Literature DB >> 31380420

VEGF Induce Vasculogenic Mimicry of Choroidal Melanoma through the PI3k Signal Pathway.

Xiaoyan Xu1, Yao Zong1, Yunxia Gao2, Xiangrong Sun3, Han Zhao4, Wenjuan Luo1, Shaoyou Jia1.   

Abstract

PURPOSE: To explore the effect of VEGF (vascular endothelial growth factor) on the vasculogenic mimicry (VM) formation of Choroidal Melanoma (CM) through PI3k signal pathway, to find novel targets for CM therapy.
METHODS: This research investigated the molecular mechanism of VEGF promoting VM formation of CM. First, we evaluated the expressions of VEGF in 20 CM specimens by immunohistochemical determination. Then we detected expressions of VEGF, AKT, MT1-MMP, MMP2, and MMP9 of OCM-1 in hypoxia. siRNA was used to inhibit the expression of VEGF, to realize the control of the VM formation. The VM formation was evaluated through wound healing assay, transwell assay, and apoptosis. And then we testify the correlation of the VM and the factors in protein and mRNA level preliminarily.
RESULTS: VEGF protein was expressed in CM in all 20 cases of CM, especially along the VM. In hypoxia, the expression of VEGF in OCM-1 increased significantly. VEGF gene deletion reduced the proliferation, migration, and invasion of OCM-1. VEGF gene deletion impaired the expression of invasive associated genes like VEGF, p-AKT, AKT, MT1-MMP, MMP2, and MMP9. These results indicate that VEGF induce VM formation in CM by activating PI3K/AKT signaling pathway.
CONCLUSIONS: VEGF promoted VM formation by the PI3K signal transduction pathway, indicating a molecular mechanism which may be used to develop new therapeutic targets for the clinical treatment of CM.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31380420      PMCID: PMC6657640          DOI: 10.1155/2019/3909102

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Choroidal melanoma (CM) is the most common primary intraocular malignant tumor in adults and the second most common intraocular malignant tumor in China, with high rates of malignancy and distant metastasis. Although studies on the pathogenesis of CM have made great progress, the exact molecular mechanism of the disease is still unknown, impeding efforts to develop tools for early diagnosis and effective treatment. As tumor microcirculation plays an important role in CM metastasis and tumor blood supply, angiogenesis was thought to be a critical factor in cancer development. However, in 1999, a theory called vasculogenic mimicry (VM) [1] was proposed, which suggested that aggressive melanoma cells may generate vascular channels that facilitate tumor perfusion independent of tumor angiogenesis. VM describes the formation of fluid-conducting channels by highly invasive and genetically dysregulated tumor cells, in contrast to the endothelial-lined tubular structures connected to host vessels that are associated with angiogenesis [2-4]. VM has been found in several different types of cancers, including skin melanoma [5, 6], prostate cancer [7], breast cancer [8, 9], ovarian cancer [10, 11], and osteosarcoma [12]. VM has also been shown to have a close relationship with tumor invasion and metastasis [13]. Since VM does not occur in healthy children or adults, it is an ideal target for drug development. Disrupting VM should not affect normal physiological processes, as is the case with traditional chemotherapy drugs [14, 15]. Side effects from VM-targeted treatments are expected to be minimal. VM formation is related to the expression of vascular endothelial growth factor (VEGF), which is overexpressed in malignant melanoma [16]. VEGF binds to two receptor tyrosine kinases: VEGF receptor 1 (VEGFR1), also known as fms-like tyrosine kinase (FLT-1), and VEGF receptor 2 (VEGFR2), also known as kinase insert domain receptor (KDR). VEGFR1 and VEGFR2 are expressed on vascular endothelial cells, tumor cells, and other cells in the tumor microenvironment [17]. VEGFR2 plays an important role in promoting endothelial cell mitogenesis by activating the PI3K/AKT signaling pathway. PI3K activates downstream targets, such as membrane type 1 matrix metalloproteinase (MT1 MMP) and matrix metalloproteinase-2 (MMP-2). Under the combined action of MT1 MMP and MMP-2, the laminin 5 gamma 2 chain (LN-5γ2) cracks into fragments, namely, 5 gamma 2 prime (5γ21) and 5 gamma 2x (5γ2x). The presence of these two fragments in the microenvironment eventually leads to the formation of the VM network structure [18]. Our experiments have shown that blocking VEGF expression with siRNA reduced the activation of the PI3K/AKT pathway in the tumor microenvironment and inhibited VM formation. These results suggest novel targets for CM therapy and new approaches to CM treatment.

