Literature DB >> 31366950

SQSTM1/p62 loss reverses the inhibitory effect of sunitinib on autophagy independent of AMPK signaling.

Bolin Hou1,2, Gang Wang3, Quan Gao1,2, Yanjie Wei1,2, Caining Zhang1,2, Yange Wang1,2, Yuqing Huo4, Huaiyi Yang5, Xuejun Jiang6, Zhijun Xi7.   

Abstract

Sunitinib (ST), a multitargeted receptor tyrosine kinase inhibitor, has been demonstrated to be effective for the treatment of renal carcinoma. It has been reported that ST is involved in the mediation of autophagy; however, its regulatory role in the autophagic process remains controversial. Furthermore, the mechanism by which activated AMP-activated protein kinase (AMPK) negatively regulates autophagy remains nearly unexplored. In the present study, we revealed that ST inhibited AMPK activity and regulated autophagy in a cell type- and dose-dependent manner. In a number of cell lines, ST was demonstrated to inhibit H2O2-induced autophagy and the phosphorylation of acetyl-CoA carboxylase (ACC), whereas alone it could block the autophagic flux concurrent with increased expression of p62. An immunoprecipitation assay revealed that LC3 directly interacted with p62, whereas ST increased punctate LC3 staining, which was well colocalized with p62. Taken together, we reveal a previously unnoticed pathway for ST to regulate the autophagic process, and p62, although often utilized as a substrate in autophagy, plays a critical role in regulating the inhibition of ST in both basal and induced autophagy.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31366950      PMCID: PMC6668422          DOI: 10.1038/s41598-019-47597-4

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Macroautophagy (herein referred to as autophagy) is a process involving the bulk degradation of cytosolic components by autophagolysosomes[1]. It occurs in most eukaryotic cells at basal levels and is activated in response to the number of stimuli. It is well recognized that autophagy fulfills two major cellular functions: detoxification via waste removal and provision of protection in response to nutrient stress. Although often used as a substrate of autophagy, p62 was initially found as a signaling mediator residing in the late endosome and lysosome[2]. Accumulating evidence has indicated that p62 is a multifunctional adaptor protein that participates in the regulation of a series cellular functions, such as nutrient sensing, survival/apoptosis modulation, and signaling pathway activation[3,4]. Moreover, it is known to link the cellular degradation pathways, ubiquitin system, and autophagic machinery[5-7]. In vertebrates, p62 regulates the autophagic removal of protein aggregates and damaged organelles, including mitochondria, through its interaction with ubiquitin and the LC3 component of autophagy[8,9]. Although it is recognized to play an essential role in mediating selective autophagy, p62 is required for the unselected autophagic process, and its loss inhibits resveratrol (RSV)–induced autophagy[10]. ST is a multitargeted receptor tyrosine kinase inhibitor, and it inhibits the activity of PDGFRs, c-KIT, FLT-3, and VEGFRs, all of which have been demonstrated to be important for cell proliferation, migration, and angiogenesis[11]. ST can induce both cell viability loss and cell senescence, and it can cause G1-S cell cycle arrest and the DNA damage response in OS-RC-2 cells[12,13]. Recently, ST has been demonstrated to mediate autophagy depending on the cell type. In both cardiac and PC12 cells, ST increases autophagic flux, whereas it induces incomplete autophagy in either renal or bladder cancer cells. In RCC 786-O cells, ST increases the level of phosphorylated EGFR, which may cause resistance to ST treatment in RCC[14]. In endometrial carcinoma, ST decreases either the basal or EGF-activated NFkB transcription[15]. Additionally, ST has been demonstrated to inhibit AMPK and cause myocyte cytotoxicity[16,17]. AMPK, a key energy-surveillance kinase complex, contains three subunits: a catalytic, one scaffolding and a regulatory. Energy stress increased the levels of either ADP or AMP (compared with ATP), and their augment functioned as an index of energy deprivation. AMPK was firstly found to be a kinase that directly inhibited ACC through increasing its phosphorylation; it also functions in multiple ways to influence cellular metabolism, and its activation is upregulated responsive to various stress conditions with an increased ratio of AMP to ATP. Through enhancing Thr172 phosphorylation of the catalytic subunit and inhibiting dephosphorylation of Thr172, AMP binding was found to increase the activity of AMPK. Mammalian target of rapamycin complex 1 (mTORC1) is a multiprotein complex consisting of mTOR, raptor, mLST8, and PRAS40, and AMPK demonstrated to inhibit mTORC1 via activating tuberous sclerosis complex 2 (TSC2) and directly reducing the phosphorylation of raptor[18,19]. Therefore, AMPK has been thought to trigger autophagy through an indirect mechanism by inhibiting mTORC1 activity or directly binding to ULK1, which is a serine/threonine kinase and also known as ATG1[20,21]. However, Shang et al. observed that nutrient starvation simulates the autophagic response mediated by ULK1 dephosphorylation and its dissociation from AMPK[22]. They further suggested that AMPK might have dual roles in the regulation of autophagy depending on the nutrient condition. Indeed, compound C, a pharmacological AMPK inhibitor that efficiently blocks the metabolic actions of AMPK, has been demonstrated to induce the autophagic process in different cancer cell lines[23]. Here, we show that ST treatment alone can either inhibit or induce autophagy depending on the cell type and its concentration. ST was demonstrated to inhibit AMPK activity, upregulated p62 expression and abolished the H2O2-induced autophagic flux. While deprivation of p62 reversed the inhibitory effect of ST on basal autophagy, it no longer blocked the H2O2-activated autophagic flux in p62-depleted cells.

