Si-Ning Shen1, Ke Li2, Ying Liu2, Cheng-Liang Yang3, Chun-Yu He3, Hao-Rang Wang1. 1. Department of Thoracic Surgery, Affiliated Cancer Hospital of Zhengzhou University (Henan Cancer Hospital), China. 2. Department of Oncology, Affiliated Cancer Hospital of Zhengzhou University (Henan Cancer Hospital), China. 3. Department of Radiation Oncology, Affiliated Cancer Hospital of Zhengzhou University (Henan Cancer Hospital), China.
Abstract
Accumulating evidence has established that long noncoding RNA (lncRNA) plasmacytoma variant translocation 1 (PVT1) is a tumor regulator in many cancers. Here, we aimed to investigate the possible function of lncRNA PVT1 in esophageal carcinoma (EC) via targeting of microRNA-145 (miR-145). Initially, microarray-based gene expression profiling of EC was employed to identify differentially expressed genes. Moreover, the expression of lncRNA PVT1 was examined and the cell line presenting with the highest level of lncRNA PVT1 expression was selected for subsequent experiments. We then proceeded to examine interaction among lncRNA PVT1, FSCN1, and miR-145. The effect of lncRNA PVT1 on viability, migration, invasion, apoptosis, and tumorigenesis of transfected cells was examined with gain-of-function and loss-of-function experiments. We observed that lncRNA PVT1 was robustly induced in EC. lncRNA PVT1 could bind to miR-145 and regulate its expression, and FSCN1 is a target gene of miR-145. Overexpression of miR-145 or silencing of lncRNA PVT1 was revealed to suppress cell viability, migration, and invasion abilities, while also stimulating cell apoptosis. Furthermore, our in vivo results showed that overexpression of miR-145 or silencing of lncRNA PVT1 resulted in decreased tumor growth in nude mice. In conclusion, our research reveals that down-regulation of lncRNA PVT1 could potentially promote expression of miR-145 to repress cell migration and invasion, and promote cell apoptosis through the inhibition of FSCN1. This highlights the potential of lncRNA PVT1 as a therapeutic target for EC treatment.
Accumulating evidence has established that long noncoding RNA (lncRNA) plasmacytoma variant translocation 1 (PVT1) is a tumor regulator in many cancers. Here, we aimed to investigate the possible function of lncRNA PVT1 in esophageal carcinoma (EC) via targeting of microRNA-145 (miR-145). Initially, microarray-based gene expression profiling of EC was employed to identify differentially expressed genes. Moreover, the expression of lncRNA PVT1 was examined and the cell line presenting with the highest level of lncRNA PVT1 expression was selected for subsequent experiments. We then proceeded to examine interaction among lncRNA PVT1, FSCN1, and miR-145. The effect of lncRNA PVT1 on viability, migration, invasion, apoptosis, and tumorigenesis of transfected cells was examined with gain-of-function and loss-of-function experiments. We observed that lncRNA PVT1 was robustly induced in EC. lncRNA PVT1 could bind to miR-145 and regulate its expression, and FSCN1 is a target gene of miR-145. Overexpression of miR-145 or silencing of lncRNA PVT1 was revealed to suppress cell viability, migration, and invasion abilities, while also stimulating cell apoptosis. Furthermore, our in vivo results showed that overexpression of miR-145 or silencing of lncRNA PVT1 resulted in decreased tumor growth in nude mice. In conclusion, our research reveals that down-regulation of lncRNA PVT1 could potentially promote expression of miR-145 to repress cell migration and invasion, and promote cell apoptosis through the inhibition of FSCN1. This highlights the potential of lncRNA PVT1 as a therapeutic target for EC treatment.
Esophageal carcinoma (EC) serves as a common malignant gastrointestinal tumor. Additionally, it is one of the main causes of tumor‐related mortality (Shiba et al., 2018). It has been estimated that in 2012, approximately 455, 800 patients were freshly diagnosed as EC and 400,200 related deaths globally (He et al., 2018). The common risk factors responsible for EC include smoking, drinking, and high body mass index. Furthermore, it has been verified and proven that the ingestion of vegetables and fruits can reduce the morbidity of esophageal carcinoma (Zhao et al., 2018). Although surgery, radiotherapy, and chemotherapy have been developed in the past years, they were established as treatments for EC. The entire survival rates within 5 years are still under 20% due to the high possibilities of recurrence and distant metastasis of EC (Nayan et al., 2018; Zhou et al., 2018). Anastomotic leaks and pulmonary complications are the most frequently reported postoperative complications of EC (Yu et al., 2018).Numerous microRNAs (miRNAs or miRs) have been confirmed to be located at cancer‐related delicate sites and genomic regions. This suggests that miRNAs play roles in the pathogenesis of humancancers (Song et al., 2018). miR‐145 is a tumor suppressor that is found in various cancers (Derouet et al., 2018), such as breast cancer (Johannessen et al., 2017), lung cancer (Mataki et al., 2016), colon cancer (Yu et al., 2017), and gastric cancer (Zeng et al., 2017). In a study prior to this current one, miR‐145 promoted glioma cell apoptosis by suppressing BNIP3, which led to the inactivation of Notch signaling pathway (Du et al., 2017). Moreover, up‐regulation of miR‐145 could potentially reduce proliferation and metastasis of EC (Cui et al., 2016). Long noncoding RNAs (lncRNAs) are transcripts that are typically longer than 200 nt. Some lncRNAs were verified to be incorporated in different processes of malignant tumor development such as carcinogenesis, progression, and metastasis (Hu et al., 2017). lncRNA plasmacytoma variant translocation 1 gene (PVT1) is a well‐studied lncRNA affecting cell apoptosis, migration, invasion, and proliferation (Chai et al., 2018). In addition, lncRNA PVT1 has been found to play an oncogenic role in prostate cancer (Liu et al., 2016). A previous study by Zhuang, et al. revealed that up‐regulation of lncRNA PVT1 promotes cell proliferation and suppresses cell apoptosis in bladder cancer (Liu and Zhang, 2017). lncRNA‐UCA1 upgrades cell migration and invasion by the hsa‐miR‐145/zinc finger E‐box binding homeobox 1/2 (ZEB1/2)/fascin homologue 1 pathway in bladder cancer (Xue et al., 2016). Fascin‐1 (FSCN1) is an actin‐bundling protein that is involved in cancer metastasis and recurrence through the regulation of cellular proliferation and cloning efficiency (Zhang et al., 2018b). It has been demonstrated that the overexpression of miR‐145 could reduce cancer migration through regulating FSCN1 (Zhao et al., 2016). Based on the aforementioned information, a hypothesis was proposed that lncRNA PVT1 may affect the development of EC involving the regulation of miR‐145 and FSCN1. Thus, the focus of the current study is to investigate the mechanism by which lncRNA PVT1/miR‐145/FSCN1 axis participates in the regulation of proliferation, invasion, migration, and apoptosis of EC cells.
Materials and methods
Ethics statement
This experiment was based on the premise of safeguarding the interests of the subjects. All subjects were agreed to donate the diseased materials to the laboratory after ethical review and signed the written informed consent. All study methodologies were conformed to the standards set by the Declaration of Helsinki. The animal experiment strictly adhered to the principle to minimize the pain, suffering, and discomfort to experimental animals. The study methodologies were approved by the Ethics Committee of the Affiliated Cancer Hospital of Zhengzhou University.
