Literature DB >> 31376326

Repression of TGF-β Signaling in Breast Cancer Cells by miR-302/367 Cluster.

Mona Ahmadalizadeh Khanehsar1,2, Moslem Hoseinbeyki1, Masoumeh Fakhr Taha1, Arash Javeri3.   

Abstract

OBJECTIVE: Epigenetic alterations of the malignantly transformed cells have increasingly been regarded as an important event in the carcinogenic development. Induction of some miRNAs such as miR-302/367 cluster has been shown to induce reprogramming of breast cancer cells and exert a tumor suppressive role by induction of mesenchymal to epithelial transition, apoptosis and a lower proliferation rate. Here, we aimed to investigate the impact of miR-302/367 overexpression on transforming growth factor-beta (TGF-β) signaling and how this may contribute to tumor suppressive effects of miR-302/367 cluster.
MATERIALS AND METHODS: In this experimental study, MDA-MB-231 and SK-BR-3 breast cancer cells were cultured and transfected with miR-302/367 expressing lentivector. The impact of miR-302/367 overexpression on several mediators of TGF-β signaling and cell cycle was assessed by quantitative real-time polymerase chain reaction (qPCR) and flow cytometry.
RESULTS: Ectopic expression of miR-302/367 cluster downregulated expression of some downstream elements of TGF-β pathway in MDA-MB-231 and SK-BR-3 breast cancer cell lines. Overexpression of miR-302/367 cluster inhibited proliferation of the breast cancer cells by suppressing the S-phase of cell cycle which was in accordance with inhibition of TGF-β pathway.
CONCLUSION: TGF-β signaling is one of the key pathways in tumor progression and a general suppression of TGF-β mediators by the pleiotropically acting miR-302/367 cluster may be one of the important reasons for its anti-tumor effects in breast cancer cells. Copyright© by Royan Institute. All rights reserved.

Entities:  

Keywords:  Breast Cancer; Reprogramming; Transforming Growth Factor-Beta; miR-302/367

Year:  2019        PMID: 31376326      PMCID: PMC6722449          DOI: 10.22074/cellj.2020.6193

Source DB:  PubMed          Journal:  Cell J        ISSN: 2228-5806            Impact factor:   2.479


Introduction

Despite recent advancements in the treatment of breast cancer, it still remains one of the leading causes of cancer deaths among women (1). Therefore, development of new therapeutic approaches for breast cancer is of the utmost importance. Reprograming of somatic cells and generation of induced pluripotent stem (iPS) cells by some transcription factors including OCT3/4, SOX2, NANOG, KLF4, LIN28 and MYC (2, 3) demonstrated that the cell fate can be manipulated in vitro. Reprogramming is a process accompanied by distinct alterations in chromatin and transcriptional programs. MiRNAs constitute a class of 17-24 bp small non-coding RNAs, involved in regulation of different biological processes and cancer-related cellular activities such as apoptosis, proliferation and invasion (4, 5). MiR-302/367 cluster possesses a coding sequence located in intron 8 of the LARP7 gene and codes for 5 miRNAs including miR302a, miR302b, miR302c, miR302d, and miR367 which are highly expressed in embryonic stem cells (6-8), but their expression decline rapidly after differentiation (9). It was shown that miR-302/367 cluster can effectively reprogram human and mouse somatic cells to iPS cells (10, 11). miR-302 is also able to reprogram human cancer cells to a human embryonic stem cell-like state with a slow cell cycle rate and dormant cell-like morphology (12, 13). Reprogramming by miR-302/367 cluster has shown tumor suppressive effects on different cancer cells, such as melanoma and colon cancer cells (14), cervical carcinoma cells (15) glioblastoma cells (16), prostate cancer cells (13), endometrial cancer cells (17) and breast cancer (18). The miR-302/367 cluster has been shown to induce reprogramming of somatic cells through multiple pathways, including MECP1/2 and AOF1/2 silencing, repression of suppressor NR2F2 gene expression, and silencing RHOC and TGFBRII (19). Transforming growth factor-b (TGF-β) signaling pathway is one of the major players in malignant progression through multiple mechanisms which enhance tumor cell invasion, dissemination, and immune evasion (20, 21). In this study we aimed to investigate how overexpression of miR-302/367 cluster in breast cancer cells affects some of the main TGF-β signaling pathway mediators.