2. Methods

2.1. Reagents and Instruments

Human choroidal melanoma cell line (OCM-1) was obtained from BeNa Culture Collection (Beijing, China). COCl2 and XTT Kits were acquired from Shanghai Macklin Biochemical (Shanghai, China). Annexin V-FITC/Propidium Iodide (PI) Assay Kits were obtained through SouthernBiotech (Birmingham, USA). Antibodies for VEGF (1:200), Tubulin, GAPDH, serine/threonine-specific protein kinase (AKT), phosphor-AKT (p-AKT), MT1-MMP, MMP-2, and matrix metallopeptidase 9 (MMP-9) as well as horseradish peroxidase- (HRP-) conjugated Affinipure Goat Anti-Rabbit/mouse IgG(H+L) were purchased from Proteintech (Chicago, China). Antibodies for CD34 and Periodic Acid-Schiff (PAS) and a Fast Red Substrate Kit were purchased from Abcam (Cambrige, USA). PrimeScript RT Reagent Kit, SYBR Premix Ex Taq, and RNAiso Plus were obtained through TaKaRa. VEGF siRNA and pHBLV-U6-ZsGreen-PGK-Puro negative virus were purchased from Hanbio Biotechnology (Shanghai, China). Puromycin was purchased from InvivoGen (San Diego, USA).

2.2. Immunohistochemical Determination of VEGF Expression and VM Assessment in CM Specimens

Protein expression of VEGF was evaluated in 20 archival paraffin-embedded CM specimens using an avidin-biotin immunohistochemical (IHC) assay. For histopathology studies, tumor tissues were cut in 5 μm sections from the center of the specimen so that the following assays would best reflect the entire tumor. The tissues were fixed in 4% paraformaldehyde solution for 48 hours, dehydrated, and embedded in paraffin using routine methods. The sections were heated in a sodium citrate buffer at 95°C for 20 minutes for antigen retrieval and then deparaffinized in xylene. After naturally cooling to room temperature, the sections were blocked in 3% H2O2 for 15 minutes, blocked in 5% bovine serum albumin for 30 minutes at 37°C, and then incubated with primary antibody (VEGF 1:100) at 37°C for 2 hours. After washing with a mixture of phosphate-buffered saline (PBS) and Tween 20 (PBST), the sections were incubated with alkaline phosphatase-conjugated secondary antibody at 37°C for 20 minutes. Visualization was performed using a Fast Red Substrate Kit under a microscope. The nuclei were counterstained with hematoxylin, followed by dehydration and coverslip mounting. Selecting images of 200x magnification for analysis, after flat field calibration, and exposure for 30 ms to capture images, all the images were analyzed by Image PRO PLUS 7.0 software. VM was detected by CD34–PAS dual staining. Immunohistochemical staining was performed on 5-μ formalin-fixed paraffin-embedded tumor sections, for CD34 followed by immunodetection. The slides were then rinsed with distilled water for 5 min, incubated with PAS for 15 min, counterstained with hematoxylin for 1 min, and viewed under a light microscope to detect CD34 and PAS signals. CD34-negative and PAS-positive channels were considered as VM.

2.3. Measurement of VEGF, AKT, MT1-MMP, MMP-2, and MMP-9 Protein Expression in OCM-1 Cells in Hypoxia

OCM-1 cells were incubated in increasing concentrations (0 μM, 50 μM, and 150 μM) of COCl2 for 24, 48, and 72 hours. Cells were collected and compared with the control group of cells treated with 0 μM COCl2. Target proteins were analyzed by western blot using specific primary antibodies for VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9. HRP-conjugated secondary antibodies were used to visualize the protein. The bands were detected using the Super ECL Plus. The same membrane was stripped and treated with an antibody specific to GAPDH to provide a protein-loading control of total cell lysates. Stained bands were scanned, and intensity was quantified using the 1D image analysis program.