Microarray‐based gene expression profiling
EC‐related gene expression datasets (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE23400, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE77861, and http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45168) and annotation probe files were downloaded from a GEO database available at http://www.ncbi.nlm.nih.gov/geo. Affy install package of r software was used to revise the background and conduct normalization processing of each dataset (Fujita et al., 2006). Therefore, the linear model in the Limma install pack method of empirical Bayes statistics was connected with t‐test to perform a nonspecific filtering of the expression profile data. Differently expressed mRNAs and lncRNAs were selected (Smyth, 2004). EC gene expression information was downloaded from TCGA database, which was then evaluated with the use of a r software. Differential analysis was conducted for the transcriptome profiling data with package edgeR of r software (Robinson et al., 2010). False discovery rate was applied on P‐value with package multitest. False discovery rate < 0.05 and |log2 (fold change)| > 1 were set as the threshold. It was used to screen out differentially expressed genes (DEGs). MicroRNA.org (http://34.236.212.39/microrna/getMirnaForm.do), mirdb.org (http://www.mirdb.org/), starbase (http://starbase.sysu.edu.cn/index.php), and targetscan.org (http://www.targetscan.org/vert_71/) were used to predict the target gene of miRNA. RAID v2.0 website (http://www.rna-society.org/raid/index.html) and mircode.org website (http://www.mircode.org/) were employed in order to analyze lncRNA. It was proven to bind to miRNA. The expression of lncRNA PVT1 in EC in The Cancer Genome Atlas (TCGA) was retrieved by using the Expression Profiling Interactive Analysis (GEPIA) database (Tang et al., 2017). Consequently, a curve of disease‐free survival (DFS) was drawn.
Study subjects and cell culture
A total of 50 EC patients (31 males and 19 females) between the ages of 34 and 72 years were enrolled in this study, who underwent surgical treatments from June 2015 to January 2016 in the Department of Pathology, Affiliated Cancer Hospital of Zhengzhou University (Henan Cancer Hospital). EC tissues and adjacent normal tissues of the 50 EC patients were collected. Adjacent normal tissues were extracted from the normal mucosal tissues at the margin of the tumor. These can be observed by the naked eye or from atypical hyperplasia tissues nonstained by Lugol's dye. EC specimens removed surgically were placed under aseptic condition immediately and put into the aseptic Eppendorf (EP) tube free of RNase. Subsequently, the tube was put into nitrogen canisters immediately and preserved in a refrigerator at −80 °C. The basic clinical characteristics of the selected patients are shown in Table S1. The primitive information of patients was noted by the medical record department, and all of the patients were followed up. The patients’ treatment and clinical outcomes were fully comprehended, and the clinical data were completed. The follow‐up was carried out from the end of the operation to January 2019. In total, the follow‐up lasted for a period of 3 years. The relationship between lncRNA PVT1 expression, overall survival (OS), and DFS was analyzed with the use of the Kaplan–Meier method.The study enrolled human EC cell lines KYSE‐30, KYSE‐70, KYSE‐109, Eca109, and TE‐1, and normal esophageal epithelial cell line HEEC (Shanghai Institute of Biochemistry and Cellular Biology, Chinese Academy of Sciences, Shanghai, China). These cell lines were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco Company, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) (Jiangsu Kurt Biological Co., Ltd., Changzhou, Jiangsu, China) in a 5 mL·dL−1 CO2 incubator at 37 °C. When cells reached 80–90% confluence, they were passaged using 0.25 g·dL−1 trypsin (Shanghai Regal Biology Technology Co, Ltd., Shanghai, China).
Plasmid construction, cell grouping, and transfection
In accordance with the sequences of lncRNA PVT1, miR‐145, and FAS searched from NCBI, the blank, lncRNA PVT1 overexpression, lncRNA PVT1 negative control (NC), si‐lncRNA PVT1, miR‐145 NC, miR‐145 mimic, anta‐miR‐145 NC and miR‐145 inhibitor, si‐FSCN1, and miR‐145 inhibitor + si‐FSCN1 plasmids were developed by Shanghai Sangon Biotech Co., Ltd., Shanghai, China.Moreover, 24 h before transfection the cells were inoculated into a 6‐well plate. Upon reaching 30–50% confluence, the cells were transfected with different plasmids. This process was carried out in accordance with the instructions of Lipofectamine 2000 (11668‐019; Invitrogen, New York, CA, USA). The cells at passage 3 transfected with different plasmids were seeded in a 24‐well plate and divided into different groups: the blank group for lncRNA PVT1 (EC cells transfected with 0.4 pmol·μL−1 blank plasmid), the lncRNA PVT1 mimic group (transfected with 0.4 pmol·μL−1 lncRNA PVT1 overexpression plasmid), the NC group for lncRNA PVT1 (transfected with 0.4 pmol·μL−1 lncRNA PVT1 mimic negative meaningless sequences), the si‐lncRNA PVT1 group (transfected with 0.4 pmol·μL−1 si‐lncRNA PVT1 plasmid), the blank group for miR‐145 (transfected with 0.4 pmol·μL−1 miR‐145 negative nonsense sequences), the miR‐145 mimic group (transfected with 0.4 pmol·μL−1 miR‐145 mimic plasmid), the NC group for miR‐145 (transfected with 0.4 pmol·μL−1 miR‐145 inhibitor negative nonsense sequences), the miR‐145 inhibitor group (transfected with 0.4 pmol·μL−1 miR‐145 inhibitor plasmid), the si‐FSCN1 group (transfected with 0.4 pmol·μL−1 si‐FSCN1 plasmid), and the miR‐145 inhibitor + si‐FSCN1 group (transfected with 0.4 pmol·μL−1 miR‐145 inhibitor + si‐FSCN1 plasmid).
RNA isolation and quantitation
miRNeasy Mini Kit (217004; Qiagen, Valencia, CA, USA) was included to extract the total RNA from tissues and cells after transfection. The primer sequences for lncRNA PVT1, miR‐145, FSCN1, and EC‐related genes were designed and then synthesized by Takara Inc., Dalian, China (Table 1). Then, the extraction of the RNA was reverse‐transcribed into complementary DNA (cDNA) in accordance with the instructions of PrimeScript RT Kit (RR036A; Takara, Dalian, China). Following this, reverse transcription–quantitative polymerase chain reaction (RT‐qPCR) was conducted while abiding to the instructions of SYBR® Premix Ex Taq™ II kit (RR820A; TaKaRa, Dalian, China) using ABI 7500 RT‐qPCR instrument (7500; ABI Company, Oyster Bay, NY, USA). Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was considered as an internal control. Hence, relative transcriptional levels of target genes were calculated using the formula: △△Ct = △Ct (model group)−△Ct (normal group), △Ct = Ct (target gene)−Ct (internal control) (Mutus et al., 1989).
Table 1
The primer sequence of RT‐qPCR. Bax, Bcl‐2‐associated X; Bcl‐2, B‐cell lymphoma‐2; F, forward; FSCN1, Fascin‐1; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; lncRNA, long noncoding RNA; miR‐145, microRNA‐145; MTA1, metastasis‐associated protein 1; PVT1, plasmacytoma variant translocation 1 gene; R, reverse; RT‐qPCR, reverse transcription–quantitative polymerase chain reaction; VEGFR2, vascular endothelial growth factor receptor 2.
