maturation.

Figure 6—figure supplement 1.

Characterization of hCLiPs upon long-term culture.

(A) Phase contrast images of hCLiPs upon serial passage. Arrows indicate cells with a fibroblast-like morphology. (B) Surface marker profiling of hCLiPs upon serial passage. Data are from three repeated experiments for cells derived from lots FCL and DUX and from one experiment for cells derived from lot JFC. (C) Hierarchical clustering based on Euclidean distance of genes that were differentially expressed between hCLiPs at P10 and those at P0. Probes were ranked by the weighted average difference method (Kadota et al., 2008), and the top 5% (2445 probes) were defined as differentially expressed genes. (D) Immunocytochemistry of hepatic function-related proteins in hCLiPs at P3 after hepatic maturation.

hCLiPs stably expand in vitro and retain their hepatic differentiation ability.

(A) Growth curves of hCLiPs from P0–10 (lots FCL and DUX) or P0–four or P0–5 (lot JFC). Each curve represents data obtained in independent experiments. Data in each plot indicate the cumulative cell numbers at each time point normalized against that at D0 (set to one cell). (B) Representative chromosomal images of hCLiPs derived from the three lots, as assessed by Q-band karyotyping. (C) qRT-PCR analysis of hepatocyte-specific genes at P1, P3, and P5. Data are normalized against ACTB expression, and shown as mean ± SEM of two repeated experiments except JFC cells at P5 (n = 1). (D) Basal enzymatic activities of major CYPs in Hep-i(-) and Hep-i(+) cells at P3 and P5, as well as in PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Data are shown as one experiment or the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. N.d. indicates ‘not detected’. (E) Inducibility of CYP1A2, CYP2B6, and CYP3A activities at P3 and P5. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Data are shown as one experiment or the mean ± SEM of two repeated experiments for each lot of hCLiPs and the results of one experiment for each lot of PHHs. N.d. indicates ‘not detected’.

Characterization of hCLiPs upon long-term culture.

(A) Phase contrast images of hCLiPs upon serial passage. Arrows indicate cells with a fibroblast-like morphology. (B) Surface marker profiling of hCLiPs upon serial passage. Data are from three repeated experiments for cells derived from lots FCL and DUX and from one experiment for cells derived from lot JFC. (C) Hierarchical clustering based on Euclidean distance of genes that were differentially expressed between hCLiPs at P10 and those at P0. Probes were ranked by the weighted average difference method (Kadota et al., 2008), and the top 5% (2445 probes) were defined as differentially expressed genes. (D) Immunocytochemistry of hepatic function-related proteins in hCLiPs at P3 after hepatic maturation.

Enrichment of hCLiPs with LPC markers and characterization of their descendants in the subsequent culture

We then asked whether the loss of the original phenotype of hCLiPs, especially the hepatic phenotype, during serial passages would be caused by their own phenotypic change or by expansion of contaminated NPCs. Using antibodies against three LPC makers (EPCAM, PROM1 and CD24) and a NPC marker THY1/CD90, which particularly characterizes fibroblastic cells, we sorted each LPC-marker+THY1- population and LPC-marker-THY1+ population from FCL-hCLiPs at P0 (Figure 7A, Figure 7—figure supplement 1). qRT-PCR clearly demonstrated that each LPC marker enabled enrichment of cells with hepatic phenotype (ALB, TTR, GJB1), whereas THY1-enriched cells consistently exhibited mesenchymal phenotype as characterized by the expression of ACTA2 and VIM in addition to THY1 (Figure 7B). After subsequent three passages (2–3 weeks), LPC marker-enriched cells relatively retained their LPC/hepatic phenotypes as assessed by qRT-PCR (Figure 7C) and flow cytometry (Figure 7—figure supplement 1) compared to THY1-enriched cells. However, we noted that compared to the cells at P0, such LPC/hepatic phenotypes were largely reduced after three passages (Figure 7—figure supplement 2). These results demonstrated that, even after enrichment of LPC marker+ cells, phenotypic deterioration of hCLiPs is unavoidable. Since hCLiPs did not exhibit remarkable morphological changes until P10 of culture (Figure 6—figure supplement 1A), the results obtained here call attention to the need for a careful quality control of hCLiPs by quantitative analyses, including flow cytometry and qRT-PCR.
Figure 7.

FACS is useful for enrichment of hCLiPs, but does not prevent phenotypic deterioration of the descendant cells in the subsequent culture.

(A) Schematic representation of the experimental design for FACS of LPC marker+THY1- cells (hCLiP-enriched cells) and LPC marker-THY1+ cells (putative NPCs), and the subsequent evaluation by qRT-PCR. Results for the EPCAM/THY sorting experiments are partially shown as a representative of this study. The full result for EPCAM/THY1, PROM1/THY1 and CD24/THY1 sorting experiments are shown in Figure 5—figure supplement 1. (B) qRT-PCR was performed for the cells just after sorting using LPC markers (EPCAM, PROM1 and CD24), hepatic markers (ALB, TTR and GJB1) and fibroblast markers (THY1, ACTA1 and VIM). (C) qRT-PCR using the same gene panel as in (B) was performed for the sorted cells which were plated and subsequently cultured in the standard hCLiP culture condition for another 2 weeks. For comparison between P0 (as shown in B) and these descendant cells are shown in Figure 7—figure supplement 2.

Unsorted cells which were cultured for the same period with sorted cells are shown on the top.

Figure 7—figure supplement 1.

Detailed data for FACS of FCL-hCLiPs using antibodies for LPC markers and THY1.

Unsorted cells which were cultured for the same period with sorted cells are shown on the top.

Figure 7—figure supplement 2.

Comparison of gene expression levels of FCL-hCLiPs just after sorting and their descendants which underwent another 2 week culture.

FACS is useful for enrichment of hCLiPs, but does not prevent phenotypic deterioration of the descendant cells in the subsequent culture.

(A) Schematic representation of the experimental design for FACS of LPC marker+THY1- cells (hCLiP-enriched cells) and LPC marker-THY1+ cells (putative NPCs), and the subsequent evaluation by qRT-PCR. Results for the EPCAM/THY sorting experiments are partially shown as a representative of this study. The full result for EPCAM/THY1, PROM1/THY1 and CD24/THY1 sorting experiments are shown in Figure 5—figure supplement 1. (B) qRT-PCR was performed for the cells just after sorting using LPC markers (EPCAM, PROM1 and CD24), hepatic markers (ALB, TTR and GJB1) and fibroblast markers (THY1, ACTA1 and VIM). (C) qRT-PCR using the same gene panel as in (B) was performed for the sorted cells which were plated and subsequently cultured in the standard hCLiP culture condition for another 2 weeks. For comparison between P0 (as shown in B) and these descendant cells are shown in Figure 7—figure supplement 2.

Detailed data for FACS of FCL-hCLiPs using antibodies for LPC markers and THY1.

Unsorted cells which were cultured for the same period with sorted cells are shown on the top.

Repopulation of chronically injured mouse livers by hCLiPs

The capacity to repopulate injured livers is the most important and stringent criterion of a candidate cell source for liver regenerative medicine. Depending on the disease, 1–15% of hepatocytes must be replaced to achieve and sustain a therapeutic effect (Jorns et al., 2012; Rezvani et al., 2016). Laboratory-generated hepatocytes typically have RIs of less than 5% (Rezvani et al., 2016), but a few studies reported maximum RIs of 20% or 30% in individual animals (Carpentier et al., 2014; Du et al., 2014). Moreover, in a recent study, Zhang et al. (2018) achieved much higher RI (>60%) by transplanting expandable hepatic cells named ProliHH, which were generated from PHHs as with hCLiPs. Thus, it is important to evaluate the repopulative capacity of hCLiPs from a comparative point of view. We assessed the repopulative capacity of hCLiPs in immunodeficient mice with chronically injured livers. Our previous study revealed that rat CLiPs repopulate the liver of cDNA-uPA/SCID mice (Katsuda et al., 2017); therefore, we first transplanted hCLiPs derived from lots FCL, DUX and JFC at P0–P2 into this model. After intrasplenic transplantation of primary hCLiPs that had been expanded in vitro for approximately 2 weeks (11–13 days) (hereafter designated P0-hCLiPs), the human ALB (hALB) level was exponentially increased in the blood of some, but not all, mice (Figure 8A, red lines). The maximum hALB level in blood was >10 mg/ml, which is comparable with that observed following transplantation of PHHs in this animal model (Tateno et al., 2015). Immunohistochemistry (IHC) of human-specific CYP2Cs (including CYP2C9 and other CYP2Cs according to the manufacturer’s datasheet) demonstrated extensive repopulation in mouse livers extracted at 10–11 weeks after transplantation (Figure 8B). Although the RI varied among mice (32.2 ± 13.5% for lot FCL, n = 11; 39.3 ± 13.5% for lot JFC, n = 11; 17.8 ± 16.4% for lot DUX, n = 4, mean ± SEM), it reached >90% in some animals (Figure 8C). This maximum RI is comparable with that achieved after transplantation of PHHs (Rezvani et al., 2016). The repopulative capacity declined as the culture period increased (Figure 8A and C). Nonetheless, one mouse transplanted with FCL-P1-hCLiPs (hCLiPs derived from lot FCL that were passaged once before transplantation) (67.4%) and two mice transplanted with JFC-P2-hCLiPs (hCLiPs derived from lot JFC that were passaged twice before transplantation) (83.1% and 91.1%) exhibited high RIs. It should be noted that FCL-P1-hCLiPs and JFC-P2-hCLiPs underwent approximately 1000- and 400-fold expansion from the initial PHHs, respectively. These fold expansion is comparable to that achieved by ProliHH developed by Zhang et al. (2018). They reported high repopulative capacity of ProliHH at P4-P6. The fold expansion based on the initial number of PHHs, ProliHH at P4-P6 in their culture system underwent approximately 400–1000-fold expansion. Thus, hCLiPs have repopulative capacity at the comparable levels with ProliHH. We further confirmed the repopulative capacity of FCL-P0-hCLiPs using another model, namely, TK-NOG mice (Hasegawa et al., 2011). In this model, the serum hALB level was dramatically elevated to at most 8.1 mg/ml (Figure 8D). The maximum RI was lower in TK-NOG mice (57.5%) than in cDNA-uPA/SCID mice (96.0%) (Figure 8E and F). However, engraftment was more efficient in TK-NOG mice than in cDNA-uPA/SCID mice; significant repopulation (>15% RI) with FCL-P0-hCLiPs was observed in 83% (5/6 mice) of TK-NOG mice (Figure 8F), but only in 50% (3/6 mice) of cDNA-uPA/SCID mice (Figure 8C). Examination of the area repopulated by hCLiPs by staining with an antibody against human mitochondria showed that repopulating human cells expressed MDR1 and TTR, which are associated with hepatic function (Figure 8G and H). MDR1 was detected on the apical side of adjacent mouse and human hepatocytes, suggesting that hCLiP-derived cells successfully reconstructed the normal liver architecture (Figure 8G, arrows). Accordingly, hepatic zonation was correctly established in the repopulated regions, as assessed by expression of glutamate-ammonia ligase (GLUL, also known as glutathione synthetase) (Figure 8H), CYP1A2 and CYP3A4 (Figure 8I).
Figure 8.

hCLiPs repopulate chronically injured mouse livers and contribute to reconstruction of the normal liver architecture.