Materials and Methods

Cell lines and culture conditions

In this experimental study, human MDA-MB-231 and SK BR-3 breast cancer cell lines were respectively purchased from Pasteur Institute and Iranian Biological Resource Center (IRBC), Iran. Both cell lines were cultured in Dulbecco’s Modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS), 1% L-glutamine and 1% penicillin-streptomycin (all from GibcoTM, Thermo Fisher Scientific, USA) at 5% CO2 and 37°C. The culture medium was renewed every other day.

Transfection with miR-302/367 expressing vector

Transfection of MDA-MB-231 and SK-BR-3 were performed using either a TDH101PA-GP miR-302abcd/367 expressing Lentivector (System Biosciences, SBI, USA) or the same vector without the miR-302/367 cluster as the mock control type, using Lipofectamine® 2000 transfection reagent (Invitrogen, Thermo Fisher Scientific, USA) according to the manufacture’s protocol. 48 hours after transfection, transfected cells were selected by adding 1 mg/ ml puromycin dihydrochloride (Bio Basic Inc., Canada) to the culture medium every other day up to the elimination of untransfected cells. Transfected cells were kept in culture condition for a two-week period.

Analysis of miRNA and gene expression by quantitative real time polymerase chain reaction

For analysis of miRNA expression, total RNA including small RNA, was extracted from the cultured cells using RNX-Plus solution (Sinaclon, Iran) according to the manufacturer’s protocol. Equal amounts of RNA were reverse transcribed into cDNA using BON-miR miRNA 1st-Strand cDNA Synthesis Kit (Stem Cell Technology Co., Iran). For quantification of mRNAs, total RNA was extracted using the High Pure RNA Isolation Kit (Roche, Germany) according to the manufacturer’s protocol. RNAquality and quantity were assessed using a NanoDropTM 2000/2000c Spectrophotometer (Thermo Fisher Scientific, USA). Equal amount of total RNA from each group was reverse transcribed into cDNA using oligo-dT primers and RevertAid H Minus Reverse Transcriptase (Thermo Fisher Scientific). Assessment of miRNA and mRNA expression was performed, using FastStart SYBR Green Master (Roche, Germany) and specific primers for miR302a, miR-302b, miR-302c, miR-302d, miR-367 and other genes as mentioned in Table 1, on a Rotor-Gene 6000 (Corbett Research, Australia) real-time PCR instrument. SNORD47 was selected as the internal reference gene for quantification of miRNAs. GAPDH and B2M were used as the internal reference genes for quantification of the mRNAs. Comparative analysis of gene expression between different groups was performed using REST 2009 software (Relative Expression Software Tool, Qiagen) based on a Pair Wise Reallocation Randomization Test (22). Four replicates of each group were included in the qPCR reactions. Primers used for quantitative real-time polymerase chain reaction

Analysis of cell cycle by flow cytometry

At the end of transfection and cell culture period, the cells were harvested and fixed in 70% cold ethanol and DNA content was stained with propidium iodide (PI) solution. Four replicates of each group were used in this study. Cell cycle analysis was carried out using a FACSCaliburTM flow cytometer (BD Biosciences, USA). FlowJo vX.0.7 software (Tree Star Inc., USA) was used for analysis of the results. Comparison of the cell cycle G1, S and G2/M proportions was performed between the mock and miR-302/367 transfected group of each cell line, using unpaired t test.