Gene
Sequence (5′‐3′)
lncRNA PVT1
F: TGAGAACTGTCCTTACGTGACC
R: AGAGCACCAAGACTGGCTCT
miR‐145
F: ACACTCCAGCTGGGGTCCAGTTTTCCCAGGAA
R: CTCAACTGGTGTCGTGGA
FSCN1
F: ACAGCAGGGGACTCAG
R: CCCACCGTCCAGTATTT
CD147
F: GACGACCAGTGGGGAGAGTA
R: GCGAGGAACTCACGAAGAAC
MTA1
F: CAGCTACGAGCAGCACAACG
R: TGTCCGTGGTTTGCCAG
VEGFR2
F: GAAGAGTGCGCCAACGAGC
R: CTCCCGACTTTGTTGACCGCT
Bax
F: CCCGAGAGGTCTTTTTCCGAG
R: CCAGCCCATGATGGTTCTGAT
Bcl‐2
F: GGTGGGGTCATGTGTGTGG
R: CGGTTCAGGTACTCAGTCATCC
GAPDH
F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
The primer sequence of RT‐qPCR. Bax, Bcl‐2‐associated X; Bcl‐2, B‐cell lymphoma‐2; F, forward; FSCN1, Fascin‐1; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; lncRNA, long noncoding RNA; miR‐145, microRNA‐145; MTA1, metastasis‐associated protein 1; PVT1, plasmacytoma variant translocation 1 gene; R, reverse; RT‐qPCR, reverse transcription–quantitative polymerase chain reaction; VEGFR2, vascular endothelial growth factor receptor 2.
Western blot analysis
Radioimmunoprecipitation assay (RIPA) kit (R0010; Beijing Solarbio Life Sciences Co., Ltd., Beijing, China) was taken to extract total proteins from left lung tissues in each group. A bicinchoninic acid (BCA) kit (G3522‐1; Guangzhou Jepes Biotechnology Co., Ltd., Guangzhou, China) was used to determine protein concentration. Proteins were transferred onto nitrocellulose (NC) membrane after separation by polyacrylamide gel electrophoresis. The membranes were then blocked with 5% bovine serum albumin (BSA) for 1 h. The membrane was incubated overnight at 4 °C with the following diluted primary rabbit antibodies that were purchased and obtained from Abcam Inc., Cambridge, MA, USA: FSCN1 (1 : 10 000; ab126772), CD147 (1 : 1000; ab108317), vascular endothelial growth factor receptor 2 (VEGFR2) (1 : 10 000; ab10972), metastasis‐associated protein 1 (MTA1) (1 : 2000; ab71153), Bcl‐2‐associated X protein (Bax) (1 : 1000; ab32503), and B‐cell lymphoma 2 (Bcl‐2) (1 : 1000; ab32124). The membrane was rinsed with phosphate‐buffered saline (PBS) five times (5 min/time) and incubated with horseradish peroxidase (HRP)‐conjugated goat anti‐rabbit immunoglobulin G (IgG) (1 : 5000; Beijing Zhongshan Biotechnology Co., Ltd., Beijing, China). Finally, enhanced chemiluminescence (ECL) reagent (ECL808‐25; Biomiga, Suisun City, CA‐92121, USA) was incorporated to visualize the results by the X‐ray film (36209ES01; Qianchen Biotechnology Co., Ltd., Shanghai, China). The ratio of the gray value of the target band to GAPDH represented the relative protein expression.
Fluorescence in situ hybridization
The separation of cytoplasm and nucleus was conducted. In brief, the transfected cells were collected, transferred into a 1.5‐mL EP tube, and centrifuged for 2–3 min. After the supernatant was discarded, the pellet was dissolved in precooled CER I by the maximum rotational speed vortex and lysed on ice for 10 min. Afterward, precooled CER II was added, followed by vortex at the maximum rotational speed for 5 s. The samples were incubated on ice for 1 min and centrifuged at 4 °C for 5 min. The supernatant containing cytoplasm was collected in a new centrifuge tube and preserved at −80 °C. The pellets were washed and precipitated using PBS three times. The pellets were supplemented with precooled CER followed by vortex at the maximum rotational speed for 15 s. The samples were incubated on ice for 40 min, followed by vortex for 15 s. The samples were centrifuged for 10 min at 4 °C. Furthermore, the supernatant containing nuclear components was transferred into a new EP tube and preserved at −80 °C for subsequent use.In situ hybridization was subsequently performed. On the first day, the slide was dried at 50 °C for 15–30 min and then fixed in diethylpyrocarbonate (DEPC)/4% polytetrafluoroethylene (PFA) for 20 min. The slide was rinsed once in 1 × DEPC/phosphate‐buffered saline (PBS) and bathed in 1 × DEPC/PBS for 5 min. The slide was detached with protease K for 10 min, then rerinsed in the 1 × DEPC/PBS, and fixed in the DEPC/4% PFA for 10 min. Afterward, the slide was rinsed once in the 1 × DEPC/PBS and then bathed in the 1 × DEPC/PBS for 5 min. The slide was incubated with acetic acid (0.1 M RNase‐free triethylamine (TEA) for 10 min, rinsed once in the 1 × DEPC/PBS, and rerinsed in the 1 × DEPC/PBS for 5 min). Every slice was prehybridized with 200 μL prehybridization solution in a hybrid box for 1 h. The hybrid box contained 50% 20 × SSC and 50% formamide. The slices were then hybridized with a RNA probe (0.1–0.2 ng·μL−1) overnight at 65 °C for 12–16 h. On the second day, the slide was bathed in the preheated 0.2 × SSC three times (20 min/time) and rebathed in 0.2 × SSC for 5 min, twice in Buffer B1 (5 min/time). It was then enclosed by Buffer B2 for 1 h and incubated with anti‐digoxigenin/alkaline phosphatase (anti‐DIG‐AP Fab antibody) (diluted by Buffer B2 at 1 : 5000) overnight at 4 °C. On the third day, the slide was bathed in Buffer B1 three times (20 min/time) and sliced evenly by Buffer B3 at room temperature (5–10 min/time). The slices were incubated with newly configured 5‐bromo‐4‐chloro‐3‐indolyl phosphate/nitroblue tetrazolium (BCIP/NBT) chromogenic liquid in a dim‐light room for 3–24 h, which was ended by ddH20.
Dual‐luciferase reporter gene assay
Bioinformatic website RNA22 was used to analyze the target relationship between lncRNA PVT1 and miR‐145, and dual‐luciferase reporter gene assay was carried out to verify whether miR‐145 was a target of lncRNA PVT1, and whether FSCN1 was a target gene of miR‐145. Initially, the full length of lncRNA PVT1 was ligated into pmirGLO Dual‐Luciferase miRNA Target Expression Vector (Promega Corporation, Madison, WI, USA) to construct wild‐type (WT) pmirGLO‐lncRNA. pmirGLO‐lncRNA mutant (MUT) was also developed in which the binding sites of miR‐145 were mutated. Target sequence and mutation sequence were created according to potential binding sites of miR‐145 on the 3′‐untranslated region (3′UTR) of FSCN1. The cells were seeded in a 6‐well plate at a density of 2 × 105 cells/well and then transfected. After 48 h of transfection, the cells were collected and dual‐luciferase reporter gene assay was performed based off of the instructions of dual‐luciferase detection kit (D0010; Beijing Solarbio Life Sciences Co., Ltd, Beijing, China). Fluorescence intensity was measured by means of a GloMax 20/20 luminometer fluorescence detector in Promega Corporation, Madison, WI, USA (Shanxi Zhongmei Biotechnology Co., Ltd., Shanxi, China).