2.4. Measurement of VEGF, AKT, MT1-MMP, MMP-2, and MMP-9 mRNA Expression in OCM-1 Cells in Hypoxia

To explore the related genetic difference between COCl2-treated OCM-1 and nontreated cells, real-time PCR was used to detect the mRNA from OCM-1 in normal medium and from those cells incubated in increasing concentrations (0 μM, 50 μM, and 150 μM) of COCl2 for 24, 48, and 72 hours. Total RNA was extracted using TRIzol reagent according to the manufacturer's instruction. The real-time PCR primers are shown in Table 1.
Table 1

Primers for real-time PCR.

GenesPrimer sequence
VEGF-S5′ GTGCCCACTGAGGAGTCCAACATC 3′
VEGF-AS5′  GAGCAAGGCCCACAGGGATTTT  3′
AKT-S5′  GACGGGCACATTAAGATCACAGACTTCGG  3′
AKT-AS5′  AAGGGCAGGCGACCGCACATCA  3′
MT1-MMP-S5′  GGGACTGAGGAGGAGACGGAGGTGA  3′
MT1-MMP-AS5′  CAGCAGGGAACGCTGGCAGTAGAG  3′
MMP2-S5′  AACTACGATGATGACCGCAAGTGGG  3′
MMP2-AS5′  GAAGTTCTTGGTGTAGGTGTAAATGGGTG
3′MMP9-S5′  TGCCAGTTTCCATTCATCTTCCAAGGC 3′
MMP9-AS5′  CATCACCGTCGAGTCAGCTCGGGTC 3′
GAPDH-S5′  ATGACATCAAGAAGGTGGTGAAGCAGG  3′
GAPDH-AS5′  GCGTCAAAGGTGGAGGAGTGGGT  3′

2.5. Viral Transformation of OCM-1 Cell Lines with VEGF siRNA

OCM-1 cells (3 × 104 per well) were paved to 16 wells of a 24-well plate and cultured overnight at 37°C. The cells were observed on the second day, and their density was adjusted to about 50%, followed by virus infection. Each well in a group of four was infected, respectively, with pHBLV-U6-ZsGreen-PGK-Puro negative virus and VEGF siRNA virus. 100 μl of DMEM was placed in four 5 ml centrifuge tubes. Each tube then received, respectively, 12.6 μl of pHBLV-U6-ZsGreen-PGK-Puro negative virus and VEGF siRNA virus (titer of 2 × 108 TU/ml and MOI of 30 for all viruses, where virus volume = (MOI × cell number)/virus titer)). 25 μl of polybrene (2 mg/ml) was added to each tube and the solution was mixed. The original medium was removed from the 24-well plate and replaced with the virus infection solution from the centrifuge tubes. After culturing for 48 hours in the incubator, this second virus solution was removed and replaced by fresh medium for subsequent culture. After 72 hours, infection efficiency was observed by fluorescence and photographed. The results showed infection rates of up to 80%-90%, indicating that the procedure for screening cell lines could be continued. Cells were digested in the 24-well plate and transferred to 6 cm plates. 2 μg/ml puromycin was added to the medium, which was changed three days later to observe cell fluorescence. After 7 days, the concentration of puromycin was reduced to 1 μg/ml. When the cell density achieved about 80%, 100 ng/ml puromycin was used for cell culture maintenance, followed by fluorescence observation and photographing.

2.6. Identification of Stable Cell Lines by Western Blot and Real-Time PCR

1 × 106 cells were collected from each of the transformed cell lines described above (OCM-1 and siVEGF) and prepared for western blot. Total RNA was extracted using TRIzol reagent according to the manufacturer's instructions and prepared for real-time PCR. Cells were collected and compared with the control group of cells treated with normal medium.