Results

Overexpression of the miR-302/367 members in transfected cells

Antibiotic-based selection of the miR-302/367 transfected breast cancer cells caused producing a highly (>90%) GFP-expressing cells population (Fig .1A) which were used for the subsequent experiments. Quantification of the miR-302/367 expression in MDA-MB-231 cells showed upregulation of miR-302a, miR-302b, miR-302c, miR-302d and miR-367 by mean factors of 74, 946, 33, 145 and 25, respectively (Fig .1B). In SK-BR-3 cells, after miR-302/367 transfection, miR-302a, miR-302b, miR-302c, miR-302d and miR-367 were upregulated by mean factors of 145, 1581, 20, 202 and 6, respectively (Fig .1B).
Fig.1

Ectopic expression of miR-302 cluster in the BC cells. A. Photomicrographs of the MDA-MB-231 and SK-BR-3 cells transfected with either miR-302/367 or mock vector. Transfected cells show GFP expression. Scale bar represents 50 µm and B. Assessment of miR-302/367 expression using quantitative real-time polymerase chain reaction (qPCR) in MDA-MB-231 cells (left) and SK-BR-3 cells (right) transfected with miR-302/367 vector. Fold changes are reflected on the vertical axis compared to the control group (transfected with mock vector) which has been normalized to 1. Analysis performed by REST 2009 software based on a Pair Wise Fixed Reallocation Randomisation Test. and significant P values (*; P<0.05, ***; P<0.001) are indicated on the chart. BC; Breast cancer and GFP; Green fluorescent protein.

Regulation of TGF-ß and MAPK pathway genes by miR-302/367 cluster

Firstly, we checked how transfection of the breast cancer cells with miR-302/367 cluster affects the expression of some key mediators of TGF-β and mitogenactivated protein kinase (MAPK) pathways at gene level. Quantitative real-time PCR showed that in the both MDA-MB-231 and SK-BR-3 cells, overexpression of miR-302/367 cluster downregulated TGFBR2, BUB1, RHOC, AKT1, MAPK1, MAPK14 and SMAD3 expression compared to the mock transfected cells (Fig .2).
Fig.2

Expression analysis of some transforming growth factor-beta (TGF-β) mediators at mRNA level after transfection with miR-302/367 vector using quantitative real-time polymerase chain reaction (qPCR). Downregulation of TGF-β-related genes in A. MDA-MB-231 and B. SK-BR-3 cells. Red line represents expression level in the mock transfected group. P values were generated by REST 2009 software based on a Pair Wise Fixed Reallocation Randomisation Test.. Significant P values (*; P<0.05, **; P<0.01, ***; P<0.001) are reflected on the chart.

Cell cycle arrest by overexpression of miR-302/367 cluster

At the end of culture period, transfected breast cancer cells with either miR-302/367 or mock vector were analyzed for the cell cycle phases, using PI staining and flow cytometry. In the miR-302/367 transfected MDA-MB-231 and SK-BR-3 cells, there was a marked decrease in the S-phase population, while the G2/M phase population was partially increased compared to the mock transfected group (Fig .3).
Fig.3

Flow cytometry analysis of cell cycle. There was a significant decrease in S-phase and a partial increase in G2/M-phase population of both MDA-MB-231 and SK-BR-3 cells, after overexpression of miR-302/367 cluster (unpaired t test, n=4, *; P<0.05, **; P<0.01 and ***; P<0.001).

Ectopic expression of miR-302 cluster in the BC cells. A. Photomicrographs of the MDA-MB-231 and SK-BR-3 cells transfected with either miR-302/367 or mock vector. Transfected cells show GFP expression. Scale bar represents 50 µm and B. Assessment of miR-302/367 expression using quantitative real-time polymerase chain reaction (qPCR) in MDA-MB-231 cells (left) and SK-BR-3 cells (right) transfected with miR-302/367 vector. Fold changes are reflected on the vertical axis compared to the control group (transfected with mock vector) which has been normalized to 1. Analysis performed by REST 2009 software based on a Pair Wise Fixed Reallocation Randomisation Test. and significant P values (*; P<0.05, ***; P<0.001) are indicated on the chart. BC; Breast cancer and GFP; Green fluorescent protein. Expression analysis of some transforming growth factor-beta (TGF-β) mediators at mRNA level after transfection with miR-302/367 vector using quantitative real-time polymerase chain reaction (qPCR). Downregulation of TGF-β-related genes in A. MDA-MB-231 and B. SK-BR-3 cells. Red line represents expression level in the mock transfected group. P values were generated by REST 2009 software based on a Pair Wise Fixed Reallocation Randomisation Test.. Significant P values (*; P<0.05, **; P<0.01, ***; P<0.001) are reflected on the chart. Flow cytometry analysis of cell cycle. There was a significant decrease in S-phase and a partial increase in G2/M-phase population of both MDA-MB-231 and SK-BR-3 cells, after overexpression of miR-302/367 cluster (unpaired t test, n=4, *; P<0.05, **; P<0.01 and ***; P<0.001). Interaction between miR-302/367 cluster and several mediators of transforming growth factor-beta (TGF-β) signaling in both canonical and non-canonical pathways. The inhibitory effect of miR-302/367 cluster is shown by the red lines.