RNA binding protein immunoprecipitation assay
The binding between lncRNA PVT1 and argonaute 2 (Ago2) protein was assessed with the use of a RIP kit (Merck Millipore Darmstadt, Germany). The cells were washed using precooled PBS, and the supernatant was discarded. The cells were lysed using equal volume of RIPA lysis in ice bath for 5 min and centrifuged at 2192 × g for 10 min at 4 °C to collect the supernatant. Subsequently, the supernatant was incubated with an antibody for coprecipitation. Specifically, 50 μL magnetic beads of each coprecipitation system were washed, resuspended in 100 μL RIP Wash Buffer, and incubated with 5 μg antibodies, including Ago2 (1: 50; ab186733) and IgG (1: 100; ab109489) separately. The antibodies were obtained from Abcam Inc., Cambridge, UK. Next, the bead–antibody complex was rinsed, resuspended in 900 μL RIP Wash Buffer, and incubated with 100 μL cell extract at 4 °C overnight. The samples were then placed on the bead pedestal to collect the complex of bead protein. After the samples were treated with protease K, the RNA was extracted for RT‐qPCR detection.
RNA pull‐down assay
The cells were transfected with the use of 50 nm biotin‐labeled Bio‐miR‐145‐WT and Bio‐miR‐145‐MUT (Wuhan GeneCreate Biological Engineering Co., Ltd., Wuhan, China). After 48 h, the cells were harvested and rinsed using PBS. The cells were incubated in specific lysis buffer (Ambion, Austin, Texas, USA) for 10 min. The cell lysate was incubated with M‐280 streptavidin magnetic bead (S3762; Sigma‐Aldrich Chemical Co., St Louis, MO, USA) precoated with RNase‐free BSA and yeast tRNA (TRNABAK‐RO; Sigma‐Aldrich Chemical Co., St Louis, MO, USA) at 4 °C overnight. In the following step, the cell lysate was washed twice with precooled lysis buffer, three times with low salt buffer, and once with high salt buffer. The bounded RNA was purified using TRIzol, and lncRNA PVT1 expression was detected by RT‐qPCR.
When cell density reached 80% after transfection, the cells were detached by 0.25% trypsin and then made into single‐cell suspension. After accurate measurement, the cells were seeded in a 96‐well plate at a density of 3 × 103‐6 × 103 cells/well, with 0.2 mL/well. Six duplicated wells were set. After 24 h, 48 h, and 72 h of culture, culture medium containing 10% MTT (5 g·L−1) (GD‐Y1317; Guduo Biotechnology Co., Ltd., Shanghai, Beijing) was added, and the cells were cultured for 4 h. The supernatant was extracted. Each well was incubated with 100 μL dimethyl sulfoxide (DMSO) (D5879‐100ML; Sigma‐Aldrich Chemical Company, St Louis MO, USA) for 10 min to dissolve the formazan crystal produced by living cells. Optical density (OD) value in each well at 490 nm was measured using an enzymatic marker (Nanjing Detie Experimental Equipment Co., Ltd.). Cell viability curve graph was created with time point as abscissa and OD value as ordinate.
Scratch test
After 48 h of transfection, the cells were inoculated into a 6‐well plate. After the cells adhered to the wall, the culture medium was replaced with serum‐free Dulbecco's modified Eagle's medium (DMEM) (http://www.thermofisher.com). When cell confluence reached 90–100%, 10 μL pipette was employed to scratch on the bottom of the 6‐well plate vertically. Each well was scratched about 4–5 strips with same width. The scratched cells were washed away, and the plate was placed into an incubator for further culture. Migration distance of cell scratch region was examined under an inverted microscope after scratch for 24 h. Photographs of several randomly selected views were obtained. All investigations involved at least 3 wells, each repeated in triplicate.
Transwell assay
After 48 h of transfection, the cells were starved for 24 h in serum‐free medium and then detached, followed by two washes using PBS. Following this, the cells were resuspended with serum‐free medium Opti‐MEMI (31985008; Nanjing Senbega Biotechnology Co., Ltd., Jiangsu, China), which contained 10 g·L−1 BSA with the density adjusted to 3 × 104 cells·mL−1. Transwell chambers were situated into a 24‐well plate. The apical chamber of the bottom membrane of Transwell chamber was coated with Matrigel (1: 8, 40111ES08; Shanghai Yisheng Biotechnology Co., Ltd., Shanghai, China). Once cells in each group were detached normally, they were rinsed twice with PBS and resuspended with RPMI 1640 medium at a density of 1 × 105 cells·mL−1. Furthermore, 200 μL cell suspension was included in the apical chamber covered with Matrigel. Afterward, 600 μL RPMI 1640 medium containing 20% FBS was added into the basolateral chamber. When the cells were normally cultured for about 24 h, Transwell chamber was removed and collected. Inner cells of the apical chamber were erased with a cotton bud, fixed for 15 min with 4% paraformaldehyde, and stained with 0.5% crystal violet solution for 15 min. Lastly, the invasive cells were measured under an inverted microscope (XDS‐800D; Shanghai Caikon Optical Instrument Co., Ltd., Shanghai, China) in 5 randomly selected visual fields. All investigations involved at least 3 wells, each repeated in triplicate.
Flow cytometry
After 48 h of transfection, the cells were collected, washed with precooled equilibrium salt solution twice, and centrifuged at 179 × g for 5 min. Then, the supernatant was discarded. The cells were fixed with precooled 70% ethyl alcohol overnight at 4 °C. After the cells were washed with balanced salt solution PBS, they were centrifuged at 179 × g for 5 min. Next, 10 μL RNase enzyme was added into the cells and incubated at 37 °C for 5 min. The cells were stained with 1% propidium iodide (PI) (40710ES03; Shanghai Qianchen Biotechnology Co., Ltd.) for 30 min devoid of light. Eventually, the cells were situated in a flow cytometry (FACSCalibur; BD, FL, NJ, USA). The cell cycle was recorded and measured according to red fluorescence at 488 nm.After 48 h of transfection, the cells were collected and washed with precooled PBS. The apoptosis of cells was determined with the use of a Annexin V/fluorescein isothiocyanate (FITC)/PI apoptosis detection kit (CA1020; Beijing Solarbio Life Sciences Co., Ltd., Beijing, China). Next, the cells were washed using binding buffer and incubated with a mixed solution of Annexin V/FITC and binding buffer at dilution rate of 1 : 40 for 30 min. It was then incubated with mixed solution of PI and binding buffer at 1 : 40 for 15 min. Consequently, cell apoptosis was measured using flow cytometry.