(A) hALB levels in blood of cDNA-uPA/SCID mice. Each line indicates the level in an individual mouse. Colors denote the passage number of transplanted hCLiPs. (B) Representative images of cDNA-uPA/SCID mouse livers highly (left and middle panels) and slightly (right panel) repopulated by hCLiPs. The percentages indicate RIs. (C) Distribution of RIs in livers of cDNA-uPA/SCID mice at 10–11 weeks after transplantation of hCLiPs, as assessed by IHC of CYP2C (shown in B). Colors denote the passage number of transplanted hCLiPs. RIs were calculated for samples marked by asterisks using hepatocytes isolated from chimeric livers by two-step collagenase perfusion followed by incubation with magnetic beads conjugated with a specific anti-mouse antibody (see Materials and methods for details). Bars indicate the mean ± SEM. (D) hALB levels in sera of TK-NOG mice. Each line indicates the level in an individual mouse. (E) Representative IHC of human CYP2C in TK-NOG mouse livers highly (left panel) and intermediately (right panel) repopulated by hCLiPs. The percentages indicate RIs determined based on this IHC. (F) A dot plot showing the distribution of RIs in livers of cDNA-uPA/SCID mice at 10–11 weeks after transplantation of hCLiPs. Bars indicate the mean ± SEM. (G) IHC of the hepatic function marker proteins MDR1 (left panels) and TTR (right panels). Sections were counterstained with an anti-human mitochondria antibody (green) and DAPI. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. (H) IHC of the zone 3-specific protein GLUL. Sections were counterstained with an anti-human mitochondria antibody (green) and DAPI. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. (I) IHC of the zone 3-specific CYPs CYP1A2 and CYP3A4. Sections were counterstained with an antibody against human CYP2C, which does not show strong zone specificity. Nuclei were also counterstained with DAPI in merged images. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. PV and CV indicate portal vein and central vein, respectively.

(A) Blood hALB levels in cDNA-uPA/SCID mice which were transplanted with FCL-P4-hCLiPs (purple lines). Each line indicates the level in an individual mouse. cDNA-uPA/SCID mice transplanted with FCL-P0-hCLiPs (red lines) or FCL-P1-hCLiPs (a green line), which were successfully repopulated with high RIs (>60%), are shown as reference (these data are used also in Figure 6A). (B) Representative images of cDNA-uPA/SCID mouse livers transplanted with FCL-P4-hCLiPs. The liver tissue was harvested 8 weeks after transplantation, and stained with a human-specific CYP2C antibody to estimate the RIs. (C) Serum hALB levels in TK-NOG mice which were transplanted with FCL-P3-hCLiPs with (light blue lines) or without (green lines) hepatic induction. Each line indicates the level in an individual mouse. TK-NOG mice transplanted with FCL-P0-hCLiPs (red lines) are shown as reference (these data are used also in Figure 6D).

hCLiPs repopulate chronically injured mouse livers and contribute to reconstruction of the normal liver architecture.

(A) hALB levels in blood of cDNA-uPA/SCID mice. Each line indicates the level in an individual mouse. Colors denote the passage number of transplanted hCLiPs. (B) Representative images of cDNA-uPA/SCID mouse livers highly (left and middle panels) and slightly (right panel) repopulated by hCLiPs. The percentages indicate RIs. (C) Distribution of RIs in livers of cDNA-uPA/SCID mice at 10–11 weeks after transplantation of hCLiPs, as assessed by IHC of CYP2C (shown in B). Colors denote the passage number of transplanted hCLiPs. RIs were calculated for samples marked by asterisks using hepatocytes isolated from chimeric livers by two-step collagenase perfusion followed by incubation with magnetic beads conjugated with a specific anti-mouse antibody (see Materials and methods for details). Bars indicate the mean ± SEM. (D) hALB levels in sera of TK-NOG mice. Each line indicates the level in an individual mouse. (E) Representative IHC of human CYP2C in TK-NOG mouse livers highly (left panel) and intermediately (right panel) repopulated by hCLiPs. The percentages indicate RIs determined based on this IHC. (F) A dot plot showing the distribution of RIs in livers of cDNA-uPA/SCID mice at 10–11 weeks after transplantation of hCLiPs. Bars indicate the mean ± SEM. (G) IHC of the hepatic function marker proteins MDR1 (left panels) and TTR (right panels). Sections were counterstained with an anti-human mitochondria antibody (green) and DAPI. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. (H) IHC of the zone 3-specific protein GLUL. Sections were counterstained with an anti-human mitochondria antibody (green) and DAPI. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. (I) IHC of the zone 3-specific CYPs CYP1A2 and CYP3A4. Sections were counterstained with an antibody against human CYP2C, which does not show strong zone specificity. Nuclei were also counterstained with DAPI in merged images. Images of sections transplanted with hCLiPs derived from lot FCL are shown as representative data. PV and CV indicate portal vein and central vein, respectively.

Repopulation assay of FCL-hCLiPs at later passages.

(A) Blood hALB levels in cDNA-uPA/SCID mice which were transplanted with FCL-P4-hCLiPs (purple lines). Each line indicates the level in an individual mouse. cDNA-uPA/SCID mice transplanted with FCL-P0-hCLiPs (red lines) or FCL-P1-hCLiPs (a green line), which were successfully repopulated with high RIs (>60%), are shown as reference (these data are used also in Figure 6A). (B) Representative images of cDNA-uPA/SCID mouse livers transplanted with FCL-P4-hCLiPs. The liver tissue was harvested 8 weeks after transplantation, and stained with a human-specific CYP2C antibody to estimate the RIs. (C) Serum hALB levels in TK-NOG mice which were transplanted with FCL-P3-hCLiPs with (light blue lines) or without (green lines) hepatic induction. Each line indicates the level in an individual mouse. TK-NOG mice transplanted with FCL-P0-hCLiPs (red lines) are shown as reference (these data are used also in Figure 6D). We next tested whether, after several passages, hCLiPs would still retain repopulative capacity. First, we transplanted FCL-P4-hCLiPs (hCLiPs derived from lot FCL that were passaged four times before transplantation) to cDNA-uPA/SCID mice. Based on the growth curves (Figure 6A), we estimated that these cells underwent 2.2 ± 0.94×106 fold (n = 3, mean ± SEM) expansion from the initial PHHs. We observed increase of blood hALB levels in these mice, but the hALB increasing rates were much slower than in the animals transplanted with FCL-P0-hCLiP or FCL-P1-hCLiPs (Figure 8—figure supplement 1A). The hALB levels 8 weeks after transplantation was 10 μg/ml at most (Figure 8—figure supplement 1A), which was approximately 1/1000 of the mice with high RI (>60% RI). As expected, hCYP2C staining indicated that all the mice transplanted with FCL-P4-hCLiPs exhibited very low RI (<1%) (Figure 8—figure supplement 1B). We also transplanted FCL-P3-hCLiPs to TK-NOG mice. In this experiment, we prepared EPCAM-expressing cells at the first passage by magnetic activated cell sorting (MACS), and cultured them for another two passages (three passages in total). During the culture at P3, we separated these cells to two groups, one with hepatic induction (P3 Hep-i(+)) and the other without hepatic induction (P3 Hep-i(-)). After transplantation to TK-NOG mice, we observed serum hALB increase in these mice (Figure 8—figure supplement 1C). Importantly, we confirmed that Hep-i(+) cell-transplanted group showed consistently higher hALB levels than the Hep-i(-) cell-transplanted group. However, the serum hALB levels of FCL-P3-hCLiP-Hep-i(+)-transplanted mice at 8 weeks were still only 9.1 ± 1.8 μg/ml (n = 4, mean ± SEM), which were again much lower than the mice transplanted with FCL-P0-hCLiPs. These results collectively show that hCLiPs unavoidably decrease their repopulative capacity following extended in vitro culture.
Figure 8—figure supplement 1.

Repopulation assay of FCL-hCLiPs at later passages.

(A) Blood hALB levels in cDNA-uPA/SCID mice which were transplanted with FCL-P4-hCLiPs (purple lines). Each line indicates the level in an individual mouse. cDNA-uPA/SCID mice transplanted with FCL-P0-hCLiPs (red lines) or FCL-P1-hCLiPs (a green line), which were successfully repopulated with high RIs (>60%), are shown as reference (these data are used also in Figure 6A). (B) Representative images of cDNA-uPA/SCID mouse livers transplanted with FCL-P4-hCLiPs. The liver tissue was harvested 8 weeks after transplantation, and stained with a human-specific CYP2C antibody to estimate the RIs. (C) Serum hALB levels in TK-NOG mice which were transplanted with FCL-P3-hCLiPs with (light blue lines) or without (green lines) hepatic induction. Each line indicates the level in an individual mouse. TK-NOG mice transplanted with FCL-P0-hCLiPs (red lines) are shown as reference (these data are used also in Figure 6D).

Functional characterization of hCLiP-derived hepatocytes in chimeric livers

Finally, we isolated human cells from chimeric mouse livers and investigated their functionality because it has been argued that some types of laboratory-generated hepatocytes are not fully functional after repopulation (Rezvani et al., 2016). We first performed microarray-based transcriptomic analysis. After isolating hepatocytes from chimeric livers of cDNA-uPA/SCID mice by a two-step collagenase perfusion method, we eliminated mouse cells using a magnetic bead separation system. Microscopic observation revealed that 32.7%, 16.8% and 33.1% of hepatocytes isolated from chimeric livers of mice transplanted with hCLiPs derived from lots FCL, JFC and DUX bound to magnetic beads conjugated with a specific anti-mouse antibody prior to magnetic separation, respectively, while these percentages were reduced to 2.9%, 0.0%, and 1.6% after magnetic separation, respectively. Thus, we assumed that the results of experiments performed with these cells should be mostly ascribed to human cells. Magnetically separated human cells exhibited typical morphologies of mature hepatocytes (Figure 9A). However, unexpectedly, hierarchical clustering and principle component analysis (PCA) of the entire transcriptome showed that chimeric liver-derived human cells were distinct from PHHs (Figure 9B and C). A control sample of human hepatocytes isolated from chimeric livers following transplantation of IPHHs (lot JFC) yielded similar results as human hepatocytes isolated from chimeric livers following transplantation of hCLiPs (Figure 9B and C), indicating that the transcriptomic difference between human hepatocytes in chimeric livers and PHHs is due to environmental differences between human and mouse livers. Surprisingly, GSEA demonstrated that multiple hepatic function-related gene sets were overrepresented in human hepatocytes isolated from chimeric livers in comparison with PHHs (Supplementary file 6). The majority of these gene sets were associated with metabolic pathways. Other hepatic functions were also enriched, such as pathways associated with coagulation and complement production (Figure 9D, Supplementary file 6). BEC/LPC marker genes were underrepresented in hCLiP-derived hepatocytes isolated from chimeric livers and PHHs in comparison with hCLiPs (Figure 9—figure supplement 1A), demonstrating that hCLiPs underwent hepatic maturation after repopulating mouse livers. We also investigated whether hCLiP-derived hepatocytes isolated from chimeric livers exhibited CYP activities. As expected based on the transcriptomic analysis, hCLiP-derived cells isolated from chimeric livers exhibited basal enzymatic activities of major CYPs at the levels comparable with those in PHHs (Figure 9E). Enzymatic activities of CYP1A2, CYP2B6 and CYP3A were markedly induced in hCLiP-derived hepatocytes isolated from chimeric livers upon treatment with rifampicin, phenobarbital and omeprazole (Figure 9F). Consistently, qRT-PCR analysis demonstrated that expression of CYP1A2, CYP2B6 and CYP3A4 was dramatically upregulated upon treatment with CYP inducers (Figure 9—figure supplement 1B). Finally, activities of the phase II enzymes SULT and UGT in hCLiP-derived hepatocytes isolated from chimeric livers were comparable with those in PHHs (Figure 9G). These results indicate that although their transcriptomic profiles are not identical to those of PHHs, including IPHHs and APHHs, hCLiPs functionally mature in the mouse liver.
Figure 9.