2.7. Wound Healing Assay

To detect cell migration, OCM-1 and siVEGF cell lines were seeded in a 6-well plate. After the cells grew to confluence, a “scratch wound” in the confluence monolayers was made using a 10 μL pipette tip. Then each well was rinsed with PBS and serum-free medium containing 100 μM COCl2. The plates were incubated at 37°C, 5% CO2 in air for 0, 24, and 48 hours. The distance the cells migrated from the edge of the wound was measured. Results were expressed as the average distance. Nh Migration rate = (0 hour scratch width-Nh scratch width)/0 hour scratch width.

2.8. Transwell Assay

The invasion properties of each of the cell lines was evaluated by transwell assay. OCM-1 and siVEGF cell lines were treated with 100 μM COCl2 for 48 hours. 1 × 105 cells of each cell line were centrifuged, and the culture medium was removed. 100 μl of serum-free medium was used to resuspend the cells, which were then inoculated into Matrigel Invasion Chambers. 600 μl of medium containing 10% fetal bovine serum was added to the lower chambers, followed by culture in the cell incubator for 28 hours. The old culture medium was discarded, and the upper and lower chambers were washed twice using PBS. Cells on the upper chambers were swabbed using Q-tips and treated with methanol for 10 minutes. The cells were stained by 1% eosin (containing 1% to 2% glacial acetic acid) for 5 minutes. The lower chambers were washed once with PBS, and the chamber membrane was removed with a blade. The membrane was then placed onto a glass slide with the cell side down so it could dry. Subsequent steps included photomicrography, counting, and plotting.

2.9. Measurement of Apoptosis by Flow Cytometry (FCM)

OCM-1 and siVEGF cell lines were treated with 100 μM COCl2 for 48 hours. The cells were then centrifuged at 2000 rpm/min. The culture medium was removed, and the cells were rinsed with 1×PBS solution. The samples were centrifuged again, and the supernatant was removed. 100 μl of each cell suspension was added to Falcon tubes, followed by the addition of either Annexin V-FITC or PI Staining Solution. FCM was performed within 1 hour. In the resulting FCM histograms, the abscissa represented the Annexin V-FITC fluorescence signal value, detecting phosphatidylserine, while the ordinate represented the PI fluorescence signal value, detecting DNA. In normal cells, phosphatidylserine was distributed throughout the membrane, and, due to the membrane's integrity, the cells could not be stained by Annexin V-FITC or PI. The corresponding points were distributed in the LL quadrant of the histogram. For early apoptotic cells, phosphatidylserine moved toward the outside of the cell, resulting in Annexin-V-FITC staining. Membrane integrity still prevented the PI from staining. The corresponding points were distributed in the early apoptosis area. Late apoptotic cells could be stained by both Annexin-V-FITC and PI. The corresponding points were distributed in the late apoptosis area of the histogram.

2.10. Detection of PI3K/AKT Signaling Pathway by Western Blot

OCM-1 and siVEGF cell lines were incubated in 100 μM COCl2 for 48 hours. Cells were collected and compared with a control group of cells treated with 0 μM COCl2. The target proteins were analyzed by western blot using specific primary antibodies for VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9. HRP-conjugated secondary antibodies were used to visualize the protein. The bands were detected using the Super ECL Plus. The same membrane was stripped and treated with an antibody specific to GAPDH to provide a protein-loading control of total cell lysates. Stained bands were scanned, and intensity was quantified using the 1D image analysis program.

3. Results

3.1. Elevated VEGF Protein Expression and VM Formation in CM Specimens

VEGF protein expression was evaluated in 20 archival paraffin-embedded CM specimens by IHC assay. All of the specimens tested positive for VEGF. VEGF protein expression was significantly higher than the negative control, especially along the VM compared to the stromal cells (p=<0.001) (Figures 1(a) and 1(b)).
Figure 1

Positive VEGF expressions of VM in CM specimens (200×). (a) The expression of VEGF was significantly higher in CM than in the negative control, especially along the VM compared to the stromal cells. (b) The IOD of VEGF was significantly higher in CM than in the negative control (p=<0.001). (c) CD34-negative and PAS-positive channels were considered as VM (yellow arrows).