Discussion

Genetic and epigenetic alterations contribute to cancer initiation and progression through affecting gene expression. While genetic mutations may lead to stable and irreversible alterations, transient and reversible changes are usually caused by epigenetic modifications (23). It has been shown that reprogramming of cancer cells by some pluripotency transcription factors or specific miRNAs, like miR-302/367 cluster, may lead to an embryonic stem cell-like state and less tumorigenicity (13, 24). We previously demonstrated upregulation of some pluripotency factors, including OCT4A, SOX2 and NANOG, by overexpression of miR-302/367 cluster in MDA-MB-231 and SK-BR-3 cells (18). Accumulating evidence supports the function of miR 302 cluster as a tumor suppressor family which can alleviate tumorigenicity of cancer cells through reversal of epithelial to mesenchymal transition (EMT), induction of apoptosis and anti-proliferative effect (13-15). Previously, we demonstrated some anti-tumor effects of miR-302 cluster in melanoma, colon and breast cancer cells (14, 18). Among the pathways promoting EMT, several studies have reported that inhibition of TGF-ß signaling induces somatic cell reprogramming (25, 26). In this study, we investigated how overexpression of miR-302/367 cluster in MDA-MB-231 and SKBR- 3 breast cancer cells affects some mediators of TGF-β/MAPK/AKT signaling pathway at gene level. As shown, TGFBR2 and RHOC are directly targeted by miR-302 cluster, subsequently facilitating human or mouse fibroblast reprogramming towards iPS cells (27, 28). In accordance with these studies, we found that overexpression of miR-302/367 in human breast cancer cells downregulates TGFBR2 and RHOC expressions. TGF-ß signaling has two canonical and non-canonical pathways (Fig .4). In the canonical or SMAD-dependent pathway, SMAD proteins play key regulatory roles among which SMAD2 and SMAD3 proteins are phosphorylated through activity of TGF-ß and activin (29). While, in the non-canonical or SMAD-independent pathway, TGF-ß activates phosphatidylinositol 3kinase (PI3K)/ AKT and MAPK pathways (30). In the current study, expressions of TGFBR2, BUB1, RHOC, AKT1, MAPK1, MAPK14 and SMAD3 were significantly downregulated after overexpression of miR-302/367 cluster in the both cell lines. Previously, Cai et al. (15) reported that miR-302/367 directly targets AKT1 and it suppresses proliferation of HeLa and SiHa cervical carcinoma cells. In the same study, AKT1 protein level was decreased after miR-302/367 transfection, but AKT1 gene expression was not significantly changed. In another study, Li et al. (31) demonstrated that miR-302abcd cluster upregulated OCT4 expression by targeting AKT1 gene at its 3’-UTR. The same report also showed downregulation of AKT1 at both gene and protein levels, following miR-302 transfection. Similarly, we showed that overexpression of miR-302/367 cluster in MDA-MB-231 and SKBR- 3 cells induces expression of OCT4 gene (18) and downregulates expression of AKT1. Therefore, it seems that a mechanism, similar to that of previous reports, is applicable to breast cancer cells.
Fig.4

Interaction between miR-302/367 cluster and several mediators of transforming growth factor-beta (TGF-β) signaling in both canonical and non-canonical pathways. The inhibitory effect of miR-302/367 cluster is shown by the red lines.