Human cells isolated from chimeric livers of mice transplanted with hCLiPs have mature functions.

(A) Phase contrast images of human cells isolated from chimeric livers of mice transplanted with hCLiPs. (B) Hierarchical clustering based on Euclidean distance of the entire transcriptome (27,459 probes) comparing hCLiPs prior to transplantation (hCLiP), hCLiP-derived hepatocytes from chimeric livers (transplanted cells were at P1, P0, and P0 for lots FCL, DUX, and JFC, respectively), and PHHs. Data for human hepatocytes isolated from chimeric livers of mice transplanted with PHHs (lot JFC) are shown for reference. (C) PCA mapping of the samples described in (B). (D) Gene sets enriched in hCLiP-derived cells from chimeric livers in comparison with PHHs (top panels) and their corresponding heatmaps (bottom panels). Hierarchical clustering was performed based on Euclidean distance. (E) Basal enzymatic activities of major CYPs in hCLiP-derived cells from chimeric livers and PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures. (F) Inducibility of CYP1A2, CYP2B6, and CYP3A activities. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures. (G) Activities of the phase II enzymes UGT and SULT, as assessed by LC-MS/MS analysis using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures.

(A) Heatmap showing expression of BEC/LPC marker genes, as assessed by microarray analysis. Each element represents normalized (log2) expression, as indicated by the color scale. Hierarchical clustering was performed based on Euclidean distance. (B) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Each value is determined by one experiment with two replicate cultures. Supplementary file legends.

Figure 9—figure supplement 1.

Characterization of human cells isolated from chimeric livers of mice transplanted with hCLiPs.

(A) Heatmap showing expression of BEC/LPC marker genes, as assessed by microarray analysis. Each element represents normalized (log2) expression, as indicated by the color scale. Hierarchical clustering was performed based on Euclidean distance. (B) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Each value is determined by one experiment with two replicate cultures. Supplementary file legends.

Human cells isolated from chimeric livers of mice transplanted with hCLiPs have mature functions.

(A) Phase contrast images of human cells isolated from chimeric livers of mice transplanted with hCLiPs. (B) Hierarchical clustering based on Euclidean distance of the entire transcriptome (27,459 probes) comparing hCLiPs prior to transplantation (hCLiP), hCLiP-derived hepatocytes from chimeric livers (transplanted cells were at P1, P0, and P0 for lots FCL, DUX, and JFC, respectively), and PHHs. Data for human hepatocytes isolated from chimeric livers of mice transplanted with PHHs (lot JFC) are shown for reference. (C) PCA mapping of the samples described in (B). (D) Gene sets enriched in hCLiP-derived cells from chimeric livers in comparison with PHHs (top panels) and their corresponding heatmaps (bottom panels). Hierarchical clustering was performed based on Euclidean distance. (E) Basal enzymatic activities of major CYPs in hCLiP-derived cells from chimeric livers and PHHs, as assessed by LC-MS/MS using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures. (F) Inducibility of CYP1A2, CYP2B6, and CYP3A activities. Enzymatic activities in inducer-treated cells were compared with those in cells treated with the corresponding vehicle by LC-MS/MS analysis using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures. (G) Activities of the phase II enzymes UGT and SULT, as assessed by LC-MS/MS analysis using a cocktail of substrates. Each value is determined by one experiment with two replicate cultures.

Characterization of human cells isolated from chimeric livers of mice transplanted with hCLiPs.

(A) Heatmap showing expression of BEC/LPC marker genes, as assessed by microarray analysis. Each element represents normalized (log2) expression, as indicated by the color scale. Hierarchical clustering was performed based on Euclidean distance. (B) qRT-PCR analysis of the inducibility of CYP1A2, CYP2B6, and CYP3A mRNA expression. Gene expression levels were normalized against that of ACTB. Each value is determined by one experiment with two replicate cultures. Supplementary file legends.

Discussion

In this study, we demonstrated that hCLiPs can repopulate chronically injured livers of immunodeficient mice. An efficient repopulative capacity is one of the most important requirements of a candidate cell source for transplantation therapy; however, it is very challenging to develop such a cultured cell source. Laboratory-generated hepatic cells, such as pluripotent cell-derived hepatic cells and those transdifferentiated from cells of different lineage origins, have a poor repopulative capacity (Rezvani et al., 2016). The RI of laboratory-generated hepatocytes is typically less than 5% (Rezvani et al., 2016). After our report of rodent CLiPs (Katsuda et al., 2017), four groups recently reported methods for in vitro generation of proliferative liver (progenitor) cells from human hepatocytes (Fu et al., 2018; Hu et al., 2018; ; Kim et al., 2019; Zhang et al., 2018). In three of these studies (Fu et al., 2018; Hu et al., 2018; ; Kim et al., 2019), the generated cells exhibited relatively low repopulative efficiency with approximately 13% of RI at maximum. In contrast, Zhang el al. reported strikingly high repopulation efficiency with as high as 64% of RI (Zhang et al., 2018). Importantly, although the proliferative efficiency is limited compared with IPHHs, they succeeded in induction of proliferative hepatic cells even from APHHs. Moreover, contrary to the dichotomous repopulation of hCLiPs in our study (RI >80% or nearly 0%), Zhang et al demonstrated highly stable repopulation among transplanted animals. Our study is, thus, not the first one to report substantial repopulation using an in vitro-generated human hepatic cell source. Nonetheless, to solidify a novel concept, more evidence must be provided independently from multiple laboratories. As such, we still believe that our work also plays an important role in pioneering this new field. Another important finding in this study is that hCLiPs may be a novel cell source for drug discovery studies. The major criterion for the application of cultured hepatic cells in drug discovery studies, particularly to evaluate the functions of drug-metabolizing enzymes, is the inducibility of CYP enzymatic activities. CYP enzymes play central roles in the metabolism of clinically used drugs and xenobiotics. In general, CYP induction accelerates the clearance of xenobiotics, leading to beneficial or harmful outcomes depending on the context. Thus, recapitulation of CYP induction in cultured hepatocytes or their equivalents is important to precisely predict the effects of a tested drug on hepatocytes. However, PHHs lose their hepatic functions, including CYP inducibility, upon in vitro culture. Laboratory-generated hepatocytes reportedly exhibit basal CYP activities after maturation (Baxter et al., 2015; Kanninen et al., 2016; Liu et al., 2011; Takayama et al., 2018; Takayama et al., 2014). Although a few groups described CYP inducibility in terms of enzymatic activity (Inamura et al., 2011; Pettinato et al., 2016; Takayama et al., 2012), such reports are very limited, to the best of our knowledge. We propose that hCLiPs are a novel platform for drug discovery studies. An issue yet to be addressed is clarification of the mechanism underlying the small molecule-mediated conversion of PHHs to hCLiPs. Mini-screen of three small molecules Y, A and C demonstrated that A and C individually accelerated proliferation of PHHs, while Y alone exhibited no beneficial effect on proliferation, and even negatively affected proliferation when combined with AC (in comparison of YAC with AC). This is in line with our previous observation in rodent hepatocyte culture, in which Y minimally affected the proliferation of these three small molecules (Katsuda et al., 2017). AC substantially induced the proliferation of rodent hepatocytes at the comparable, if not at the same, level with YAC (Katsuda et al., 2017). Thus, the synergistic effect of A83-01 and CHIR99021 is the key to hepatocyte proliferation in rodent and human hepatocytes. Importantly, comparative analysis of APHHs and IPHHs suggested that activity of Wnt signaling in response to CHIR99021 may partly explain the proliferative ability of IPHHs. On the other hand, APHHs responded to A83-01 equally or even more efficiently than IPHHs, leaving a question how A83-01 affected the proliferation of IPHHs, but not APHHs. Since A83-01 is essential to IPHH proliferation as assessed in the mini-screen (Figure 1A), this small molecule might affect IPHHs in a TGFβ-independent manner. Further investigation is needed to fully understand the difference between the proliferative ability endowed by FAC between IPHHs and APHHs. Another important issue to be considered is the requirement for FBS in hCLiP induction, which is not the case for rodent CLiP induction. FBS-derived factor(s) essential for hCLiP induction should be identified in a future study. Comparison of our study with the recently reported four studies provides hints to mechanistic understanding of in vitro PHH expansion (Fu et al., 2018; Hu et al., 2018; Kim et al., 2019; Zhang et al., 2018). Notably, hepatocyte growth factor (HGF), which is not included in our culture condition, is used in all these four studies, suggesting its critical role. Indeed, Kim et al. (2019) particularly emphasizes its essential role in the presence of AC. On the other hand, Zhang et al. (2018) ascribe the proliferative capacity of PHHs particularly to Wnt signaling (Zhang et al., 2018). Interestingly, these authors reported that Wnt3a plays an essential role, while neither CHIR99021 nor Wnt signaling amplifier Rspo1 substituted for the pro-proliferative effect of Wnt3a. Moreover, these authors proposed a unique idea that hypoxic culture condition supports the stable proliferation of PHHs by suppressing PHH senescence. In line with this observation, Fu et al. also demonstrated that a sirtuin suppressor nicotinamide decreases proliferation of PHH. This finding highlights the difference between human and rodent PHHs: nicotinamide is known to induce proliferation of rat hepatocytes (Mitaka et al., 1991) and thus is frequently added to hepatocyte culture medium (including ours), but this may not be the case for induction of PHH proliferation. Collectively, these findings, including ours, provide important insight to optimization of the methodology of PHH expansion.

Materials and methods

Primary human hepatocytes

Infant primary human hepatocytes (IPHHs) (lots FCL, DUX, JFC and MRW) were purchased from Veritas Corporation (Tokyo, Japan). Adult primary human hepatocytes (APHHs) (lots HC1-14, HC3-14, HC5-25, and HC7-4) were purchased from Sekisui XenoTech (KS). IPHH lot 187273 and APHH lot 187271 were purchased from Biopredic (Saint-Gregoire, France). Donor information is summarized in Table 1.

Culture medium

The basal medium for culture of PHHs was SHM (DMEM/F12 (Life Technologies, MA) containing 2.4 g/l NaHCO3 and L-glutamine) (Chen et al., 2007; Katsuda et al., 2018) supplemented with 5 mM HEPES (Sigma, MO), 30 mg/l L-proline (Sigma), 0.05% bovine serum albumin (Sigma), 10 ng/ml epidermal growth factor (Sigma), insulin-transferrin-serine-X (Life Technologies), 10−7 M dexamethasone (Sigma), 10 mM nicotinamide (Sigma), 1 mM ascorbic acid-2 phosphate (Wako, Osaka, Japan), and antibiotic/antimycotic solution (Life Technologies). Depending on the experiment, this basal medium was supplemented with 10% FBS (Life Technologies), as well as small molecules, namely, 10 μM Y-27632 (Wako), 0.5 μM A-83–01 (Wako), and 3 μM CHIR99021 (Axon Medchem, Reston, VA). After a mini-screen of these three small molecules, PHHs were routinely cultured in SHM supplemented with 10% FBS, 0.5 μM A-83–01, and 3 μM CHIR99021.