VM was detected by CD34–PAS dual staining; CD34-negative and PAS-positive channels were considered as VM (Figure 1(c)). The cells composing the channels were negative for CD34 indicating that they were not endothelial or endothelial progenitor cells.

3.2. Elevated mRNA and Protein Expression of VEGF, AKT, MT1-MMP, MMP-2, and MMP-9 in OCM-1 Cells in Hypoxia

Real-time PCR was used to verify possible target genes in OCM-1 cells with the primers shown in Table 1. The expression of VEGF, AKT, MT1-MMP, MMP-2, and MMP-9 increased in a concentration-dependent and time-dependent manner after treatment with COCl2 (Figure 2).
Figure 2

Expression of VEGF, AKT, MT1-MMP, MMP2, and MMP9 mRNA was increased after treatment by COCl2.

We then confirmed the protein expression of VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9 after COCl2 treatment in OCM-1 cells by western blot (Figure 3). Concentration-dependent increases of VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9 were found after COCl2 treatment in OCM-1 cells when compared with the control.
Figure 3

Expression of VEGF, p-AKT, AKT, MT1-MMP, MMP2, andMMP9 was increased after treatment by COCl2.

3.3. Transformed OCM-1 Cell Lines Were Established Expressing VEGF siRNA

The infection efficiency was up to almost 80%-90%, confirmed by immunofluorescence assay (Figure 4), meaning the infection was successful. The infected viruses were stably expressed in the cells and passaged with them; cells with green fluorescence accounted for almost 90% of the total number.
Figure 4

Fluorescent image of virus infected cells and stable cell lines. (a), (b) Cell image and fluorescent image at 72 h after virus infection; (c), (d) images of stable cell lines.

We verified the transformed cell lines by western blot and real-time PCR. Compared with the OCM-1 parent cell line, the expression level of VEGF in the siVEGF cell line was significantly reduced. No significant changes were reported in the negative cell line (Figure 5). The results indicate the successful establishment of siVEGF OCM-1 cell lines, which laid a foundation for subsequent experiments.
Figure 5

Verifying stable cell lines via WB and RT-PCR. (a), (b) The expression of VEGF was significantly reduced in the siVEGF cell line, compared with the OCM-1 parent cell line, whereas no significant changes were reported in the negative cell line. (c) Compared with the OCM-1 parent cell line, the level of VEGF mRNA was decreased in the siVEGF cell line.

3.4. siRNA Deletion of VEGF Inhibited VM Formation

VEGF gene deletion significantly suppressed OCM-1 cell migration (migration rate 23%-42%) (Figure 6). Knockout of VEGF gene resulted in the significant inhibition of OCM-1 cell invasion in a reconstituted basement membrane. Cells that migrated through the polycarbonate membrane were significantly reduced in the VEGF gene deletion group (Figure 7).
Figure 6

VEGF gene deletion reduced migration of OCM-1, and VEGF gene deletion slowed down the migration more significantly.

Figure 7

VEGF gene deletion significantly inhibited the OCM-1 cell invasion in the reconstituted basement membrane for 28 h.

We also analyzed the activation of programmed cell death (apoptosis) induced by VEGF gene deletion using flow cytometry. The results indicated that VEGF gene deletion induced apoptosis of OCM-1 (Figure 8). More cells were in early apoptosis after hypoxic preconditioning.
Figure 8

VEGF gene deletion induced early apoptosis of OCM-1. The apoptosis of OCM-1 cells was more severe after treatment with COCl2.

These results suggest VEGF gene deletion reduced OCM-1 cell proliferation, migration, and invasion, especially after the COCl2 treatment. Therefore, VEGF is thought to play an important role in VM formation of CM.

