Literature DB >> 31371552

Complete Genome Sequences of Two Severe Fever with Thrombocytopenia Syndrome Virus Strains Isolated from a Human and a Dog in the Republic Of Korea.

Sook-Young Lee1, Jun-Gu Kang2, Hye-Sung Jeong3, Won-Meong Kim3, Ki-Dong Son3, Ji Soo Kim3, Sung-Suk Oh2,4, Yoon-Kyoung Cho2, Weon-Hwa Jheong5, Joon-Seok Chae6.   

Abstract

Severe fever with thrombocytopenia syndrome virus (SFTSV) is tick-borne and causes this disease (SFTS) in humans. We determined the complete genome sequences of two SFTSV strains isolated from serum from a human with SFTS and a dog with asymptomatic infection using reverse transcription and rapid amplification of cDNA ends PCR.
Copyright © 2019 Lee et al.

Entities:  

Year:  2019        PMID: 31371552      PMCID: PMC6676000          DOI: 10.1128/MRA.01695-18

Source DB:  PubMed          Journal:  Microbiol Resour Announc        ISSN: 2576-098X


ANNOUNCEMENT

Severe fever with thrombocytopenia syndrome virus (SFTSV) belongs to the family Phenuiviridae and genus Phlebovirus and is tick-borne. The first case of SFTS was reported in China in 2011 (1), with new cases reported in South Korea and Japan in 2013 (2–4). SFTSV is an enveloped virus with a negative-sense single-stranded RNA (ssRNA) genome comprised of large (L; RNA-dependent RNA polymerase), medium (M, glycoprotein), and small (S; nucleocapsid/nonstructure protein) segments (5). SFTSV infection is reported in not only humans and ticks but also domestic and wild animals (6–8). However, among animals, entire genome sequences of SFTSV have been reported from only hedgehog, goat, rodent, weasel, and cheetah (9–13). In this paper, we isolated and completely sequenced two SFTSV strains. The first strain was isolated from the serum of an SFTS patient, and the second was isolated from a PCR-positive serum sample from a dog (without prominent clinical signs) resulting from a surveillance study. This study was approved by the Medical Research Ethics Committee of Gacheon University Hospital (institutional review board number GBIRB2014-314). SFTSV was isolated in monolayer-cultured Vero cells (KCLB 10081) via addition of 200-μl SFTSV-positive sera and confirmed in infected cells after 5 to 7 days via NP gene amplification according to previously described methods (14). Briefly, viral RNA was extracted from infected cells using the TRI reagent (Molecular Research Center, USA). cDNA was synthesized using the PrimeScript first-strand cDNA synthesis kit (TaKaRa, Japan) according to the manufacturer’s instructions. The three genome segments were amplified by reverse transcription-PCR using the 11 primer pairs listed in Table 1. The 5′- and 3′-end sequences of each of the two SFTSVs were confirmed via rapid amplification of cDNA ends PCR (15). Sequencing of 11 PCR products was performed using an ABI PRISM 3130 instrument (Applied Biosystem, USA). Entire genome sequences were generated from 25 sequence reads by joining overlapping sequences using ClustalW multiple alignment in BioEdit v. 7.0.9.0 (16).
TABLE 1

Primer sets for entire genome sequences of two SFTSV strains, KH1 and Dog22

Segment typePrimer nameSequenceReaction typea
SUP-S-1TTTGGTCGTGGTGGTGGTTTACACAAAGACCCCCb RT
UP-S-2TTTGGTCGTGGTGGTGGTTTACACAAAGAACCCCCb
MUP-M-FTTTGGTCGTGGTGGTGGTTTACACAGAGACGGCCAACAb
UP-M-RTTTGGTCGTGGTGGTGGTTTACACAAAGACGGCCAACAb
LUP-L-FTTTGGTCGTGGTGGTGGTTTACACAGAGACGCCCAGATb
RP-L-RTTTGGTCGTGGTGGTGGTTTACACAAAGACCGCCCAGATb
SUPTTTGGTCGTGGTGGTGGTTTc PCR/Seq
S1312RYGTCATGAACCTGAAGGTPCR/Seq
S1078FGAARACAGAGTTCACAGCPCR/Seq
UP-S-1/2TTTGGTCGTGGTGGTGGTTTACACAAAGA(A)CCCCCb PCR/Seq
MUPTTTGGTCGTGGTGGTGGTTTc PCR/Seq
M1032RTCYAGTGTTGCCATCATTCTPCR/Seq
M813FKTGTTCWGAATCAGAAGAAAPCR/Seq
M2408RCCAGCCTGRTTGCAGGGAGCPCR/Seq
M1473FAGCTCCAGTGAAGCTAGTGTTSeq
M2282FCARGTCTTCAAGGGTGTGAGPCR/Seq
UP-M-RTTTGGTCGTGGTGGTGGTTTACACAAAGACGGCCAACAb PCR/Seq
LUPTTTGGTCGTGGTGGTGGTTTc PCR/Seq
L1070RCCTGAGTCGGTCTTGATGTCPCR/Seq
L905FCTRGARRTCAATAGATGTGAPCR/Seq
L2424RCGTGAGAAYTCATGCTTCTTPCR/Seq
L1530FCATTCAAGAGGAACCTAAGCASeq
L2257FGTGAACAGCTGGTACATTGGPCR/Seq
L3224RCGSCCTTTGTCCATCCATGAPCR/Seq
L3059FTGGGCYGCCATTTCCATGTTPCR/Seq
L4564RCAGRTCYTCTGCCTTGCACCPCR/Seq
L4108RCTGCTCCACCCAGTCTTCSeq
L4046FGGGACAGGAAGAAGTATCAPCR/Seq
L5219RACATGGGTGTCCTCCATCACPCR/Seq
L4935FCATACACTGAGGAGTACAAGPCR/Seq
UP-L-RTTTGGTCGTGGTGGTGGTTTACACAAAGACCGCCCAGATb PCR/Seq