Induction of hCLiPs from IPHHs

IPHHs were thawed in a water bath set to 37°C and suspended in 10 ml Leibovitz’s L-15 Medium (Life Technologies) supplemented with Glutamax (Life Technologies) and antibiotic/antimycotic solution. After centrifugation at 50 × g for 5 min, the cells were resuspended in William’s E medium supplemented with 10% FBS, GlutaMAX, antibiotic/antimycotic solution, and 10−7 M insulin (Sigma). The number of viable cells was determined using trypan blue (Life Technologies). IPHHs from lot JFC were seeded in collagen I-coated plates (IWAKI, Shizuoka, Japan) at a density of approximately 5 × 103 viable cells/cm2. IPHHs from lots FCL and DUX barely attached to the plates, and many of the small number that did attach subsequently detached prior to D3, as monitored by time-lapse imaging using a BZ-X700 microscope (Keyence, Osaka Japan) (data not shown). Therefore, IPPHs from lots FCL and DUX were seeded at a density of approximately 2 × 104 viable cells/cm2, which was approximately 4-fold higher than the seeding density of IPHHs from lot JFC. To determine the fold change in cell number during in vitro culture, the number of adherent cells on D3 was counted based on micrographs acquired at 10 × magnification (5–10 fields per experiment).

Subculture of hCLiPs

Cells were harvested using TrypLE Express (Life Technologies, MA) when they reached 70–100% confluency and then re-plated into a 10 cm collagen-coated plate at a density of 1–2 × 105 cells/dish.

Cell proliferation assay

Numbers of viable cells were estimated based on the WST-8 assay using Cell Counting Kit 8 (Dojindo, Kumamoto, Japan), according to the manufacturer’s instructions.

Flow cytometry and cell sorting

Flow cytometry and cell sorting were performed using a S3e Cell Sorter (BioRad, Hercules, CA). Cells were labeled with APC-conjugated mouse anti-human CD44 (1:20; G44-26; BD, Franklin Lakes, NJ), APC-conjugated mouse anti-human EPCAM (1:20; EBA-1; BD), PE/Cy7-conjugated anti-human/mouse CD49f (ITGA6) (1:20; GoH3; Biolegend), PE/Cy7-conjugated anti-human CD24 (1:20; ML5; Biolegend), APC-conjugated human anti-PROM1/CD133 (1:11; AC133; Miltenyi Biotech), APC-conjugated mouse anti-human CD26/DPP4 (1:11, FR10-11G9; Miltenyi Biotech), and FITC-conjugated mouse anti-human CD90/THY1 antibodies. An APC-conjugated mouse IgG1, κ isotype control antibody (Biolegend, MOPC-21) and a PE-Cy7-conjugated mouse IgG2b, κ isotype control (BD, 27–35) were used as controls.

Flow cytometry of primary mouse hepatocytes

An adult RosaYFP/YFP mouse received retro-orbital injection of AAV-TBG-cre at the dose of 2.5 × 1011 viral particles, and hepatocytes were harvested 3 weeks later using a standard two-step collagenase perfusion method. Isolated RosaYFP/YFP hepatocytes were stained with APC anti-mouse CD326/EPCAM) (1:100, G8.8, Biolegend) or APC anti-human/mouse CD49f/Itga6 antibody (1/100, GoH3, Biolegend). For staining with Prom1/Cd133 and Cd24, cells were incubated with purified rat anti-mouse CD133/Prom1 antibody (1:100, 315–2 C11, Biolgend) and rat anti-mouse CD24 antibody (1:100, Biolegend, M1/69) followed by staining with Alexa647-conjugated donkey anti-rat antibody (1:300, Jackson ImmunoResearch). APC-conjugated rat IgG2a or IgG2b, κ isotype control antibody was used as control. DAPI was added to stain dead cells. Attune NxT Flow Cytometer (Lifetechnologies) was used for data collection. B6 wild-type adult hepatocytes, which were stained with only DAPI, was used for making the threshold of YFP signal.

Microarray analysis

One-color microarray-based gene expression analysis was performed using a SurePrint G3 Human Gene Expression v3 8 × 60K Microarray Kit (Agilent, Santa Clara, CA) following the manufacturer’s instructions. The 75th percentile shift normalization was performed using GeneSpring software (Agilent).

Induction of hepatic differentiation of hCLiPs

hCLiPs were harvested using TrypLE Express (Life Technologies) and reseeded into a collagen I-coated 24-well plate at a density of 5 × 104 cells/well (2.5 × 104 cells/cm2). When cells reached approximately 50–80% confluency, culture medium was replaced by SHM supplemented with 2% FBS, 0.5 mM A-83–01, and 3 mM CHIR99021 in the absence (Hep-i(-)) or presence (Hep-i(+)) of 5 ng/ml human OSM (R and D) and 10−6 M dexamethasone. Cells were cultured for a further 6 days and fresh medium was provided every 2 days. On D6, cells were overlaid with a mixture of Matrigel (Corning, Corning, NY) and the aforementioned hepatic induction medium at a ratio of 1:7 and cultured for another 2 days. Thereafter, Matrigel was removed via aspiration, samples were washed with Hank’s Balanced Salt Solution supplemented with Ca2+ and Mg2+ (Life Technologies), and cells were used for RNA extraction or CYP induction experiments.

CYP induction

SHM containing 2% FBS, but not A-83–01 or CHIR99021, was used as basal medium. CYP3A and CYP2B6 were induced via treatment with 10 μM rifampicin and 1 mM phenobarbital. An equal volume of methanol (1/100 dilution) and H2O (1/1000 dilution) was used as the vehicle control for rifampicin and phenobarbital, respectively. CYP1A2 was induced via treatment with 50 μM omeprazole, and methanol (1/100 dilution) was used as the vehicle control. Each CYP induction medium was replaced by freshly prepared medium every day. After 3 days, CYP activity was measured by LC-MS/MS.

CYP activity assay using a cocktail of substrates

Cells were cultured in phenol red-free William’s E medium supplemented with a cocktail of substrates (1/100 dilution) at 37°C for 1 hr. This cocktail contained 40 μM phenacetin as a CYP1A2 substrate, 50 μM bupropion as a CYP2B6 substrate, 0.1 μM amodiaquin as a CYP2C8 substrate, 5 μM diclofenac as a CYP2C9 substrate, 100 μM S-mephenytoin as a CYP2C19 substrate, 5 μM bufuralol as a CYP2D6 substrate, 5 μM midazolam as a CYP3A substrate, and 100 μM 7-hydroxycoumarin as a UGT and SULT substrate. Thereafter, the culture supernatant was harvested and metabolites were quantified by LC-MS/MS as described previously (Kozakai et al., 2012) with minor modifications.

Measurement of CYP protein expression

CYP protein levels were measured as described previously (Kawakami et al., 2011) with minor modifications. After trypsin digestion of cells, the target peptide of each CYP isoform was absolutely quantified by LC-MS/MS. The expression levels of each CYP were quantified using previously described peptide standards (Kawakami et al., 2011).

Measurement of cellular DNA

The cellular DNA content was measured to estimate the number of cells for CYP induction experiments. Following removal of Matrigel via aspiration, cells were washed once with phosphate-buffered saline (PBS) and any remaining Matrigel was removed by treating cells with Cell Recovery Solution (Corning) at 4°C for approximately 30 min. Thereafter, cells were washed once with PBS, and the cellular DNA content was determined using a DNA Quantity Kit (Cosmobio, Tokyo, Japan). To estimate the cell number from the DNA content, the correlation between these two parameters was determined using a dilution series of hCLiPs derived from each lot.

qRT-PCR

Total RNA was isolated using an miRNeasy Mini Kit (QIAGEN, Venlo, The Netherlands). Reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Life Technologies) according to the manufacturer’s guidelines. cDNA was used for PCR with Platinum SYBR Green qPCR SuperMix UDG (Lifetechnologies). Expression levels of target genes were normalized against that of ACTB as an endogenous control. The primers used for qRT-PCR are listed in the following table.

Primers for qRT-PCR

Immunocytochemistry (ICC)

The antibodies used for ICC are listed in the table below. Cells were fixed in chilled methanol (−30°C) on ice for 5 min. In some experiments, cells were fixed in 4% paraformaldehyde (PFA) (Wako, Osaka, Japan) at room temperature for 15 min and permeabilized by treatment with PBS containing 0.05% Triton X-100 for 15 min. Thereafter, cells were washed three times with PBS, incubated in Blocking One solution (Nacalai Tesque, Kyoto, Japan) at 4°C for 30 min, and labeled with primary antibodies at room temperature for 1 hr or at 4°C overnight. The primary antibodies were detected using Alexa Fluor 488- or Alexa Fluor 594-conjugated secondary antibodies (Life Technologies). Nuclei were counterstained with Hoechst 33342 (Dojindo).

Antibodies for ICC

IHC

The antibodies used for IHC are listed in the table below. Formalin-fixed paraffin-embedded (FFPE) tissue samples were prepared. Following dewaxing and rehydration, heat-induced epitope retrieval was performed by boiling specimens in ImmunoSaver (Nissin EM, Tokyo, Japan) diluted 1/200 at 98°C for 45 min. Endogenous peroxidase was inactivated by treating specimens with methanol containing 0.3% H2O2 at room temperature for 30 min. Thereafter, specimens were permeabilized with 0.1% Triton X-100, treated with Blocking One solution at 4°C for 30 min, and incubated with primary antibodies at room temperature for 1 hr or at 4°C overnight. Sections were stained using ImmPRESS IgG-peroxidase kits (Vector Labs, Burlingame, CA) and a metal-enhanced DAB substrate kit (Life Technologies), according to the manufacturers’ instructions. Finally, specimens were counterstained with hematoxylin, dehydrated, and mounted. FFPE tissue samples were used for fluorescence IHC unless otherwise stated. Following dewaxing and rehydration, heat-induced epitope retrieval was performed by boiling specimens in ImmunoSaver (Nissin EM) diluted 1/200 at 98°C for 45 min and then the following staining steps were performed. Fresh frozen tissue blocks prepared using Tissue-Tek O.C.T. Compound (Sakura Finetek, Tokyo, Japan) were used for CYP1A2 and CYP3A4 staining. Fresh frozen liver sections prepared using a cryostat (Leica) were fixed in chilled (−30°C) acetone (Wako) for 5 min, washed three times with PBS, permeabilized with 0.1% Triton X-100, and treated with Blocking One solution at 4°C for 30 min. Thereafter, specimens were incubated with primary antibodies at room temperature for 1 hr or at 4°C overnight and then stained with a mixture of an Alexa Fluor 488-conjugated antibody (Invitrogen) (1:500) and an Alexa Fluor 594-conjugated antibody (Invitrogen) (1:500) at room temperature for 1 hr. Stained sections were mounted using Vectashield mounting medium containing DAPI (Vector Laboratories).

Antibodies for IHC

Liver repopulation assay using cDNA-uPA/SCID mice hCLiPs derived from three lots of cells were used. For lots FCL and JFC, primary cultured cells at D11–14 (P0-hCLiPs), cells passaged once (P1-hCLiPs), and cells passaged twice (P2-hCLiPs) were used. For lot FCL, P4-hCLiP transplantation was also performed. For lot DUX, P0-hCLiPs were used. After harvesting cells using TrypLE Express, 0.2–1 × 106 cells/mouse were intrasplenically transplanted into 2–4 week-old cDNA-uPA/SCID mice (PhoenixBio Co., Ltd, Higashihiroshima, Japan) under isoflurane anesthesia. From 2 weeks after transplantation, 10 μl blood was retro-orbitally collected each week and the hALB concentration was measured using a Human Albumin ELISA Quantitation Kit (Bethyl, TX) or a Latex agglutination turbidimetric immunoassay with a BioMajesty analyzer (JCA-BM6050; JEOL, Tokyo, Japan). Livers were extracted at 8–11 weeks after transplantation and histologically analyzed. The transplantation experiments were approved by animal care committee.