3.5. Expression of VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9 in Transformed Cell Lines in Hypoxia

After COCl2 treatment, we found that the expression levels of VEGF, p-AKT, AKT, MT1 MMP, MMP-2, and MMP-9 were slightly increased in the transformed cell lines, compared with the measurements taken from cells cultured in normal medium. When compared with the OCM-1 parent cell line, the expression levels of VEGF, AKT, and MT1-MMP in the siVEGF cell line were reduced (Figure 9).
Figure 9

Detecting the expression of VEGF, p-AKT, AKT, MT1-MMP, MMP2, and MMP9 via western blotting. After COCl2 treatment, the expression levels of VEGF, p-AKT, AKT, MMP2, and MMP9 were increased to a certain extent. Compared with the OCM-1 parent cell line, the expression levels of VEGF, AKT, and MT1-MMP in the siVEGF cell line were reduced.

4. Discussion

Our studies show a close correlation between the expression of VEGF and VM formation in CM. VEGF protein was expressed in all 20 specimens of CM we tested, especially along VM compared to the stromal cells. When OCM-1 cells were cultured in hypoxia, VEGF expression increased significantly. VEGF gene deletion reduced the proliferation, migration, and invasion of OCM-1 cells. These results indicate that VEGF is closely associated with VM formation and that VEGF protein plays an essential role in tumor malignancy and metastasis. We also measured the activity of the PI3K/AKT signaling pathway in the OCM-1 and siVEGF cell lines. VEGF gene deletion not only impaired the formation of tumor VM, but also altered the expression of invasive associated genes like VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9. These experiments demonstrate that VEGF promote VM formation in CM by activating PI3K/AKT signaling pathway, offering a new target to improve CM therapy. The VM blood supply system is independent of the endothelial vessels connected to tumors, reflecting the plasticity of aggressive tumor cells that express vascular cell markers which line the tumor vasculature [19]. VM has been found in several different types of cancers and has been confirmed to be closely related to mortality [20-22]. Angiogenesis inhibitors are ineffective against tumor cell VM, suggesting that this tumor phenotype will have selective resistance to conventional therapy [23]. Study of VM's molecular mechanism provides multiple therapeutic targets and diagnostic indicators for the aggressive, metastatic phenotype, such as PI3K, MMP-2, and MMP-9 [24, 25]. Hypoxia stimulates hypoxia inducing factor (HIF-1α), one of the main transcription regulatory factors, and increases expression of its downstream factors, such as VEGF, to regulate the proliferation and metastasis of melanoma [26-31]. VEGF, which expresses on cells in the tumor microenvironment, binds to VEGFR2, activating the downstream targets of the PI3K pathway, such as MT1 MMP and MMP-2, which eventually lead to the formation of the VM network structure [18]. Our results are in line with these previous studies. MMP is a member of the zinc ion matrix protease family, which can degrade various components of extracellular matrix [32]. MMP-2 and MMP-9 can degrade type-IV collagen, the main structure of the basement membrane. Expression of MMP-2 and MMP-9 increased significantly in tumor and metastatic tumor [33-35]. Increased MMP activity promotes protein hydrolysis in the basement membrane and the extracellular matrix (ECM), releasing angiogenesis factors [36]. ECM remodeling regulated by MMP inducer (CD147) is a crucial process during tumor cell invasion and the regulation of its blood supply [37]. In conclusion, our studies demonstrated that VEGF protein was expressed in both CM specimens and the OCM-1 cell line. That expression increased significantly in hypoxia. VEGF gene deletion impaired VM formation and the expression of invasive associated genes such as VEGF, p-AKT, AKT, MT1-MMP, MMP-2, and MMP-9. These results indicate that VEGF induce VM formation in CM by activating PI3K/AKT signal transduction pathway, which may provide new therapeutic targets for the clinical treatment of CM.
  37 in total

1.  Expression and functional significance of VE-cadherin in aggressive human melanoma cells: role in vasculogenic mimicry.