RT, reverse transcriptase; Seq, sequencing.

These primer pairs, including specific sequences for SFTSV, have a universal primer (UP) sequence at their 5′ end (in italics).

TTTGGTCGTGGTGGTGGTTT (20 bp) is the UP.

Primer sets for entire genome sequences of two SFTSV strains, KH1 and Dog22 RT, reverse transcriptase; Seq, sequencing. These primer pairs, including specific sequences for SFTSV, have a universal primer (UP) sequence at their 5′ end (in italics). TTTGGTCGTGGTGGTGGTTT (20 bp) is the UP. The lengths of the L, M, and S segments of the two SFTSV strains were identified as 6,368, 3,378, and 1,746 nucleotides (nt), respectively. The G+C contents of each segment of the KH1 and Dog22 strains were 48.4% (L), 49.3% (M), and 49.1% (S) and 48.4% (L), 49.6% (M), and 48.3% (S), respectively. By BLASTn, each segment of the KH1 strain displayed the most similarity with the L (GenBank accession number KP663737; 99%), M (KP663738; 99%), and S (KP663739; 100%) sequences of the strain KAGBH5 from a patient reported in Korea in 2015 (17). Furthermore, each segment of the Dog22 strain displayed the highest similarity with the L segment of strain 16MS104 (MF094733; 99%), the M segment of strain 16KS29 (MF094766; 99%), and the S segment of strain 16KS29 (MF094791; 99%) from a patient reported in Korea, 2016 (unpublished data). These results suggest a potential interspecies transmission of SFTSV between humans and dogs, which implies that SFTSV is not absolutely host specific (14). Further epidemiological information would be required to investigate this hypothesis.

Data availability.

The entire genome sequences of the two SFTSV strains have been deposited in GenBank under the accession numbers KY968712, MH464251, MH464252, MH491547, MH491548, and MH491549.
  6 in total

1.  A single-domain antibody inhibits SFTSV and mitigates virus-induced pathogenesis in vivo.

Authors:  Xilin Wu; Yanlei Li; Bilian Huang; Xiaohua Ma; Linjing Zhu; Nan Zheng; Shijie Xu; Waqas Nawaz; Changping Xu; Zhiwei Wu
Journal:  JCI Insight       Date:  2020-07-09

2.  Novel SFTSV Phylogeny Reveals New Reassortment Events and Migration Routes.

Authors:  Xiaoli Wu; Mingyue Li; Yanfang Zhang; Boyun Liang; Junming Shi; Yaohui Fang; Zhengyuan Su; Mengmeng Li; Wenjing Zhang; Ling Xu; Jun Wang; Qiaoli Wu; Shuang Tang; Hualin Wang; Tao Zhang; Cheng Peng; Xin Zheng; Fei Deng; Shu Shen
Journal:  Virol Sin       Date:  2020-09-22       Impact factor: 4.327

3.  The AST/ALT Ratio (De Ritis Ratio) Represents an Unfavorable Prognosis in Patients in Early-Stage SFTS: An Observational Cohort Study.

Authors:  Lianzi Wang; Yang Xu; Shubing Zhang; Asma Bibi; Yuanhong Xu; Tao Li
Journal:  Front Cell Infect Microbiol       Date:  2022-02-08       Impact factor: 5.293

4.  Severe Fever with Thrombocytopenia Syndrome Virus in Ticks in the Republic of Korea.

Authors:  Jun-Gu Kang; Yoon-Kyoung Cho; Young-Sun Jo; Sun-Woo Han; Jeong-Byoung Chae; Jung-Eun Park; Hyesung Jeong; Weon-Hwa Jheong; Joon-Seok Chae
Journal:  Korean J Parasitol       Date:  2022-02-23       Impact factor: 1.341

5.  Recovery of Two Replication-Competent Canine Distemper Viruses That Separately Express Dabie Bandavirus Gn and Gc.

Authors:  Jiahui Lin; Yuehua Li; Liangpeng Lyu; Qianqian Wang; Hui Zhang; Bo Ni; Fuxiao Liu
Journal:  Front Vet Sci       Date:  2022-03-31

Review 6.  Human seminal virome: a panel based on recent literature.

Authors:  Beatriz Helena Dantas Rodrigues de Albuquerque; Maryana Thalyta Ferreira Camara de Oliveira; Janaína Ferreira Aderaldo; Mychelle de Medeiros Garcia Torres; Daniel Carlos Ferreira Lanza
Journal:  Basic Clin Androl       Date:  2022-09-06
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.