Liver repopulation assay using TK-NOG mice with P0-hCLiPs

FCL-P0-hCLiPs were used. Seven-week-old TK-NOG mice were obtained from the Central Institute of Experimental Animals (Kawasaki, Japan). One day after arrival at the National Cancer Center, mice were intraperitoneally injected with 10 mg/ml ganciclovir (Mitsubishi Tanabe Pharma Corporation, Osaka, Japan) at a dose of 10 μl/g body weight to induce thymidine kinase-mediated injury in host mouse hepatocytes. One week after injection, approximately 30 μl blood was obtained from the tail. Serum was separated and diluted 1/5 with PBS, and the serum ALT level was measured using a DRI-CHEM 3500 analyzer (Fujifilm, Tokyo, Japan). Mice with serum ALT levels of 500–1600 U/l were chosen as host animals for transplantation. At 1–3 days after ALT measurement, 0.4–1 × 106 cells were intrasplenically transplanted into these mice under isoflurane anesthesia. From 2 weeks after transplantation, approximately 20 μl blood was collected each week from the tail and the hALB concentration was measured using a Human Albumin ELISA Quantitation Kit (Bethyl, Montgomery, TX). Livers were extracted at 8–10 weeks after transplantation and histologically analyzed. The transplantation experiments were approved by animal care committee.

Liver repopulation assay using TK-NOG mice with P3-hCLiPs

For transplantation of FCL-P3-hCLiPs, EPCAM+ FCL-hCLiPs were magnetically sorted at the first passage (using P0 hCLiPs) by MACS cell sorting system using MidiMACS Separator (Miltenyi) using CD326 (EpCAM) MicroBeads (Miltenyi). These EPCAM+ cells were subjected to another two passages (P3 in total). During the culture at P3, we separated these cells to two groups, one with hepatic induction (P3 Hep-i(+)) and the other without hepatic induction (P3 Hep-i(-)). 1 × 106 cells/mouse were transplanted into GCV-treated TK-NOG mice as described before. Throughout this experiment, hCLiPs were cultured in a slightly different condition from other experiments (FBS concentration was 5% instead of 10%), but we do not think the obtained results were severely changed by this minor modification. Hepatic induction was conducted in SHM supplemented with 5%FBS and AC with 10 ng/ml hOSM (matrigel was not used). The transplantation experiments were approved by animal care committee.

Estimation of RIs

Unless otherwise stated, RIs were estimated based on CYP2C positivity using image analysis software and a Keyence BZX-710 microscope. RIs in chimeric mice that were sacrificed to isolate primary hepatocytes were estimated based on magnetic bead separation, as described in the following section.

Isolation of human hepatocytes from chimeric livers of cDNA-uPA/SCID mice

Hepatocytes were isolated from chimeric livers of cDNA-uPA/SCID mice at 10 weeks after transplantation of FCL-P1-hCLiPs, DUX-P0-hCLiPs, and JFC-P0-hCLiPs using a two-step collagenase perfusion method. To remove contaminating mouse hepatocytes, isolated cells were incubated with the 66Z antibody, which recognizes the surface of mouse hepatocytes, but not of human hepatocytes (Yamasaki et al., 2010). Cells were washed with DMEM containing 10% FBS and then incubated with Dynabeads M450-conjugated sheep anti-rat IgG (Dynal Biotech, Milwaukee, WI) for 30 min on ice. The tube was placed in a Dynal MPC-1 holder (Dynal Biotech) for 1–2 min to remove 66Z+ mouse hepatocytes. Human hepatocytes were collected as 66Z- cells. 66Z+ and 66Z- hepatocytes were counted using a hemocytometer before and after magnetic separation to estimate the repopulation efficiency and purity of human hepatocytes after separation, respectively.

Culture of chimeric liver-derived human hepatocytes

Magnetically purified human hepatocytes were resuspended in SHM containing 2% FBS and seeded into a 24-well collagen I-coated plate. One day later, RNA was prepared from cells in some wells for microarray-based transcriptomic analysis. As a control, RNA was also prepared from hepatocytes isolated from the chimeric liver of a mouse transplanted with IPHHs (lot JFC) immediately after thawing the original cell suspension (kindly prepared by PhoenixBio Co., Ltd). Other hCLiP-derived hepatocytes were used for the CYP activity assay, as described above.

Statistics

Data represent the mean ± SEM of independently repeated experiments or the mean ± SD of technical replicates in separate culture wells. Two groups were statistically compared using the Student’s t-test, unless otherwise stated. Time-dependent alteration of gene expression was analyzed by the linear mixed models using IBM SPSS Statistics 23 (SPSS Inc, Chicago, IL). Group allocation (FBS or FAC), time (culture period [day]), and the interaction of group and time were included in the model as fixed effects. A p-value less than 0.05 was considered statistically significant.