We also detected a significant downregulation of SMAD3 expression following miR-302/367 transfection of the breast cancer cells. Sustained activity of SMAD complexes in the nucleus is one of the key features of TGF-ß signaling in cancer cells. It was reported that an interaction between FOXM1 and SMAD3 is critical for TGF-β-mediated gene expression. Thus, it promotes breast cancer cell invasion and metastasis (32). BUB1 was also downregulated in the breast cancer cells after ectopic expression of miR-302/367 cluster. BUB1 is a serine/threonine kinase playing a significant role in cell cycle regulation, chromosome cohesion (33), and it is a key mediator of TGF-β signaling. It has been shown that BUB1 promotes canonical and non-canonical TGF-β signaling and mediates TGF-β-dependent EMT, cell migration and invasion through interaction with both TGFBRI and TGFBRII (34). Here, for the first time, we are reporting downregulation of BUB1 expression in breast cancer cells following overexpression of miR302/ 367 cluster. This provides further evidence regarding the significance of miR-302/367 suppressive impact on TGF-β signaling through inhibition of both canonical and non-canonical pathways. MAPK pathway is part of the non-SMAD pathways, activated by the TGF-ß receptors (35). MAPK1, also known as ERK2, is encoded by MAPK1 gene. The ERK1/2 pathway plays a pivotal role in regulation of cell proliferation, and it is known as a master regulator of G1 to S-phase progression (36, 37). Another player of the non- canonical TGF-β pathway, MAPK14/p38α is encoded by MAPK14 gene. MAPK14/p38α is 50% identical to ERK2 and generally expressed in cell lines and tissues (36). There has been controversy regarding the role of p38 MAPKs in regulating cell proliferation and survival (38). This primarily depends on the cell type determining whether p38 MAPK induces progression or inhibition of G1/S transition through differential regulation of cyclin A or D levels, phosphorylation of RB protein (39, 40), and phosphorylation of p53 (40). In our study, ectopic expression of miR-302/367 cluster in the breast cancer cells downregulated expression of all of the investigated TGF-β mediators, including TGFBR2, BUB1, RHOC, AKT1, MAPK1, MAPK14 and SMAD3. These findings indicate a strong suppressive effect of miR-302/367 cluster on the TGF-β signaling (Fig .4). In this study we report a lower proliferation rate and S-phase suppression of the breast cancer cells by overexpression of miR-302/367, confirming our previous report (18). This can be explained by suppression of MAPK1 and MAPK14 to some extent. Therefore, suppression of TGF-β mediators may provide a good reason behind the partial cell cycle arrest observedin the breast cancers, following overexpression of miR302/ 367 cluster.

Conclusion

Overexpression of miR-302/367 cluster in human breast cancer cells resulted in a general suppressive effect on multiple mediators of TGF-β signaling and BUB1. This finding was accompanied by inhibition of cell proliferation. Previously, we reported anti-tumor Ahmadalizadeh Khanehsar et al. effects of either miR-302bcad or miR-302bcad/367 clusters on melanoma, colon and breast cancer cells due to induction of apoptosis and suppression of proliferation and invasion. Current results are providing new evidence that suppression of TGF-β signaling at gene level may be one of the important reasons for anti-tumor effects of miR-302/367 cluster in breast cancer cells.
Table 1

Primers used for quantitative real-time polymerase chain reaction


TargetPrimer sequence (5ˊ-3ˊ)Size (bp)Accession no.

TGFBR2F: CCCATCCACTGAGACATATTAAT198NM_001024847.2
R: CATTCTTTCTCCATACAGCCAC
BUB1F: GAGTCAAATATGGAACGAAGAG207NM_004336.4
R: GTCTTCATTTACCCATTGCTCA
RHOCF: CCTGACAGCCTGGAAAACAT153NM_175744.4
R: AACGGGCTCCTGCTTCATCT
AKT1F: ACAAACGAGGGGAGTACATCAA156NM_005163.2
R: TCTTCATCAGCTGGCACTGC
MAPK1F: ATTCCAAGGGCTACACCAAGT136NM_002745.4
R: GGATCCAAGAATACCCAAAATGT
MAPK14F: TGGCTGTCGACTTGCTGGA189NM_001315.2
R: CATAGGTCAGGCTTTTCCACT
SMAD3F: CATAATAACTTGGACCTGCAGC236NM_005902.3
R: ACGCCTCTTCCGATGTGTCT
B2MF: TCCAGCGTACTCCAAAGATTCA113NM_004048.2
R: GTCAACTTCAATGTCGGATGGAT
GAPDHF: TCACCATCTTCCAGGAGCGA116NM_002046.5
R: CAAATGAGCCCCAGCCTTCT

  40 in total

Review 1.  Cell cycle regulation by p38 MAP kinases.