Authors:  M J Hendrix; E A Seftor; P S Meltzer; L M Gardner; A R Hess; D A Kirschmann; G C Schatteman; R E Seftor
Journal:  Proc Natl Acad Sci U S A       Date:  2001-06-19       Impact factor: 11.205

2.  Melanoma-associated expression of vascular endothelial growth factor and its receptors FLT-1 and KDR.

Authors:  U Graeven; W Fiedler; S Karpinski; S Ergün; N Kilic; U Rodeck; W Schmiegel; D K Hossfeld
Journal:  J Cancer Res Clin Oncol       Date:  1999-11       Impact factor: 4.553

Review 3.  Matrix metalloproteinases and their inhibitors in tumour growth and invasion.

Authors:  V M Kähäri; U Saarialho-Kere
Journal:  Ann Med       Date:  1999-02       Impact factor: 4.709

4.  Molecular determinants of ovarian cancer plasticity.

Authors:  A K Sood; E A Seftor; M S Fletcher; L M Gardner; P M Heidger; R E Buller; R E Seftor; M J Hendrix
Journal:  Am J Pathol       Date:  2001-04       Impact factor: 4.307

5.  Cooperative interactions of laminin 5 gamma2 chain, matrix metalloproteinase-2, and membrane type-1-matrix/metalloproteinase are required for mimicry of embryonic vasculogenesis by aggressive melanoma.

Authors:  R E Seftor; E A Seftor; N Koshikawa; P S Meltzer; L M Gardner; M Bilban; W G Stetler-Stevenson; V Quaranta; M J Hendrix
Journal:  Cancer Res       Date:  2001-09-01       Impact factor: 12.701

6.  Molecular classification of cutaneous malignant melanoma by gene expression profiling.

Authors:  M Bittner; P Meltzer; Y Chen; Y Jiang; E Seftor; M Hendrix; M Radmacher; R Simon; Z Yakhini; A Ben-Dor; N Sampas; E Dougherty; E Wang; F Marincola; C Gooden; J Lueders; A Glatfelter; P Pollock; J Carpten; E Gillanders; D Leja; K Dietrich; C Beaudry; M Berens; D Alberts; V Sondak
Journal:  Nature       Date:  2000-08-03       Impact factor: 49.962

7.  Lack of lymphangiogenesis despite coexpression of VEGF-C and its receptor Flt-4 in uveal melanoma.

Authors:  R Clarijs; L Schalkwijk; D J Ruiter; R M de Waal
Journal:  Invest Ophthalmol Vis Sci       Date:  2001-06       Impact factor: 4.799

8.  Hypoxia-inducible factor-1alpha is a positive factor in solid tumor growth.

Authors:  H E Ryan; M Poloni; W McNulty; D Elson; M Gassmann; J M Arbeit; R S Johnson
Journal:  Cancer Res       Date:  2000-08-01       Impact factor: 12.701

9.  Vascular channel formation by human melanoma cells in vivo and in vitro: vasculogenic mimicry.

Authors:  A J Maniotis; R Folberg; A Hess; E A Seftor; L M Gardner; J Pe'er; J M Trent; P S Meltzer; M J Hendrix
Journal:  Am J Pathol       Date:  1999-09       Impact factor: 4.307

10.  Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases.

Authors:  H Zhong; A M De Marzo; E Laughner; M Lim; D A Hilton; D Zagzag; P Buechler; W B Isaacs; G L Semenza; J W Simons
Journal:  Cancer Res       Date:  1999-11-15       Impact factor: 12.701

View more
  16 in total

Review 1.  Vascular mimicry: Triggers, molecular interactions and in vivo models.

Authors:  Stephen L Wechman; Luni Emdad; Devanand Sarkar; Swadesh K Das; Paul B Fisher
Journal:  Adv Cancer Res       Date:  2020-07-16       Impact factor: 6.242

Review 2.  Mechanisms of vasculogenic mimicry in hypoxic tumor microenvironments.

Authors:  Xiaoxu Wei; Yunhua Chen; Xianjie Jiang; Miao Peng; Yiduo Liu; Yongzhen Mo; Daixi Ren; Yuze Hua; Boyao Yu; Yujuan Zhou; Qianjin Liao; Hui Wang; Bo Xiang; Ming Zhou; Xiaoling Li; Guiyuan Li; Yong Li; Wei Xiong; Zhaoyang Zeng
Journal:  Mol Cancer       Date:  2021-01-04       Impact factor: 27.401

3.  Downregulation of Astrocyte Elevated Gene-1 Expression Combined with All-Trans Retinoic Acid Inhibits Development of Vasculogenic Mimicry and Angiogenesis in Glioma.