Accession numbers

Microarray transcriptome data are available with accession numbers GSE133776 (Reprogramming of primary human hepatocytes (PHHs) into hCLiPs); GSE133777 (Hepatic induction of hCLiPs); GSE133778 (Characterization of long term-cultured of hCLiPs); GSE133779 (Transcriptomic analysis of PHHs isolated from hCLiP-transplanted mouse chimeric liver). GSE133776-GSE133779 are included in Superseries GSE133797. Comparative analysis of IPHH and APHH transcriptome is available with an accession number GSE134672. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Generation of human hepatic progenitor cells with regenerative and metabolic capacities from primary hepatocytes" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by a Reviewing Editor and Anna Akhmanova as the Senior Editor. The following individual involved in review of your submission has agreed to reveal his identity: Bruce Wang (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. Summary: There is great interest in ex vivo sources of hepatocytes for transplantation or experimental studies. Derivation or expansion of these cells from ESCs or IPSCs or hepatocytes have not been satisfactory in terms of their ability to repopulate mice. Here, the authors explore a combination of factors plus FBS that causes the proliferation of infant but not adult hepatocytes and thus allows for the expansion of this population in vitro and in vivo. Upon addition of maturation media, there is also an increase in differentiation gene expression and a decrease of proliferation genes. This is important because it shows that the proliferating hepatocytes are indeed capable of returning to the well differentiated state. Moreover, there is good CYP expression, which allows for drug studies. Transplantation into a liver damage model shows that these cells can recover up to 90% of the recipient livers, although the effects are highly variable between animals. Overall, this is a compelling and balanced presentation of a new protocol for expansion and differentiation of hepatocytes from an infant hepatic source. This adds to the discussion about best ways to promote hepatocyte expansion. The results are significant, and the work is done well, but there were concerns about cell purity, limits to passaging ability, and there needs to be more discussion about how the paper compares to other methods of expanding hepatocytes. Since their main reason to moving to young human cells is that they can be expanded more, we think it's crucial that they transplant the later passage cells. Essential revisions: The key requests that need to be addressed by experimental work are to transplant later passage cells and to do some purifications or elucidation of heterogeneity of cells in the culture. 1) There is no comment about the mechanisms or targets of the small molecules used and how this allows for proliferation ex vivo. At least a discussion about all of the relevant molecules is needed, as well as a comparison with other approaches, ie Hui et al. 2) One issue that consistently comes up in this paper is the heterogeneity in the cell culture samples. The authors should clarify whether this is due to contamination in their source hepatocytes with non-hepatocytes, or if the culture conditions generate heterogeneous cell fates. If due to contamination with non-hepatocytes, can the authors purify the cells before culturing? If they continue to find heterogeneity in their culture conditions despite starting with a pure hepatocyte population, it would be important to discuss why this might be occurring. 3) Related to the above point, the use of bulk gene expression profiling to make inferences about the cell types involved is not that definitive, and thus it would be better to minimize these inferences. For example, in subsection “Characterization of proliferating cells cultured in FAC” there is a lot of discussion about potential gene expression correlates of possible cell types, and it is not clear if this is true. It is not certain that TGFB signaling really says that there is a presence of fibroblastic LPCs in the culture. Single cell sequencing would be better for this. If single cell sequencing will not be done, then the discussion about how bulk sequencing can infer cell populations should be limited. 4) We believe that more transplantation experiments need to be performed in order to (A) understand why the RI is either very high or almost zero, and (B) understand if later passage cells will repopulate. This is the central issue with the first submission of the paper. For A), there needs to be an explanation for why there is a dichotomous result here. Otherwise it is hard to know what the actual RI is for these cells. Related to this, it is unclear how many passages can be performed while retaining hepatic differentiation potential. If the cells cannot be passaged many times, then it will be extremely difficult to generate enough cells for transplantation. Given that the in vitro expansion by passage 2 is limited, can the authors transplant cells after passage 4, when the cells are still relatively pure in vitro and have expanded more extensively. This is a significant issue with the paper, especially if there is going to be no mechanistic exploration of FAC. 5) The data are consistent with two recent publications showing that primary human hepatocytes can be maintained and expanded in vitro (Hu et al., 2018, and Zhang et al., 2018). In particular the paper from Zhang et al., is very comparable to the findings in this paper. Both papers use primary human hepatocytes cultured in 2D culture. The authors need to discuss their findings in the context of these recent publications. In particular, it would be very interesting to compare their culture conditions and results with that of Zhang et al., including the gene expression profiles and proliferative capacity. We have also included the separate reviews for your consideration. Reviewer 1: There is great interest in ex vivo sources of hepatocytes for transplantation or experimental studies. Derivation or expansion of these cells from ESCs or IPSCs or hepatocytes have not been satisfactory in terms of their ability to repopulate mice. Here, the authors explore a combination of factors plus FBS that causes the proliferation of infant but not adult hepatocytes and thus allows for the expansion of this population in vitro and in vivo. Upon addition of maturation media, there is also an increase in differentiation gene expression and a decrease of proliferation genes. This is important because it shows that the proliferating hepatocytes are indeed capable of returning to the well differentiated state. Moreover, there is good CYP expression, which allows for drug studies. Transplantation into a liver damage model shows that these cells can recover up to 90% of the recipient livers, although the effects are highly variable between animals. Overall this is a compelling and balanced presentation of a new protocol for expansion and differentiation of hepatocytes from an infant hepatic source. This adds to the conversation about best ways to promote hepatocyte expansion. Essential revisions: There is no comment about the mechanisms or targets of the small molecules used and how this allows for proliferation ex vivo. At least a discussion about this is needed, and a comparison with other approaches, ie Hui et al. The use of bulk gene expression profiling to make inferences about the cell types involved is not that definitive, and thus i would minimize this. For example, subsection “Characterization of proliferating cells cultured in FAC” there is a lot of discussion about potential gene expression correlates of possible cell types, and I think it is not clear if this is true. I am not sure that TGFB signaling in hips really says that there is a presence of fibroblastic LPCs in the culture. I think single cell sequencing would be better for this. If single cell seq will not be done, then I think the discussion about how bulk seq can infer cell populations should be limited. It is unclear how many passages can be performed while retaining hepatic differentiation potential. If the cells cannot be passage many times, then it will be extremely difficult to generate enough cells for transplantation. I think 5 passages is not that significant. Please comment on this. I believe more transplantation experiments need to be performed in order to understand why the RI is either very high or almost zero. There needs to be an explanation for why there is a dichotomous result here. Otherwise it is hard to know what the actual RI is for these cells, especially those that are in higher passages beyond P1 or P2. This is a significant issue with the paper, especially if there is going to be no mechanistic exploration of FAC. Reviewer 2: In this manuscript, Katsuda et al., follow up their previous rodent study by describing culture conditions that allow for the expansion of primary human hepatocytes. They showed that while adult primary human hepatocytes have limited proliferative capacity in their culture conditions, hepatocytes from young human livers can expand efficiently, and over multiple passages. They show extensive characterization of these in vitro expanded cells, including transplantation into mouse models of liver failure to demonstrate the capacity of these cells to function as hepatocytes in vivo. Overall, this is a well written manuscript, with carefully conducted studies and detailed characterization. It addresses an important bottleneck in the field of liver regenerative medicine, the ability to maintain and expand hepatocytes in vitro for either in vitro drug testing or in vivo transplantation. However, I have a few concerns about the manuscript that need to be addressed prior to publication. My specific comments are below. 1) Their data is consistent with two recent publications showing that primary human hepatocytes can be maintained and expanded in vitro (Hu et al., 2018, and Zhang et al., 2018). In particular the paper from Zhang et al. is very comparable to the findings in this paper. Both papers use primary human hepatocytes cultured in 2D culture. The authors need to discuss their findings in the context of these recent publications. In particular, it would be very interesting to compare their culture conditions and results with that of Zhang et al., including the gene expression profiles of and proliferative capacity. 2) One issue that consistently comes up in this paper is the heterogeneity in their cell culture samples. The authors should clarify whether this is due to contamination in their source hepatocytes with non-hepatocytes, or if the culture condition generates heterogeneous cell fates. If due to contamination with non-hepatocytes, can they purify the cells before culturing? If they continue to find heterogeneity in their culture conditions despite starting with a pure hepatocyte population, it would be interesting to separate the different resulting cell populations in vitro and analyze them separately. 3) In transplantation studies, the authors state in the text that repopulation capacity declines as culture period increased, but this is not clearly seen in figure 5C. Since the authors think the uPA/SCID mice have lower engraftment efficiency, it would be nice to see transplantation of P1 and P2 cells in the TK-NOG mice. 4) The in vitro expansion by passage 2 is limited. Can they transplant cells after passage 4, when the cells are still relatively pure in vitro and have expanded more extensively? 5) Characterization of the gene expression and enzymatic function in vitro is well done. Goes farther than similar articles in this respect and provides good rational for these cells to be used in in vitro drug metabolism studies. Reviewer 3: Katsuda et al., showed the efficacy of their generated hCLiPs in vitro and in vivo as well as previous rat hepatocyte-derived CLiPs. This progress shown in this paper is important. I have a few concerns and requests about this paper. 1) The authors also expected that hCLiPs would be used in the liver cell transplantation. On the other hand, it was difficult to generate hCLiPs from adult human hepatocytes. As you know, infant liver donor is shortage actually. The authors need to assess the mechanism of difficulties in the generation of CLiPs from adult hepatocytes. 2) The authors showed that the combination of defined chemicals (A-83-01 and CHIR99021) and FBS is essential for hCLiPs-generation. The authors are requested to explain the functions of Y(Y-27632) which is not included. […] The results are significant, and the work is done well, but there were concerns about cell purity, limits to passaging ability, and there needs to be more discussion about how the paper compares to other methods of expanding hepatocytes. Since their main reason to moving to young human cells is that they can be expanded more, we think it's crucial that they transplant the later passage cells. […] Reviewer 1: There is great interest in ex vivo sources of hepatocytes for transplantation or experimental studies. Derivation or expansion of these cells from ESCs or IPSCs or hepatocytes have not been satisfactory in terms of their ability to repopulate mice. Here, the authors explore a combination of factors plus FBS that causes the proliferation of infant but not adult hepatocytes and thus allows for the expansion of this population in vitro and in vivo. Upon addition of maturation media, there is also an increase in differentiation gene expression and a decrease of proliferation genes. This is important because it shows that the proliferating hepatocytes are indeed capable of returning to the well differentiated state. Moreover, there is good CYP expression, which allows for drug studies. Transplantation into a liver damage model shows that these cells can recover up to 90% of the recipient livers, although the effects are highly variable between animals. Overall this is a compelling and balanced presentation of a new protocol for expansion and differentiation of hepatocytes from an infant hepatic source. This adds to the conversation about best ways to promote hepatocyte expansion. First of all, we sincerely appreciate the reviewer for carefully reading our manuscript and providing us insightful comments. As indicated in the point-by-point responses below, we have taken all of your comments and suggestions into account in the revision of this manuscript. We hope that you will consider our responses as satisfactory. Essential revisions: There is no comment about the mechanisms or targets of the small molecules used and how this allows for proliferation ex vivo. At least a discussion about this is needed, and a comparison with other approaches, ie Hui et al. To address the request by the reviewer, we added two paragraphs to the Discussion section. In the third paragraph, we discussed the possible mechanism underlying small molecule-mediated induction of proliferation of PHHs, and in the fourth paragraph we compared our study and the recently published similar works (Fu et al., 2018; Hu et al., 2018; Kim et al., 2018; Zhang et al., 2018). In addition to these discussions, we also performed microarray analysis to compare the responsiveness to FAC of IPHHs (infant PHHs) and APHHs (adult PHHs) (Figure 3, and its supplementary figures). The results suggested that IPHHs are more sensitive to CHIR99021 than adult PHHs, since Wnt signaling was more efficiently upregulated in IPHHs. The use of bulk gene expression profiling to make inferences about the cell types involved is not that definitive, and thus i would minimize this. For example, in subsection “Characterization of proliferating cells cultured in FAC” there is a lot of discussion about potential gene expression correlates of possible cell types, and I think it is not clear if this is true. I am not sure that TGFB signaling in hips really says that there is a presence of fibroblastic LPCs in the culture. I think single cell sequencing would be better for this. If single cell seq will not be done, then I think the discussion about how bulk seq can infer cell populations should be limited. As per the comment, we deleted the part which this reviewer pointed out. Accordingly, we also deleted the corresponding GSEA data. It is unclear how many passages can be performed while retaining hepatic differentiation potential. If the cells cannot be passaged many times, then it will be extremely difficult to generate enough cells for transplantation. I think 5 passages is not that significant. Please comment on this. As shown in Figure 6, we described that hCLiPs can be differentiated into functional hepatocytes until passage 5. At the end of the 5th passage, we can obtain 1.2 ± 0.35 x 108, 3.3 ± 0.44 x 107 and 2.0 x 106 hCLiPs from one starting PHH for lots FCL, DUX and JFC, respectively. We believe these data suggest substantial benefit of using hCLiPs, given the limited availability of PHHs. Also please note that the in vitro proliferative capacity of hCLiPs is much higher than that reported in the recently reported similar papers: FCL and DUX hCLIPs underwent 2.9 x 1013- and 2.2 x 1012-fold expansion at the end of P10 culture, and JFC hCLiPs underwent 2.0 x 106-fold expansion at the end of P5. In contrast, Zhang et al. reported that ProliHH achieved 1,000- to 10,000-fold expansion at P8; this fold-expansion is nearly equivalent to that of hCLiPs at P3 (Zhang et al., 2018). Kim et al. reported that hCdHs were passaged at 1:3-1:5 in each passage, which corresponds to 5.9 x 104 – 9.7 x 106-fold expansion at P10; this fold-expansion is nearly equivalent to that of hCLiPs at P4-5 (Kim et al., 2018). I believe more transplantation experiments need to be performed in order to understand why the RI is either very high or almost zero. There needs to be an explanation for why there is a dichotomous result here. Otherwise it is hard to know what the actual RI is for these cells, especially those that are in higher passages beyond P1 or P2. This is a significant issue with the paper, especially if there is going to be no mechanistic exploration of FAC. Given that three lots of hCLiPs consistently exhibited the dichotomous results in transplantation experiment, we think this is the nature of hCLiPs. Although we do not have any evidence, it seems to us that the high/low RI is determined by the initial engraftment efficiency. Whether this idea is correct or not, and if it is correct, what molecular mechanism specifically determines the successful engraftment must be addressed in future studies. This reviewer requested to increase the “n” by repeating the same transplantation experiment. We acknowledge that this is an important comment. However, the editor suggested us to rather perform repopulation experiments using hCLiPs at later passages. Following the editor’s suggestion, we performed repopulation study using FCL-P3-hCLiPs and FCL-P4-hCLiPs, which were transplanted to TK-NOG and cDNA-uPA/SCID mice, respectively. As you can see in Figure 8—figure supplement 1, repopulation efficiency of hCLiPs at late passages is overall much lower than that at early passage (P0-P1). We sincerely accept that the low repopulation efficiency of late passaged hCLiPs is one of the critical limitations in our study. Reviewer 2: […] Overall, this is a well written manuscript, with carefully conducted studies and detailed characterization. It addresses an important bottleneck in the field of liver regenerative medicine, the ability to maintain and expand hepatocytes in vitro for either in vitro drug testing or in vivo transplantation. However, I have a few concerns about the manuscript that need to be addressed prior to publication. My specific comments are below. First of all, we appreciate your time and effort in reviewing our paper. Your valuable comments provided significant help in improving our manuscript. We have modified our former version to address your requests. As indicated in the point-by-point responses below, we have taken all of your comments and suggestions into account in the revision. We hope that you will consider our responses as satisfactory. 1) Their data is consistent with two recent publications showing that primary human hepatocytes can be maintained and expanded in vitro (Hu et al., 2018, and Zhang et al., 2018). In particular the paper from Zhang et al., is very comparable to the findings in this paper. Both papers use primary human hepatocytes cultured in 2D culture. The authors need to discuss their findings in the context of these recent publications. In particular, it would be very interesting to compare their culture conditions and results with that of Zhang et al., including the gene expression profiles of and proliferative capacity. We added two paragraphs to Discussion section. In the third paragraph, we discussed the possible mechanism underlying small molecule-mediated induction of proliferation of PHHs, and in the fourth paragraph we compared our study with the recently published similar studies (Fu et al., 2018; Hu et al., 2018; Kim et al., 2018; Zhang et al., 2018). 2) One issue that consistently comes up in this paper is the heterogeneity in their cell culture samples. The authors should clarify whether this is due to contamination in their source hepatocytes with non-hepatocytes, or if the culture condition generates heterogeneous cell fates. If due to contamination with non-hepatocytes, can they purify the cells before culturing? If they continue to find heterogeneity in their culture conditions despite starting with a pure hepatocyte population, it would be interesting to separate the different resulting cell populations in vitro and analyze them separately. We do not think it is feasible to purify cells before culturing, because almost none of LPC markers or an NPC marker are expressed in the initial PHH source (Figure 2—figure supplement 2B, Author response image 1). To investigate the population heterogeneity of the starting PHHs, we performed flow cytometry using PHHs immediately after thawing the cryopreserved cell stocks. A hepatic surface marker DPP4/CD26 expression was detected in each of the tested cells (except JFC PHHs, in which this antigen was accidentally not tested), thereby confirming that surface antigens of these cells were at least partly preserved even after a freeze/thaw cycle. We tested the surface expression of LPC markers EPCAM, PROM1, CD24, CD44 and ITGA6. Except for ITGA6, none of these surface proteins were detected in these cells. ITGA6 expression in PHHs, including APHHs (HC5-25, derived from a 56 year-old donor), was surprising to us. Thus, we interrogated whether this slight ITGA6 expression in PHHs would be caused by LPC contamination or a nature of primary hepatocytes, using a mouse lineage tracing model. We genetically labeled hepatocytes with YFP by injecting AAV-TBG-Cre to a RosaYFP adult mouse, harvested its hepatocytes, and performed flow cytometry. While YFP+ hepatocytes were negative for any of Epcam, Prom1 and Cd24, we observed a slight signal of Itga6 (Figure 2—figure supplement 2C), just like in the case of human hepatocytes. Thus, we conclude that the slight expression of ITGA6 in PHHs does not reflect LPC contamination. As pointed out by the reviewer, we also investigated the contamination of fibroblastic cells with the use of general fibroblastic marker, THY1/CD90. THY1 expression in FCL hCLiPs was negligible (Author response image1), indicating that our starting cells are mostly composed of PHHs.
Author response image 1.
Nonetheless, we know that morphologically fibroblastic cells emerge during culture, and thus we carefully followed up the cultured cells using THY1 antibody in combination with LPC markers. After primary expansion of hCLiPs (P0), we confirmed that a certain population of cells were THY1+. Without genetic lineage tracing, which is practically unfeasible with PHHs, we cannot determine whether these cells were derived from minimally-contaminated fibroblasts or cells de-differentiated from PHHs per se. Thus, we refrained from discussing much about the cellular origin of these cells in the manuscript. Then, we sorted LPC marker+THY1- putative LPC fractions and LPC marker-THY+ fractions, and compared their gene expression profiles using a panel of genes (LPC markers, hepatic markers and fibroblastic markers). As expected, LPC marker+THY1- populations were rich in LPC/hepatic cells, while LPC marker-THY1+ populations were rich in fibroblastic cells (Figure 7B). We then continued culture of these cells for another two weeks and followed up their gene expression profiles. The sorted populations still maintained their characteristics partly, but LPC marker-THY1+ cells again emerged in LPC marker+THY1- fractions, suggesting that LPC marker-THY1+ cells which were not fully excluded by sorting grew in these fractions in the following culture. Moreover, we noted the substantial reduction in the expression of hepatic genes in LPC marker+THY1- fractions when compared with P0 cells (Figure 7—figure supplement 2). Thus, we conclude that surface marker-based selection can temporarily enrich LPC/hepatic cells, but the decline of hepatic/LPC phenotype in hCLiPs is unavoidable at least in the present sorting strategy and culture condition. 3) In transplantation studies, the authors state in the text that repopulation capacity declines as culture period increased, but this is not clearly seen in figure 5C. Since the authors think the uPA/SCID mice have lower engraftment efficiency, it would be nice to see transplantation of P1 and P2 cells in the TK-NOG mice. In our pilot study, we transplanted FCL-hCLiPs which were enriched for EPCAM expression by MACS at the first passage (namely, using P0 cells) and subsequently passaged twice (thus, P3 in total). Since we supposed that the reduction of repopulative capacity of hCLiPs in the later passages was largely due to the loss of hepatic phenotype, we also prepared hCLiPs with hepatic induction (Hep-i(+) cells). The data indicated that Hep-i(+) hCLiPs had higher repopulative capacity than Hep-i(-) cells. However, the repopulative capacity of Hep-i(+)-P3-hCLiPs was still much lower than P0-hCLiPs, highlighting the difficulty for hCLiPs to retain their repopulative capacity after extended culture periods. By the way, in this experiment (which was a part of our pilot study), hCLiPs were cultured in a slightly different condition (FBS concentration was 5% instead of 10%. But we do not think that the obtained results would be severely changed, so we provided the data in Figure 8—figure supplement 1C. 4) The in vitro expansion by passage 2 is limited. Can they transplant cells after passage 4, when the cells are still relatively pure in vitro and have expanded more extensively? We transplanted FCL-P4-hCLiPs to cDNA-uPA/SCID mice (n = 3). Although each mouse exhibited increase in blood hALB levels, its increasing rate was much slower than that of highly repopulated mice which were transplanted with P0- or P1-FCL-hCLiPs (Figure 8—figure supplement 1A). CYP2C IHC indicated that RIs were < 1% for each of the P4-hCLiP-transplanted animals 8 weeks after transplantation (Figure 8—figure supplement 1B). Because we observed very few foci formed in these mice, it seems that engraftment of hCLiPs at later passages were much less efficient than that at earlier passages. On the other hand, we caution reviewers about the interpretation of the results regarding in vitro cellular expansion and repopulation. First, we noted that fold expansion of hCLiPs at P0-P2 are comparable to that of ProliHH at P4-P6 (Zhang et al., 2018). When comparing our study with Zhang et al’s one, it seems more appropriate to use the term “fold expansion” (from the initial cell number) rather than “passage number” to indicate the age of cultured cells. According to Figure S5A in Zhang et al.’s study, “Early ProliHH (P4)” and “Late ProliHH (P6)” underwent approximately 400- and 1000- fold expansion from the initial cell number (also note that their passage counting is different from ours: P4 and P6 in their counting system correspond to P3 and P5 based on our passage counting) (Author response image 2A). FCL hCLiPs underwent > 40- fold expansion during primary culture (P0), approximately 1000-fold expansion at the endpoint of P1 (FCL-hCLiPs expand approximately 25-fold during P1 culture), and 6.4 x 106-fold expansion at the end of P4 (Author response image 1B). Thus, to our surprise, the fold expansion of our FCL P1 hCLiPs is comparable to that of Zhang et al.’s “Late ProliHH”. In our study, JFC-hCLiPs exhibited obviously slower growth rate compared to FCL- and DUX-hCLiPs (Figure 6A). Nonetheless, we confirmed that JFC-hCLiPs at P2, which exhibited high RIs in 2 of 3 transplanted mice, underwent 456 ± 156-fold expansion (n = 2) at the end of P2 (see Author response image 2B), which is comparable to that achieved by ProliHH at P3-P5. We mentioned this issue concisely in the Results section.
Author response image 2.