Authors:  C Ambrosino; A R Nebreda
Journal:  Biol Cell       Date:  2001-09       Impact factor: 4.458

2.  Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR.

Authors:  Michael W Pfaffl; Graham W Horgan; Leo Dempfle
Journal:  Nucleic Acids Res       Date:  2002-05-01       Impact factor: 16.971

Review 3.  MicroRNAs: genomics, biogenesis, mechanism, and function.

Authors:  David P Bartel
Journal:  Cell       Date:  2004-01-23       Impact factor: 41.582

4.  Bub1 is required for kinetochore localization of BubR1, Cenp-E, Cenp-F and Mad2, and chromosome congression.

Authors:  Victoria L Johnson; Maria I F Scott; Sarah V Holt; Deema Hussein; Stephen S Taylor
Journal:  J Cell Sci       Date:  2004-03-15       Impact factor: 5.285

5.  Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.

Authors:  Kazutoshi Takahashi; Shinya Yamanaka
Journal:  Cell       Date:  2006-08-10       Impact factor: 41.582

Review 6.  The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1- to S-phase transition.

Authors:  S Meloche; J Pouysségur
Journal:  Oncogene       Date:  2007-05-14       Impact factor: 9.867

7.  Induced pluripotent stem cell lines derived from human somatic cells.

Authors:  Junying Yu; Maxim A Vodyanik; Kim Smuga-Otto; Jessica Antosiewicz-Bourget; Jennifer L Frane; Shulan Tian; Jeff Nie; Gudrun A Jonsdottir; Victor Ruotti; Ron Stewart; Igor I Slukvin; James A Thomson
Journal:  Science       Date:  2007-11-20       Impact factor: 47.728

8.  Mechanism of p38 MAP kinase activation in vivo.

Authors:  Deborah Brancho; Nobuyuki Tanaka; Anja Jaeschke; Juan-Jose Ventura; Nyaya Kelkar; Yoshinori Tanaka; Masanao Kyuuma; Toshikazu Takeshita; Richard A Flavell; Roger J Davis
Journal:  Genes Dev       Date:  2003-07-31       Impact factor: 11.361

9.  Human embryonic stem cells express a unique set of microRNAs.

Authors:  Mi-Ra Suh; Yoontae Lee; Jung Yeon Kim; Soo-Kyoung Kim; Sung-Hwan Moon; Ji Yeon Lee; Kwang-Yul Cha; Hyung Min Chung; Hyun Soo Yoon; Shin Yong Moon; V Narry Kim; Kye-Seong Kim
Journal:  Dev Biol       Date:  2004-06-15       Impact factor: 3.582

Review 10.  p38 MAP-kinases pathway regulation, function and role in human diseases.

Authors:  Ana Cuenda; Simon Rousseau
Journal:  Biochim Biophys Acta       Date:  2007-03-24
View more
  2 in total

Review 1.  Drug Resistance in Metastatic Breast Cancer: Tumor Targeted Nanomedicine to the Rescue.

Authors:  Vrinda Gote; Anantha Ram Nookala; Pradeep Kumar Bolla; Dhananjay Pal
Journal:  Int J Mol Sci       Date:  2021-04-28       Impact factor: 5.923

2.  A Deep-Learning Model With the Attention Mechanism Could Rigorously Predict Survivals in Neuroblastoma.

Authors:  Chenzhao Feng; Tianyu Xiang; Zixuan Yi; Xinyao Meng; Xufeng Chu; Guiyang Huang; Xiang Zhao; Feng Chen; Bo Xiong; Jiexiong Feng
Journal:  Front Oncol       Date:  2021-07-14       Impact factor: 6.244

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.