Authors:  Chen Liang; Ling Yang; Shi-Wen Guo; Rui-Chun Li
Journal:  Curr Med Sci       Date:  2022-02-24

4.  Curcumin in Combination With Omacetaxine Suppress Lymphoma Cell Growth, Migration, Invasion, and Angiogenesis via Inhibition of VEGF/Akt Signaling Pathway.

Authors:  Yu Zhang; Jingjing Xiang; Ni Zhu; Hangping Ge; Xianfu Sheng; Shu Deng; Junfa Chen; Lihong Yu; Yan Zhou; Jianping Shen
Journal:  Front Oncol       Date:  2021-08-11       Impact factor: 6.244

5.  Cooperation between melanoma cell states promotes metastasis through heterotypic cluster formation.

Authors:  Nathaniel R Campbell; Anjali Rao; Miranda V Hunter; Magdalena K Sznurkowska; Luzia Briker; Maomao Zhang; Maayan Baron; Silja Heilmann; Maxime Deforet; Colin Kenny; Lorenza P Ferretti; Ting-Hsiang Huang; Sarah Perlee; Manik Garg; Jérémie Nsengimana; Massimo Saini; Emily Montal; Mohita Tagore; Julia Newton-Bishop; Mark R Middleton; Pippa Corrie; David J Adams; Roy Rabbie; Nicola Aceto; Mitchell P Levesque; Robert A Cornell; Itai Yanai; Joao B Xavier; Richard M White
Journal:  Dev Cell       Date:  2021-09-15       Impact factor: 12.270

Review 6.  The Regulatory Roles of Non-coding RNAs in Angiogenesis and Neovascularization From an Epigenetic Perspective.

Authors:  Itzel Alejandra Hernández-Romero; Lissania Guerra-Calderas; Marisol Salgado-Albarrán; Tatiana Maldonado-Huerta; Ernesto Soto-Reyes
Journal:  Front Oncol       Date:  2019-10-24       Impact factor: 6.244

Review 7.  Hypoxia and Extracellular Acidification as Drivers of Melanoma Progression and Drug Resistance.

Authors:  Ewelina Dratkiewicz; Aleksandra Simiczyjew; Justyna Mazurkiewicz; Marcin Ziętek; Rafał Matkowski; Dorota Nowak
Journal:  Cells       Date:  2021-04-09       Impact factor: 6.600

8.  17-Aminogeldanamycin Inhibits Constitutive Nuclear Factor-Kappa B (NF-κB) Activity in Patient-Derived Melanoma Cell Lines.

Authors:  Mariusz L Hartman; Magdalena Rogut; Aleksandra Mielczarek-Lewandowska; Michal Wozniak; Malgorzata Czyz
Journal:  Int J Mol Sci       Date:  2020-05-26       Impact factor: 5.923

Review 9.  Beyond Conventional: The New Horizon of Anti-Angiogenic microRNAs in Non-Small Cell Lung Cancer Therapy.

Authors:  Alexandru Tirpe; Diana Gulei; George Razvan Tirpe; Andreea Nutu; Alexandru Irimie; Paola Campomenosi; Laura Ancuta Pop; Ioana Berindan-Neagoe
Journal:  Int J Mol Sci       Date:  2020-10-27       Impact factor: 5.923

Review 10.  The role of microenvironment in tumor angiogenesis.

Authors:  Xianjie Jiang; Jie Wang; Xiangying Deng; Fang Xiong; Shanshan Zhang; Zhaojian Gong; Xiayu Li; Ke Cao; Hao Deng; Yi He; Qianjin Liao; Bo Xiang; Ming Zhou; Can Guo; Zhaoyang Zeng; Guiyuan Li; Xiaoling Li; Wei Xiong
Journal:  J Exp Clin Cancer Res       Date:  2020-09-30
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.