Comparison between ProliHHs and hCLiPs in terms of in vitro growth rates.

(A) According to Figure S5A in Zhang et al., 2018, Early ProliHH and Late ProliHH underwent approximately 200 and 1000 fold expansion from the starting cell number. Note that our passage counting manner is different from theirs. (B) FCL hCLiPs underwent > 40-fold expansion during primary culture (P0), approximately 1000-fold expansion at P1, and 6.4 x 106-fold expansion at P4. It should be noted that our P1 cells correspond to Zhang et al.’s P6 cells in terms of fold expansion form the initial cell number.

Comparison between ProliHHs and hCLiPs in terms of in vitro growth rates.

(A) According to Figure S5A in Zhang et al., 2018, Early ProliHH and Late ProliHH underwent approximately 200 and 1000 fold expansion from the starting cell number. Note that our passage counting manner is different from theirs. (B) FCL hCLiPs underwent > 40-fold expansion during primary culture (P0), approximately 1000-fold expansion at P1, and 6.4 x 106-fold expansion at P4. It should be noted that our P1 cells correspond to Zhang et al.’s P6 cells in terms of fold expansion form the initial cell number. Second, we noted that the repopulation rate (speed) is very different between hCLiPs and ProliHH. When hCLiPs achieved high RI, blood hALB levels reached 1 mg/ml as early as at 30 days post transplantation (Author response image 2B), whereas ProliHH even at early passage (P4) reached this level approximately at 120 days post transplantation; they reached approximately 30-40 μg/ml (estimation from the graph) at 30 days post transplantation (see Author response image 3A). This finding implies differences in repopulation modes between hCLiPs at early passage and ProliHH at both early and late passages. Another finding was that when we adjusted the range of x-axis to the 0-180 days post transplantation (same as ProliHH data), repopulation rate of FCL-P4-hCLiPs was comparable with that of Late ProliHH. Since FCL-P4-hCLiP’s hALB increasing rate was much slower than we expected based on our previous observation with P0- or P1-hCLiPs, we quitted this experiment at the standard endpoint of our experiment (8 weeks post transplantation). But, if we had extended this transplantation study until 150 days, it could be possible for P4 hCLiPs to achieve similar RI levels as ProliHH. However, this comparative investigation includes uncertain assumption/imagination which we are afraid to be “over-speculation”, and thus we did not include this discussion in our manuscript.
Author response image 3.

Comparison between ProliHHs and hCLiPs in terms of their repopulation efficiency.

(A)Repopulation experiments in FRG mice using ProliHHs at early (P4) and late (P6) passages. Data are adapted from Supplementary Figure S6G (Zhang et al., 2018).(B)hCLiP (lot FCL) repopulation experiment data (cDNA-uPA/SCID) at early (P0 and P1) and at late (P4) passages are adapted from Figure 6—figure supplement 1C of the present study. JFC (P0, P1, P2) blood hALB data are adapted from Figure 6A in the present study. We omitted data for individuals without substantial repopulation from hCLiPs at early passages and added extended the range of x-axis, to make the comparison with our data and Zhang et al’s data easier.

Comparison between ProliHHs and hCLiPs in terms of their repopulation efficiency.