Tumor formation in nude mice
Nude mice were subcutaneously injected with EC cells. Fifty BALB/CA nude mice weighing 16–20 g and aged 6–8 weeks were randomly grouped into 10 groups: 5 lncRNA PVT1‐related groups: lncRNA PVT1: the blank, NC, lncRNA PVT1 mimic, and si‐lncRNA PVT1 groups; and 5 miR‐145‐related groups: the blank, NC, miR‐145 mimic, miR‐145 inhibitor, and miR‐145 inhibitor + siPVT1 groups. Next, 100 μL cell suspension (1 × 107 cells·mL−1) was subcutaneously injected into the right axilla of each nude mice. Tumorigenesis in nude mice was analyzed once a week. The tumor weight was measured using an electronic balance, and the volume was measured with the use of vernier calipers. The changes in spirit, diet, and activities of nude mice were recorded. The nude mice were euthanized by CO2 asphyxiation at the fourth week. The tumor tissues were separated, and tumor weight and volume were measured (Volume = 1/2 × length × width2). Tumor tissues were soaked in 4% polyaldehyde at room temperature or at 4 °C for subsequent use.
Statistical analysis
Statistical analyses were conducted using SPSS 21.0 (IBM Corp. Armonk, NY, USA). The measurement data were presented as mean ± standard deviation. Independent‐samples t‐test was performed for comparisons between the two groups. One‐way analysis of variance (ANOVA) was adopted to analyze comparisons between multiple groups followed by a Tukey multiple comparison post‐test. The OS was calculated with the use of Kaplan–Meier method. P < 0.05 was considered to be of statistical significance.
Results
lncRNA PVT1 and FSCN1 are highly expressed in EC tissues and cells
MMP1, GPD1L, KAT2B, and FSCN1 were expressed differently in EC from EC datasets http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE23400, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129, and http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE77861 (Fig. 1A). http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE20347 dataset and TCGA database were used to coverify that only FSCN1 was highly expressed in EC (Fig. 1B,C). It was revealed that FSCN1 may be a target gene of hsa‐miR‐429, hsa‐miR‐200c‐3p, hsa‐miR‐488‐3p, hsa‐miR‐145‐5p, hsa‐miR‐200b‐3p, and hsa‐miR‐24‐3p based on the websites microRNA.org, mirdb.org, starbase, and targetscan.org (Fig. 1D). TCGA database showed that only hsa‐miR‐145‐5p was poorly expressed in EC (Fig. 1E). It was verified that lncRNA PVT1 has the potential to bind to hsa‐miR‐145‐5p in accordance with websites RAID v2.0 and mircode.org. It was proven that lncRNA PVT1 was highly expressed in EC based on chip http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45168 and TCGA database (Fig. 1F,G). This study collected EC and adjacent normal tissues from a total of 50 patients with EC. Then, RT‐qPCR was conducted to detect the expression of lncRNA PVT1. The results illustrated in Fig. 1H exposed that compared with adjacent normal tissues, the expression of lncRNA PVT1 in EC tissues was increased (P < 0.05). As illustrated in Fig. 1I, compared with normal epithelial cell line HHEC, the expression of lncRNA PVT1 in cell lines KYSE‐30, KYSE‐70, KYSE‐109, Eca109, and TE‐1 was increased (P < 0.05), among which KYSE‐30 cell line presented with the highest lncRNA PVT1 expression. Therefore, KYSE‐30 cell line was selected for subsequent experimentations. Subsequent results in relation to the correlation between lncRNA PVT1 expression and DFS and OS analyzed by the Kaplan–Meier method showed that OS and DFS of patients with high lncRNA PVT1 expression were significantly lower than those with low lncRNA PVT1 expression. This suggested that high lncRNA PVT1 expression was associated with poor prognosis (Fig. 1J).
Figure 1
lncRNA PVT1 is highly expressed in EC tissues and cells. A, Wayne chart of top 100 differential genes of datasets http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE23400, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129, and http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129; B, expression level of FSCN1 on http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE20347; C, expression level of FSCN1 on TCGA database; D, target of FSCN1 on four bioinformatics; E, expression level of miR‐145 on TCGA database; F, thermal map of dataset http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45168; G, expression‐level scatter diagram of lncRNA PVT1 on TCGA database; H, expression of lncRNA PVT1 in cancer tissues and adjacent normal tissues detected by RT‐qPCR. Statistical values were measurement data and expressed as mean ± standard deviation. t‐Test was used to conduct data analysis, n = 50; I, expression of lncRNA PVT1 in KYSE‐30, KYSE‐70, KYSE‐109, Eca109, TE‐1, and HHEC cell lines detected by RT‐qPCR; J, the correlation between lncRNA PVT1 expression and DFS and OS analyzed by the Kaplan–Meier method (n = 50). The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; # vs. adjacent normal tissues, P < 0.05; * vs. HEEC cell lines, P < 0.05.
lncRNA PVT1 is highly expressed in EC tissues and cells. A, Wayne chart of top 100 differential genes of datasets http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE23400, http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129, and http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38129; B, expression level of FSCN1 on http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE20347; C, expression level of FSCN1 on TCGA database; D, target of FSCN1 on four bioinformatics; E, expression level of miR‐145 on TCGA database; F, thermal map of dataset http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE45168; G, expression‐level scatter diagram of lncRNA PVT1 on TCGA database; H, expression of lncRNA PVT1 in cancer tissues and adjacent normal tissues detected by RT‐qPCR. Statistical values were measurement data and expressed as mean ± standard deviation. t‐Test was used to conduct data analysis, n = 50; I, expression of lncRNA PVT1 in KYSE‐30, KYSE‐70, KYSE‐109, Eca109, TE‐1, and HHEC cell lines detected by RT‐qPCR; J, the correlation between lncRNA PVT1 expression and DFS and OS analyzed by the Kaplan–Meier method (n = 50). The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; # vs. adjacent normal tissues, P < 0.05; * vs. HEEC cell lines, P < 0.05.
Down‐regulation of lncRNA PVT1 and up‐regulation of miR‐145 reduce expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet increase Bax in EC
Expression of lncRNA PVT1, miR‐145, and EC‐related genes in EC cells was evaluated by RT‐qPCR. As shown in Fig. 2A,B, in the lncRNA PVT1‐related groups, the blank group and the NC group exhibited no significant difference (P > 0.05). In comparison with the blank group and the NC group, the expression of lncRNA PVT1, FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 in the lncRNA PVT1 mimic group was increased (P < 0.05) and that of Bax and miR‐145 was decreased, which was reversed by si‐lncRNA PVT1 (P < 0.05). In the miR‐145‐related groups, no differences were noted in the blank group and the NC group. When compared with the blank group and the NC group, the expression of lncRNA PVT1, FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 in the miR‐145 mimic group and the si‐FSCN1 group was decreased (P < 0.05) and that of Bax and miR‐145 was increased (P < 0.05). In the miR‐145 inhibitor group, opposite results regarding the expression of lncRNA PVT1, FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, Bax, and miR‐145 were observed (P < 0.05). To elaborate, no coherent differences were found in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). The above results showed that lncRNA PVT1 silencing and miR‐145 overexpression can decrease expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet also potentiate Bax expression in EC.