Results

Inhibition of autophagy increases the cleavage of PARP-1 induced by ST

As an approved drug for RCC treatment[24], ST expectedly reduced the cell viability of both 786-O and ACHN in a dose-dependent manner (Fig. S1a). The cytotoxic effect of ST was further confirmed by the observation that the cleavage of PARP-1, which serves as a marker of cells undergoing apoptosis[25], was induced by ST (Fig. S1b). The addition of 3-MA, a widely used inhibitor of early autophagy[26], increased PARP-1 cleavage, while the usage of CQ, which inhibited the fusion between autophagosomes and lysosomes[27], further augmented ST/3-MA-induced caspase-dependent apoptosis (Fig. S1b). Moreover, deprivation of either LC3 or Beclin 1 increased the cleavage of PARP-1 (Fig. S1c–e), suggesting that autophagy is involved in the ST-induced apoptotic process. Two different LC3 or Beclin 1 small interfering RNAs (siRNAs) were used to independently knock down the expression of either LC3 or Beclin 1 (Fig. S3a,b). In addition, p62, a substrate of autophagic degradation with increased expression during autophagy inhibition[28], appeared to be upregulated in both LC3- and Beclin 1-depleted cells (Fig. S1c–e).

A high dose of ST inhibits the autophagic flux and increases p62 expression

Recent studies have revealed contradictory results about the involvement of ST in autophagy[29]; thus, we subsequently examined the autophagic flux upon ST challenge in both 786-O and ACHN cells. Through electron microscopy, we observed an obvious accrual of membrane vacuoles in either ST-treated ACHN or 786-O cells, and cytosolic components were sequestered in some of those vacuoles in comparison to the control (Fig. 1a–c). The immunoblotting analysis revealed that ST treatment increased the ratio of LC3-II to actin relative to control cells in a concentration-dependent manner (Fig. 1d,e). Unexpectedly, we found that a high dose of ST (8 μM/L) appeared to completely inhibit the autophagic flux since CQ failed to further accumulate LC3-II in both cell lines (Fig. 1d,e), whereas treatment with 4 μM/L ST abolished the autophagic flux only in 786-O cells (Fig. 1e). In contrast to ACHN cells, in which it either increased or decreased the level of p62 (Fig. 1d), ST solely augmented the expression of p62 in 786-O cells (Fig. 1e). Additionally, a high dose of ST (8 μM/L) also blocked autophagy in HeLa cells (Fig. 1f). Similar to ACHN cells, ST could increase or decrease the level of p62 in HeLa cells. However, ST at a dose of 8 μM/L was found to increase the expression of p62 in all three cell lines (Fig. 1d–f). The aforementioned results indicated that ST regulated autophagy in a dose- and cell type-dependent manner, and it could inhibit the autophagic flux under certain conditions.
Figure 1

A high dose of ST inhibits the autophagic flux and increases p62 expression. (a–c) Electron microscopy was performed in 786-O (a) and ACHN (b) cells following ST treatment (4 μM/L) for 4 h. The morphometric analysis of the area fraction between autophagosomes and cytoplasm was calculated using Photoshop software (c). The area ratio data were non-normally distributed and are presented as the mean of at least 10 cells counted for each group. ACHN (d), 786-O (e) and HeLa (f) cells were treated with ST (0–8 μM/L) for 4 h in the presence or absence of CQ (ACHN: 10 μM/L; HeLa: 15 μM/L; 786-O: 20 μM/L). The cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Densitometry was performed for quantification, and the adjusted ratio of LC3-II and p62 to actin is presented under the blots. The results were similar among experiments repeated at least twice. (Control: Ctrl; Beclin1: Bec1; Actin: A).