(A)Repopulation experiments in FRG mice using ProliHHs at early (P4) and late (P6) passages. Data are adapted from Supplementary Figure S6G (Zhang et al., 2018).(B)hCLiP (lot FCL) repopulation experiment data (cDNA-uPA/SCID) at early (P0 and P1) and at late (P4) passages are adapted from Figure 6—figure supplement 1C of the present study. JFC (P0, P1, P2) blood hALB data are adapted from Figure 6A in the present study. We omitted data for individuals without substantial repopulation from hCLiPs at early passages and added extended the range of x-axis, to make the comparison with our data and Zhang et al’s data easier. 5) Characterization of the gene expression and enzymatic function in vitro is well done. Goes farther than similar articles in this respect and provides good rational for these cells to be used in in vitro drug metabolism studies. We are pleased to have this comment. Reviewer 3: Katsuda et al., showed the efficacy of their generated hCLiPs in vitro and in vivo as well as previous rat hepatocyte-derived CLiPs. This progress shown in this paper is important. I have a few concerns and requests about this paper. First of all, we wish to express our sincere thanks for your critical reading of our manuscript and your thoughtful comments and suggestions. As indicated in the point-by-point responses below, we have taken all of the comments and suggestions into account in our revision of this manuscript. We have provided additional data to support our conclusions, and thus, we hope that you will consider our responses to be satisfactory. 1) The authors also expected that hCLiPs would be used in the liver cell transplantation. On the other hand, it was difficult to generate hCLiPs from adult human hepatocytes. As you know, infant liver donor is shortage actually. The authors need to assess the mechanism of difficulties in the generation of CLiPs from adult hepatocytes. To investigate the difference in the responsiveness to FAC of IPHHs and APHHs, we compared their transpcriptome by microarray analysis. As described in the new subsection “Comparison of IPHHs and APHHs in terms of their responsiveness to FAC” (data are provided in Figure 3), it was suggested that the lower proliferative capacity of APHHs might be partly explained by their lower responsiveness to Wnt signaling. 2) The authors showed that the combination of defined chemicals (A-83-01 and CHIR99021) and FBS is essential for hCLiPs-generation. The authors are requested to explain the functions of Y(Y-27632) which is not included. We performed a mini-screen using all possible combinations of Y, A and C in 10% FBS-supplemented SHM, and found that the combination of AC rather than YAC allows PHHs to proliferate most efficiently. We do not have explanation for this observation, and thus we did not provide much discussion about this finding in the manuscript.
GeneForwardReverse
ACTB ACTCTTCCAGCCTTCCTTCCAGCACTGTGTTGGCGTACAG
ALB GCAAGGCTGACGATAAGGAGCCTAAGGCAGCTTGACTTGC
TAT ATCTCTGTTATGGGGCGTTGACTAACCGCTCCGTGAACTC
TTR ATCTCCCCATTCCATGAGCCATTCCTTGGGATTGGTGAC
TDO2 GGTGGTTCCTCAGGCTATCATGTCGGGGAATCAGGTATGT
G6PC CCTTGCTGCTCATTTTCCTCTGTGGATGTGGCTGAAAGTT
CYP1A2 CCCCAAGAAATGCTGTGTCTAGGGCTTGTTAATGGCAGTG
CYP2B6 GGGGCACTGAAAAAGACTGAAGTTCTGGAGGATGGTGGTG
CYP3A4 ATTGGCATGAGGTTTGCTCTCGGGTTTTTCTGGTTGAAGA
EPCAM TGGACATAGCTGATGTGGCTTACCAGGATCCAGATCCAGTTG
PROM1 AGTCGGAAACTGGCAGATAGCGGTAGTGTTGTACTGGGCCAAT
CD24 AGGCGCGGACTTTTCTTTGATGCTGGGTGCTTGGAG
GJB1 CTGCTCTACCCTGGCTATGCGTAGACGTCGCACTTGACCA
THY1 ACCTACACGTGTGCACTCCAGCCCTCACACTTGACCAGTT
ACTA2 CTGTTCCAGCCATCCTTCATGGCAATGCCAGGGTACATAG
VIM TCTGGATTCACTCCCTCTGGGGTCATCGTGATGCTGAGAA
AntibodyHost animalCatalog #DilutionManufacturerFixation
CYP3A4RabbitAb35721:200AbcamMethanol
MRP2MouseAb33731:200AbcamMethanol
HNF4ARabbitsc-89871:200Santa Cruz4% PFA
MDR1Rabbitsc-532411:200Santa CruzMethanol
CYP2CMousesc-532451:200Santa CruzMethanol
CYP1A2Mousesc-532411:200Santa CruzMethanol
TTRRabbitAb758151:500AbcamMethanol
AntibodyHost animalCatalog #DilutionManufacturerTissue type
CYP2CMousesc-532451:200Santa CruzFFPE/frozen
MDR1Rabbitsc-532411:200Santa CruzFFPE
Human MitochondriaMouseab928241:1000AbcamFFPE
Human TTRRabbitab758151:500AbcamFFPE
GLULRabbitab735931:1000AbcamFFPE
Human CYP1A2RabbitBML-CR3130-01001:200EnzoFrozen
Human CYP3A4RabbitBML-CR3340-01001:200EnzoFrozen
  46 in total

Review 1.  Wnt/β-Catenin Signaling in Liver Development, Homeostasis, and Pathobiology.

Authors:  Jacquelyn O Russell; Satdarshan P Monga
Journal:  Annu Rev Pathol       Date:  2017-11-10       Impact factor: 23.472

Review 2.  Assessing the therapeutic potential of lab-made hepatocytes.

Authors:  Milad Rezvani; Andrew A Grimm; Holger Willenbring
Journal:  Hepatology       Date:  2016-05-26       Impact factor: 17.425

3.  Simultaneous absolute quantification of 11 cytochrome P450 isoforms in human liver microsomes by liquid chromatography tandem mass spectrometry with in silico target peptide selection.

Authors:  Hirotaka Kawakami; Sumio Ohtsuki; Junichi Kamiie; Takashi Suzuki; Takaaki Abe; Tetsuya Terasaki
Journal:  J Pharm Sci       Date:  2010-06-16       Impact factor: 3.534

4.  Engrafted human stem cell-derived hepatocytes establish an infectious HCV murine model.

Authors:  Arnaud Carpentier; Abeba Tesfaye; Virginia Chu; Ila Nimgaonkar; Fang Zhang; Seung Bum Lee; Snorri S Thorgeirsson; Stephen M Feinstone; T Jake Liang
Journal:  J Clin Invest       Date:  2014-10-08       Impact factor: 14.808

5.  YAP, but Not RSPO-LGR4/5, Signaling in Biliary Epithelial Cells Promotes a Ductular Reaction in Response to Liver Injury.

Authors:  Lara Planas-Paz; Tianliang Sun; Monika Pikiolek; Nadire R Cochran; Sebastian Bergling; Vanessa Orsini; Zinger Yang; Frederic Sigoillot; Jasna Jetzer; Maryam Syed; Marilisa Neri; Sven Schuierer; Lapo Morelli; Philipp S Hoppe; Wibke Schwarzer; Carlos M Cobos; John L Alford; Le Zhang; Rachel Cuttat; Annick Waldt; Nicole Carballido-Perrig; Florian Nigsch; Bernd Kinzel; Thomas B Nicholson; Yi Yang; Xiaohong Mao; Luigi M Terracciano; Carsten Russ; John S Reece-Hoyes; Caroline Gubser Keller; Andreas W Sailer; Tewis Bouwmeester; Linda E Greenbaum; Jesse J Lugus; Feng Cong; Gregory McAllister; Gregory R Hoffman; Guglielmo Roma; Jan S Tchorz
Journal:  Cell Stem Cell       Date:  2019-05-09       Impact factor: 24.633

6.  Reliable high-throughput method for inhibition assay of 8 cytochrome P450 isoforms using cocktail of probe substrates and stable isotope-labeled internal standards.

Authors:  Kazumasa Kozakai; Yasuhiro Yamada; Motoji Oshikata; Taiji Kawase; Etsuko Suzuki; Yukari Haramaki; Hideki Taniguchi
Journal:  Drug Metab Pharmacokinet       Date:  2012-04-10       Impact factor: 3.614

7.  Susceptibility of chimeric mice with livers repopulated by serially subcultured human hepatocytes to hepatitis B virus.

Authors:  Rie Utoh; Chise Tateno; Chihiro Yamasaki; Nobuhiko Hiraga; Miho Kataoka; Takashi Shimada; Kazuaki Chayama; Katsutoshi Yoshizato
Journal:  Hepatology       Date:  2008-02       Impact factor: 17.425

8.  Expanding hepatocytes in vitro before cell transplantation: donor age-dependent proliferative capacity of cultured human hepatocytes.

Authors:  J Walldorf; H Aurich; H Cai; D Runge; B Christ; S C Strom; W E Fleig
Journal:  Scand J Gastroenterol       Date:  2004-06       Impact factor: 2.423

9.  Mouse liver repopulation with hepatocytes generated from human fibroblasts.

Authors:  Saiyong Zhu; Milad Rezvani; Jack Harbell; Aras N Mattis; Alan R Wolfe; Leslie Z Benet; Holger Willenbring; Sheng Ding
Journal:  Nature       Date:  2014-02-23       Impact factor: 49.962

10.  Expansion and differentiation of human hepatocyte-derived liver progenitor-like cells and their use for the study of hepatotropic pathogens.

Authors:  Gong-Bo Fu; Wei-Jian Huang; Min Zeng; Xu Zhou; Hong-Ping Wu; Chang-Cheng Liu; Han Wu; Jun Weng; Hong-Dan Zhang; Yong-Chao Cai; Charles Ashton; Min Ding; Dan Tang; Bao-Hua Zhang; Yi Gao; Wei-Feng Yu; Bo Zhai; Zhi-Ying He; Hong-Yang Wang; He-Xin Yan
Journal:  Cell Res       Date:  2018-10-25       Impact factor: 25.617

View more
  11 in total

1.  Establishment of human fetal hepatocyte organoids and CRISPR-Cas9-based gene knockin and knockout in organoid cultures from human liver.

Authors:  Delilah Hendriks; Benedetta Artegiani; Huili Hu; Susana Chuva de Sousa Lopes; Hans Clevers
Journal:  Nat Protoc       Date:  2020-11-27       Impact factor: 13.491

Review 2.  Alternative Cell Sources for Liver Parenchyma Repopulation: Where Do We Stand?

Authors:  Tine Tricot; Jolan De Boeck; Catherine Verfaillie
Journal:  Cells       Date:  2020-02-28       Impact factor: 6.600

3.  Puromycin-based purification of cells with high expression of the cytochrome P450 CYP3A4 gene from a patient with drug-induced liver injury (DILI).

Authors:  Shoko Miyata; Noriaki Saku; Saeko Akiyama; Palaksha Kanive Javaregowda; Kenta Ite; Nagisa Takashima; Masashi Toyoda; Kei Yura; Tohru Kimura; Hiroshi Nishina; Atsuko Nakazawa; Mureo Kasahara; Hidenori Nonaka; Tohru Kiyono; Akihiro Umezawa
Journal:  Stem Cell Res Ther       Date:  2022-01-10       Impact factor: 6.832

Review 4.  Induction and Maturation of Hepatocyte-Like Cells In Vitro: Focus on Technological Advances and Challenges.

Authors:  Ye Xie; Jia Yao; Weilin Jin; Longfei Ren; Xun Li
Journal:  Front Cell Dev Biol       Date:  2021-11-26

Review 5.  Hepatocyte organoids and cell transplantation: What the future holds.

Authors:  Weng Chuan Peng; Lianne J Kraaier; Thomas A Kluiver
Journal:  Exp Mol Med       Date:  2021-10-18       Impact factor: 8.718

6.  HepG2-Based Designer Cells with Heat-Inducible Enhanced Liver Functions.

Authors:  Hiroyuki Kitano; Yoshinori Kawabe; Masamichi Kamihira
Journal:  Cells       Date:  2022-04-01       Impact factor: 6.600

7.  Co-culture with mouse embryonic fibroblasts improves maintenance of metabolic function of human small hepatocyte progenitor cells.

Authors:  Srikumar Sengupta; Brian Johnson; Morten Seirup; Hamisha Ardalani; Bret Duffin; Gregory A Barrett-Wilt; Ron Stewart; James A Thomson
Journal:  Curr Res Toxicol       Date:  2020-08-26

Review 8.  Controversies Surrounding the Origin of Hepatocytes in Adult Livers and the in Vitro Generation or Propagation of Hepatocytes.

Authors:  Nicole Min Qian Pek; Kevin J Liu; Massimo Nichane; Lay Teng Ang
Journal:  Cell Mol Gastroenterol Hepatol       Date:  2020-09-28

9.  Survival-Assured Liver Injury Preconditioning (SALIC) Enables Robust Expansion of Human Hepatocytes in Fah-/- Rag2-/- IL2rg-/- Rats.

Authors:  Ludi Zhang; Jian-Yun Ge; Yun-Wen Zheng; Zhen Sun; Chenhua Wang; Zhaoliang Peng; Baihua Wu; Mei Fang; Kinji Furuya; Xiaolong Ma; Yanjiao Shao; Nobuhiro Ohkohchi; Tatsuya Oda; Jianglin Fan; Guoyu Pan; Dali Li; Lijian Hui
Journal:  Adv Sci (Weinh)       Date:  2021-08-11       Impact factor: 16.806

10.  Drug metabolic activity is a critical cell-intrinsic determinant for selection of hepatocytes during long-term culture.

Authors:  Saeko Akiyama; Noriaki Saku; Shoko Miyata; Kenta Ite; Masashi Toyoda; Tohru Kimura; Masahiko Kuroda; Atsuko Nakazawa; Mureo Kasahara; Hidenori Nonaka; Akihide Kamiya; Tohru Kiyono; Tohru Kobayshi; Yasufumi Murakami; Akihiro Umezawa
Journal:  Stem Cell Res Ther       Date:  2022-03-12       Impact factor: 6.832

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.