Figure 2
Silencing of lncRNA PVT1 and overexpressed miR‐145 down‐regulate mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet up‐regulate Bax expression. A, mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax upon lncRNA PVT1 interference treatment determined by RT‐qPCR; B, mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax upon miR‐145 interference treatment determined by RT‐qPCR. The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 down‐regulate mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet up‐regulate Bax expression. A, mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax upon lncRNA PVT1 interference treatment determined by RT‐qPCR; B, mRNA expression of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax upon miR‐145 interference treatment determined by RT‐qPCR. The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 and up‐regulation of miR‐145 reduce protein expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet increase Bax in EC
Western blot analysis was carried out to detect the protein expression of FSCN1 and EC‐related genes (Fig. 3A–D). In the lncRNA PVT1‐related groups, the blank and NC groups retained similar trends (P > 0.05). When compared with the blank group and the NC group, the expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 in the lncRNA PVT1 mimic group was relatively higher, while Bax was lower (P < 0.05). This was then blocked by si‐lncRNA PVT1. In the miR‐145‐related groups, the results in the blank and NC groups remained similar. In comparison with the blank group and the NC group, the expression of lncRNA PVT1, FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 in the miR‐145 mimic group and the si‐FSCN1 group was lower (P < 0.05) and that of Bax was higher (P < 0.05). miR‐145 inhibitor resulted in opposite results regarding the expression of lncRNA PVT1, FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax (P < 0.05). The expression of those genes remained similar in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). With these all taken into account, the protein expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 was down‐regulated and that of Bax was up‐regulated when lncRNA PVT1 was inhibited or miR‐145 was overexpressed.
Figure 3
Silencing of lncRNA PVT1 and overexpressed miR‐145 decrease protein expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet increase Bax expression. A and B, western blot analysis of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax proteins upon lncRNA PVT1 interference treatment; C and D, western blot analysis of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax proteins upon miR‐145 interference treatment. The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 decrease protein expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 yet increase Bax expression. A and B, western blot analysis of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax proteins upon lncRNA PVT1 interference treatment; C and D, western blot analysis of FSCN1, Bcl‐2, CD147, VEGFR2, MTA1, and Bax proteins upon miR‐145 interference treatment. The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
lncRNA PVT1 specifically binds to miR‐145
FISH, bioinformatic analysis and dual‐luciferase reporter gene assay were conducted in order to explore the relationship between lncRNA PVT1 and miR‐145 and how they interact with one another. Analysis on the online prediction websites suggested that lncRNA PVT1 (Homo sapiens) was mainly located in cytoplasm, which was confirmed by FISH in human tissues (Fig. 4A,B). The online analysis software predicted that there were specific binding regions between lncRNA PVT1 sequence and miR‐145 sequence (Fig. 4C). Dual‐luciferase reporter gene assay results exploited that when compared with the NC mimic group, the luciferase activity of the lncRNA PVT1 in the miR‐145 mimic group was decreased (P < 0.05), while that of lncRNA PVT1 MUT between the NC mimic group and the miR‐145 mimic group remained similar (P > 0.05). It was suggested that lncRNA PVT1 bound to miR‐145 (Fig. 4D).
Figure 4
miR‐145 is a target of lncRNA PVT1. A, Subcellular location of lncRNA PVT1 measured by FISH; B, predicted binding site of miR‐145 in 3′ UTR of lncRNA PVT1 determined by FISH (×400, scale bar = 25 μm); C, specific binding regions between lncRNA PVT1 sequence and miR‐145 sequence analyzed by online analysis software; D, the binding of lncRNA PVT1 to miR‐145 verified by dual‐luciferase reporter gene assay; E, the binding of lncRNA PVT1 with Ago2 detected by RIP assay; F, the enrichment of lncRNA PVT1 by miR‐145 detected by RNA pull‐down assay. The values of luciferase activity were measurement data, expressed as mean ± standard deviation, and analyzed using unpaired t‐test. The experiment was repeated three times independently; * vs. the NC group, P < 0.05.
miR‐145 is a target of lncRNA PVT1. A, Subcellular location of lncRNA PVT1 measured by FISH; B, predicted binding site of miR‐145 in 3′ UTR of lncRNA PVT1 determined by FISH (×400, scale bar = 25 μm); C, specific binding regions between lncRNA PVT1 sequence and miR‐145 sequence analyzed by online analysis software; D, the binding of lncRNA PVT1 to miR‐145 verified by dual‐luciferase reporter gene assay; E, the binding of lncRNA PVT1 with Ago2 detected by RIP assay; F, the enrichment of lncRNA PVT1 by miR‐145 detected by RNA pull‐down assay. The values of luciferase activity were measurement data, expressed as mean ± standard deviation, and analyzed using unpaired t‐test. The experiment was repeated three times independently; * vs. the NC group, P < 0.05.Following this, a RIP assay was performed to verify the possible relation between lncRNA PVT1 and Ago2. The results (Fig. 4E) suggested that the level of lncRNA PVT1 increased in the Ago2 group (P < 0.05). Subsequent results obtained from RNA pull‐down assay demonstrated that the enrichment of lncRNA PVT1 was elevated in the Bio‐miR‐145‐wt group when compared to that in the Bio‐probe NC group (P < 0.05), while Bio‐miR‐145‐mut exhibited no difference (P > 0.05) (Fig. 4F). The above results demonstrated that lncRNA PVT1 negatively regulated the expression of miR‐145.
FSCN1 is a target gene of miR‐145
Bioinformatic analysis and dual‐luciferase reporter gene assay were utilized to clarify the target relationship between miR‐145 and FSCN1. The online analysis software microRNA.org illustrated that there were specific binding regions between FSCN1 sequence and miR‐145 sequence, indicating FSCN1 might be a target gene of miR‐145 (Fig. 5A). Dual‐luciferase reporter gene assay data showed that compared with the NC group, luciferase activity of the FSCN1 in the miR‐145 mimic group was decreased (P < 0.05). No significant differences were witnessed in the luciferase activity of FSCN1 MUT between the NC mimic group and the miR‐145 group (P > 0.05) (Fig. 5B). On the basis of aforementioned evidence, it can be concluded that FSCN1 was a target of miR‐145.
Figure 5
FSCN1 is a target gene of miR‐145. A, Specific binding regions between FSCN1 sequence and miR‐145 sequence detected by the online analysis software microRNA; B, the binding of miR‐145 to FSCN1 verified by dual‐luciferase reporter gene assay; the values of luciferase activity were measurement data, expressed as mean ± standard deviation, and analyzed using unpaired t‐test. The experiment was repeated three times independently; * vs. the NC group, P < 0.05.
FSCN1 is a target gene of miR‐145. A, Specific binding regions between FSCN1 sequence and miR‐145 sequence detected by the online analysis software microRNA; B, the binding of miR‐145 to FSCN1 verified by dual‐luciferase reporter gene assay; the values of luciferase activity were measurement data, expressed as mean ± standard deviation, and analyzed using unpaired t‐test. The experiment was repeated three times independently; * vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 inhibits EC cell viability
In order to detect the viability of EC cells in each group, MTT assay was conducted (Fig. 6A,B). In lncRNA PVT1‐related groups, there were no differences in cell viability between the blank group and the NC group at each time point (P > 0.05). But when compared with the blank group and the NC group, the cell viability in the lncRNA PVT1 mimic group was increased (P < 0.05), while it was decreased in the si‐lncRNA PVT1 group (P < 0.05). In the miR‐145‐related groups, there were no obvious differences in cell viability between the blank group and the NC group at each time point (P > 0.05). When compared to the blank group and the NC group, cell viability in the miR‐145 mimic group and the si‐FSCN1 group was decreased (P < 0.05), while it was increased in the miR‐145 inhibitor group (P < 0.05). No obvious differences in the cell viability were revealed in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). The results above demonstrated that suppression of lncRNA PVT1 or miR‐145 overexpression could increase viability of EC cells.