A high dose of ST inhibits the autophagic flux and increases p62 expression. (a–c) Electron microscopy was performed in 786-O (a) and ACHN (b) cells following ST treatment (4 μM/L) for 4 h. The morphometric analysis of the area fraction between autophagosomes and cytoplasm was calculated using Photoshop software (c). The area ratio data were non-normally distributed and are presented as the mean of at least 10 cells counted for each group. ACHN (d), 786-O (e) and HeLa (f) cells were treated with ST (0–8 μM/L) for 4 h in the presence or absence of CQ (ACHN: 10 μM/L; HeLa: 15 μM/L; 786-O: 20 μM/L). The cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Densitometry was performed for quantification, and the adjusted ratio of LC3-II and p62 to actin is presented under the blots. The results were similar among experiments repeated at least twice. (Control: Ctrl; Beclin1: Bec1; Actin: A).

ST inhibits H2O2-induced autophagy concurrent with the downregulation of AMPK activity

Former studies have been revealed that ST inhibits the phosphorylation of AMPK and causes myocyte cytotoxicity[16,17]. Consistently, we observed that ST markedly decreased AMPK phosphorylation in all three tested cell lines (Figs 2a, S2a). In contrast, H2O2 markedly increased the phosphorylation of ACC, the AMPK substrate and indicator of AMPK activity[30] (Figs 2b, S2b), and ST abolished the H2O2-induced phosphorylation of ACC (Figs 2b,e, S2b,e). To investigate the inhibitory mechanism of ST on autophagy, we determined the autophagic flux following treatment of the cells with H2O2 in the presence or absence of ST. Although either H2O2 or ST induced autophagy, their combination failed to further stimulate the autophagic process in ACHN cells (Fig. 2c). In 786-O cells, ST abolished the H2O2-activated autophagic flux as CQ was unable to accumulate LC3-II in H2O2/ST-treated cells (Fig. 2d). In HeLa cells, ST also completely inhibited H2O2-induced autophagy (Fig. S2c). The 5-aminoimidazole-4-carboxamide1-β-D-ribofuranoside (AICAR), an agonist of AMP-activated protein kinase (AMPK), enhanced H2O2-induced autophagy in 786-O cells (Fig. 2d). Notably, ST abolished H2O2-activated phosphorylation of ACC (Figs 2e,f, S2d), whereas AICAR increased the activity of AMPK (Fig. 2f). Therefore, ST was able to mediate the H2O2-activated autophagic process through AMPK/ACC signaling. Given that ST alone can activate autophagy, ST is likely to play a dual role in the regulation of autophagy in a dose-, cell type- and context-dependent manner.
Figure 2

ST inhibits the phosphorylation of AMPK and ACC and blocks H2O2-induced autophagy concurrent with the downregulation of AMPK activity. 786-O and ACHN (a,b) cells were treated with ST (0–8 μM/L) or H2O2 (0.1, 1 mM/L; 2 h) for up to 4 h, and the cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. tERK1/2 was used as a loading control. The results were similar among experiments repeated at least three times. ACHN (c,e) and 786-O (d,f) cells were treated with H2O2 (ACHN: 0.5 mM/L; 786-O: 0.1 mM/L) with or without ST (8 μM/L), or AICAR (0.5 mM/L) in the presence or absence of CQ (ACHN: 10 μM/L; 786-O: 20 μM/L) for 2 h. Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Actin was used as a loading control. The results were similar among experiments repeated at least twice. (Actin: A).

ST inhibits the phosphorylation of AMPK and ACC and blocks H2O2-induced autophagy concurrent with the downregulation of AMPK activity. 786-O and ACHN (a,b) cells were treated with ST (0–8 μM/L) or H2O2 (0.1, 1 mM/L; 2 h) for up to 4 h, and the cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. tERK1/2 was used as a loading control. The results were similar among experiments repeated at least three times. ACHN (c,e) and 786-O (d,f) cells were treated with H2O2 (ACHN: 0.5 mM/L; 786-O: 0.1 mM/L) with or without ST (8 μM/L), or AICAR (0.5 mM/L) in the presence or absence of CQ (ACHN: 10 μM/L; 786-O: 20 μM/L) for 2 h. Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Actin was used as a loading control. The results were similar among experiments repeated at least twice. (Actin: A).