Figure 6
Silencing of lncRNA PVT1 and overexpressed miR‐145 inhibit EC cell viability. A and B, Cell viability determined by MTT assay. Results of viability capacity in each group were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 inhibit EC cell viability. A and B, Cell viability determined by MTT assay. Results of viability capacity in each group were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 inhibits EC cell migration
Scratch test was carried out to determine the effect that silenced lncRNA PVT1 and miR‐145 have on migration of EC cells (Fig. 7A–D). In lncRNA PVT1‐related groups, no obvious differences were found in the blank and NC groups (P > 0.05). But when compared with the blank group and the NC group, cell migration in the lncRNA PVT1 mimic group was increased (P < 0.05), while in the si‐lncRNA PVT1 group, it was reduced (P < 0.05). In the miR‐145‐related groups, no obvious differences in cell migration were revealed between the blank group and the NC group (P > 0.05). But when compared with the blank group and the NC group, cell migration in the miR‐145 mimic group and the si‐FSCN1 group was decreased (P < 0.05), whereas the cell migration exhibited an increment in the miR‐145 inhibitor group (P < 0.05). Furthermore, no obvious differences in cell migration were found in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). The results of scratch test showed that the inhibition of lncRNA PVT1 or overexpression of miR‐145 could inhibit EC cell migration.
Figure 7
Silencing of lncRNA PVT1 and overexpressed miR‐145 hinder EC cell migration. A and B, Migration of EC cells after lncRNA PVT1 interference treatment determined by scratch test (×40, scale bar = 250 μm); C and D, migration of EC cells after miR‐145 interference treatment determined by scratch test (×40, scale bar = 250 μm). The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 hinder EC cell migration. A and B, Migration of EC cells after lncRNA PVT1 interference treatment determined by scratch test (×40, scale bar = 250 μm); C and D, migration of EC cells after miR‐145 interference treatment determined by scratch test (×40, scale bar = 250 μm). The results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 inhibits EC cell invasion
Subsequently, the possible effect of lncRNA PVT1 and miR‐145 on EC cell invasion was identified (Fig. 8A–D). In lncRNA PVT1‐related groups, no differences were found in the blank group and the NC group (P > 0.05). However, in contrast to the blank and NC groups, the cell invasion of the lncRNA PVT1 mimic group was increased, while the si‐lncRNA PVT1 group exhibited a decrease in cell invasion. In miR‐145‐related groups, compared with the blank group and the NC group, cell invasion of the miR‐145 mimic group and the si‐FSCN1 group was decreased (P < 0.05), and in the miR‐145 inhibitor group, it was increased (P < 0.05). No obvious differences were found in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). To conclude, the inhibition of lncRNA PVT1 or overexpression of miR‐145 could potentially inhibit EC cell invasion.
Figure 8
Silencing of lncRNA PVT1 and overexpressed miR‐145 decrease EC cell invasion. A and B, Cell invasion in response to lncRNA PVT1 interference treatment determined by Transwell assay (×100, scale bar = 100 μm); C and D, cell invasion in response to miR‐145 interference treatment determined by Transwell assay (×100, scale bar = 100 μm). Statistical results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 decrease EC cell invasion. A and B, Cell invasion in response to lncRNA PVT1 interference treatment determined by Transwell assay (×100, scale bar = 100 μm); C and D, cell invasion in response to miR‐145 interference treatment determined by Transwell assay (×100, scale bar = 100 μm). Statistical results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 promotes EC cell apoptosis
PI staining and Annexin V/PI double staining were performed to detect cell cycle and cell apoptosis, respectively. As shown in Fig. 9A–D, in the lncRNA PVT1‐related groups, no obvious differences in cell apoptosis were found between the blank group and the NC group (P > 0.05). In comparison with the blank group and the NC group, in addition to decreased apoptosis rate, less G1 phase‐arrested cells and more S phase‐arrested cells were detected in the lncRNA PVT1 mimic group (P < 0.05). In the si‐lncRNA PVT1 group, more G1 phase‐arrested cells but less S phase‐arrested cells and increased apoptosis rate were identified (P < 0.05). The above results proved that inhibition of lncRNA PVT1 can stimulate EC cell apoptosis.
Figure 9
Silencing of lncRNA PVT1 stimulates EC cell apoptosis. A and B, Cell cycle distribution in response to lncRNA PVT1 interference treatment measured using PI single staining; C and D, Cell apoptosis in response to lncRNA PVT1 interference treatment measured using Annexin V/PI double staining. Statistical results of panel B were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. Statistical results of panel D were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 stimulates EC cell apoptosis. A and B, Cell cycle distribution in response to lncRNA PVT1 interference treatment measured using PI single staining; C and D, Cell apoptosis in response to lncRNA PVT1 interference treatment measured using Annexin V/PI double staining. Statistical results of panel B were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. Statistical results of panel D were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Up‐regulation of miR‐145 induces EC cell apoptosis
PI staining and Annexin V/PI double staining were used to detect cell cycle and cell apoptosis, respectively. As shown in Fig. 10A–D, in the miR‐145‐related groups, no obvious differences in cell apoptosis were uncovered between the blank group and the NC group (P > 0.05). Compared with the blank group and the NC group, in addition to increased apoptosis rate, more G1 phase‐arrested cells and less S phase‐arrested cells were detected in the miR‐145 mimic group and the si‐FSCN1 group (P < 0.05); which was reversed in the miR‐145 inhibitor group (P < 0.05); no obvious differences in cell cycle and cell apoptosis were observed in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). In conclusion, overexpressed miR‐145 could promote EC cell apoptosis.
Figure 10
Overexpressed miR‐145 promotes cell apoptosis. A and B, Cell cycle in response to miR‐145 interference treatment determined by PI staining; C and D, cell apoptosis in response to miR‐145 interference treatment determined by Annexin V/PI double staining. Statistical results of panel B were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. Statistical results of panel D were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Overexpressed miR‐145 promotes cell apoptosis. A and B, Cell cycle in response to miR‐145 interference treatment determined by PI staining; C and D, cell apoptosis in response to miR‐145 interference treatment determined by Annexin V/PI double staining. Statistical results of panel B were measurement data, expressed as mean ± standard deviation, and analyzed using repeated measurement of one‐way ANOVA. Statistical results of panel D were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Down‐regulation of lncRNA PVT1 inhibits EC tumor growth
Tumor formation in nude mice was analyzed to determine the effects of lncRNA PVT1 on the development of EC. As shown in Fig. 11A–C, in the lncRNA PVT1‐related groups, no obvious difference was found in the blank and NC groups (P > 0.05). When compared with the blank group and the NC group, the tumor volume and weight were increased in the lncRNA PVT1 mimic group (P < 0.05), while the tumor volume and weight were decreased in the si‐lncRNA PVT1 group (P < 0.05). In the miR‐145‐related groups (Fig. 11D–F), no obvious differences in tumor volume and weight of nude mice were found between the blank group and the NC group (P > 0.05). In comparison with the blank group and the NC group, tumor volume and weight of nude mice were decreased in the miR‐145 mimic and si‐FSCN1 groups (P < 0.05), increased in the miR‐145 inhibitor group (P < 0.05), and exhibited no obvious difference in the miR‐145 inhibitor + si‐FSCN1 group (P > 0.05). The above results suggested that inhibition of lncRNA PVT1 or up‐regulation of miR‐145 might inhibit the development of EC.
Figure 11
Silencing of lncRNA PVT1 and overexpressed miR‐145 disrupt tumor growth. (A–C) Xenograft tumors and quantitative analysis of tumor growth after lncRNA PVT1 interference treatment; D‐F, xenograft tumors and quantitative analysis of tumor growth after miR‐145 interference treatment. The above results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Silencing of lncRNA PVT1 and overexpressed miR‐145 disrupt tumor growth. (A–C) Xenograft tumors and quantitative analysis of tumor growth after lncRNA PVT1 interference treatment; D‐F, xenograft tumors and quantitative analysis of tumor growth after miR‐145 interference treatment. The above results were measurement data, expressed as mean ± standard deviation, and analyzed using one‐way ANOVA. The experiment was repeated three times independently; * vs. the blank group, P < 0.05; # vs. the NC group, P < 0.05.
Discussion
EC is one of the most common types of cancer accompanied by poor prognosis, and the poor outcomes in EC patients are related to diagnosis at advanced stages and the tendency for metastases (Liu et al., 2018b). lncRNAs and miRNAs have been revealed to have the potential to function in the initiation and progression of EC (Pan et al., 2016; Qi et al., 2017). The present study explored the mechanism of how lncRNA PVT1 and miR‐145 function in EC cells. Consequently, it was found that silencing lncRNA PVT1 up‐regulated miR‐145 and conferred inhibitory effects on EC cell viability, invasion, migration, and stimulative effect on cell apoptosis through the knockdown of FSCN1.The initial results from western blot analysis and RT‐qPCR showed that miR‐145 was poorly expressed, but lncRNA PVT1 and FSCN1 were highly expressed in EC. miR‐145 was down‐regulated in many types of humancancer, including gastrointestinal tract (Chen et al., 2010), lung cancer (Ling et al., 2015), and gallbladder cancer (Letelier et al., 2014). It has been validated that lncRNA AK001796 could act as an effective treatment target and underlying prognostic factor for esophageal squamous cell carcinoma (ESCC) (Liu et al., 2018a). Interestingly, Wu et al. also revealed that overexpressed lncRNA PVT1 was related to tumorigenesis and poor prognosis in cancers (Wu et al., 2017). In addition, FSCN1 was expressed at a high level in ESCC (Shang et al., 2018), and overexpression of FSCN1 led to poor prognosis in ESCC (Akanuma et al., 2014). Similarly, a research on ESCCCHUI8 displayed that miR‐145 down‐regulated FSCN1 and the aberrant expression of lncRNA promoted the expression of FSCN1 (Shang et al., 2018).Expression of FSCN1, Bcl‐2, CD147, VEGFR2, and MTA1 was down‐regulated and that of Bax was up‐regulated upon treatment of silencing lncRNA PVT1 or overexpressed miR‐145. Knockdown of lncRNA PVT1 elevates expression of Bax and decreases that of antiapoptotic factor Bcl‐2 (Ping et al., 2018). VEGFs regulated vascular development, lymphangiogenesis, and angiogenesis by binding to various receptors, among which VEGFR2 could influence cell viability, migration, and survival (Holmes et al., 2007). Silencing VEGFR2 could promote cell development and angiogenesis in mouse models of pancreatic ductal adenocarcinoma, and up‐regulation of miR‐200 leads to decreased VEGFR2 (Sureban et al., 2013). MTA1 acts as a tumor metastasis‐related gene whose expression was found to be higher with the increasing stage of ESCC (Liu et al., 2017). Additionally, CD147 is up‐regulated with the increasing stage of ESCC, overexpression of which could promote ESCC cell invasion and lymph node metastasis, and CD147 (Zhang et al., 2018a). Furthermore, overexpression of miR‐145 can target FSCN1 and decrease its expression in ESCC(Kano et al., 2010), which was consistent with the findings confirmed by dual‐luciferase reporter gene assay.The findings of this study also revealed that silencing lncRNA PVT1 up‐regulated miR‐145 and inhibited the viability, migration, invasion capacity, and induced apoptosis of EC cells via inhibition of FSCN1. In a prior study, overexpressed miR‐145 was found to suppress non‐small‐cell lung cancer cell growth, migration, and invasion, partially by suppressing FSCN1 expression (Zhang and Lin, 2015). Sheng et al. indicated that aberrant expression of miR‐145 dampens migration and invasion of colorectal cancer cells (Chang et al., 2017). Likely, overexpression of miR‐133b in ESCC cell lines inhibits viability and accelerated apoptosis (Huang et al., 2018). Interestingly, overexpression of miR‐129 results in a marked suppression on cell viability and invasion capacity of ESCC (Li et al., 2017). Down‐regulation of FSCN1 has been determined to decrease gastric cancer cell viability and metastasis (Guo et al., 2014). lncRNA PVT1 functions as a tumor promoter in cancer development whose knockdown has the capacity to expressively reduce viability, migration, invasion, and enhanced apoptosis of cervical cancer cells (Ping et al., 2018). Restored lncRNA PVT1 promotes cell invasion by accelerating epithelial‐to‐mesenchymal transition in EC (Chai et al., 2018). Moreover, down‐regulation of lncRNA PVT1 could suppress viability and induce apoptosis of renal cancer cells (Wu et al., 2017). Similarly, it was validated that the silencing lncRNA CASC9 can help to suppress migration and invasion of EC cells in vitro (Pan et al., 2016). These results suggested that the down‐regulation of lncRNA PVT1 can induce the overexpression of miR‐145, which inhibits cell viability, migration, and invasion, affecting cell cycle and accelerating apoptosis of EC cells via knockdown of FSCN1.
Conclusions
Consequently, this study demonstrated that silencing of lncRNA PVT1 can promote the expression of miR‐145, and thus, it can function as a tumor suppressor in EC cells through down‐regulating FSCN1 (Fig. 12). The research may provide novel insight into the molecular mechanism of EC.
Figure 12
The molecular mechanism involved in the contribution of lncRNA PVT1 down‐regulation to alleviated EC progression by regulating miR‐145 and FSCN1. lncRNA PVT1 can specifically compete with miR‐145, and silencing of lncRNA PVT1 can up‐regulate the expression of miR‐145 and down‐regulate FSCN1 expression, thus inhibiting invasion, migration, survival, and viability and promoting apoptosis of EC cells.
The molecular mechanism involved in the contribution of lncRNA PVT1 down‐regulation to alleviated EC progression by regulating miR‐145 and FSCN1. lncRNA PVT1 can specifically compete with miR‐145, and silencing of lncRNA PVT1 can up‐regulate the expression of miR‐145 and down‐regulate FSCN1 expression, thus inhibiting invasion, migration, survival, and viability and promoting apoptosis of EC cells.
Conflict of interest
The authors declare no conflict of interest.
Author contributions
SNS, KL, YL, CLY, CYH, and HRW conceived and designed the project; YL, CLY, CYH, and HRW acquired the data; SNS, KL, YL, and CLY analyzed and interpreted the data; SNS and KL wrote the paper. All authors contributed to the revision and approved the final manuscript.Table S1. The clinical characteristics of patients.Click here for additional data file.