ST increases the expression of p62 and enhances its colocalization with LC3

Generally, p62 is considered to be a substrate in autophagic degradation, and the activation of autophagy usually causes a decrease in the p62 level. In comparison to ACHN cells, ST consistently increased the expression of p62 in 786-O cells (Fig. 3a,b). Real-time quantitative PCR (qPCR) results demonstrated that ST increased the transcriptional expression of p62 at both the 2 and 4 h time points (Fig. 3c and Table 1). The immunostaining assay revealed that ST increased punctate LC3 staining, which colocalized well with p62, and CQ addition further increased punctate LC3 staining in ST-treated cells and enlarged the dot staining of p62 (Fig. 3d). Consistent with a former report[31], we observed a direct interaction between LC3 and p62 (Fig. 3e), whereas IgG, which was used as a negative control, failed to pull-down p62 (Fig. 3e). Moreover, the immunoprecipitation results displayed that either ST or H2O2 regulated the interaction between LC3 and p62 (Fig. 3f).
Figure 3

ST increases the expression of p62 in 786-O cells. 786-O (a) and ACHN (b) cells were treated with ST (0–8 μM/L) for up to 24 h. Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Actin was used as a loading control. (c) qPCR was performed to detect the mRNA expression of p62 following ST treatment for up to 24 h in 786-O cells. (d) 786-O cells were split onto coverslips, cultured overnight, and treated with ST (4 μM/L) or together with CQ (15 μM/L). They were then fixed with 4% paraformaldehyde, and images were obtained by fluorescence microscopy after labeling with anti-LC3 and p62 antibodies and staining with DAPI. (e) IgG2b (rabbit) was used as a negative control. ACHN and 786-O cells were lysed and precipitated using the antibody against LC3. (f) Following treatment with ST (8 μM/L: 4 h) or H2O2 (0.1, 1 mM/L: 2 h) for up to 4 h, 786-O cells were lysed and precipitated using the antibody against LC3. The immunoprecipitates were resolved by electrophoresis and probed by immunoblotting (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated at least twice. (L-Exp: long exposure; HC: heavy chain; LC: light chain; Actin: A; Input: whole cell lysate).

Table 1

Primer sequences. p62 and β-actin were defined as forward primer and reverse primer, respectively.

GenePrimerNucleotide
p62Forward (5′ → 3′)CATCGGAGGATCCGAGTGTG
Reverse (5′ → 3′)TTCTTTTCCCTCCGTGCTCC
β-actinForward (5′ → 3′)GCCTGACGGCCAGGTCATCAC
Reverse (5′ → 3′)CGGATGTCCACGTCACACTTC
ST increases the expression of p62 in 786-O cells. 786-O (a) and ACHN (b) cells were treated with ST (0–8 μM/L) for up to 24 h. Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. Actin was used as a loading control. (c) qPCR was performed to detect the mRNA expression of p62 following ST treatment for up to 24 h in 786-O cells. (d) 786-O cells were split onto coverslips, cultured overnight, and treated with ST (4 μM/L) or together with CQ (15 μM/L). They were then fixed with 4% paraformaldehyde, and images were obtained by fluorescence microscopy after labeling with anti-LC3 and p62 antibodies and staining with DAPI. (e) IgG2b (rabbit) was used as a negative control. ACHN and 786-O cells were lysed and precipitated using the antibody against LC3. (f) Following treatment with ST (8 μM/L: 4 h) or H2O2 (0.1, 1 mM/L: 2 h) for up to 4 h, 786-O cells were lysed and precipitated using the antibody against LC3. The immunoprecipitates were resolved by electrophoresis and probed by immunoblotting (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated at least twice. (L-Exp: long exposure; HC: heavy chain; LC: light chain; Actin: A; Input: whole cell lysate). Primer sequences. p62 and β-actin were defined as forward primer and reverse primer, respectively.

Deprivation of p62 reverses the inhibitory effect of ST on autophagy

Since the knockdown of p62 was shown to inhibit resveratrol (RSV)–induced autophagy[10] and ST increased the levels of p62, we speculated that p62 might be required for ST-activated autophagy. Unexpectedly, knockdown of p62 did not inhibit the ST (2 μM/L)-induced autophagic flux in 786-O cells (Fig. 4a). In contrast, its loss reversed the inhibitory effect of ST (8 μM/L) on autophagy (Fig. 4a). Similar results were also obtained in p62-depleted ACHN and HeLa cells (Fig. 4b,c).
Figure 4

Deprivation of p62 reverses the inhibition of ST-induced autophagy. 786-O (a), ACHN (b) and HeLa (c) cells were transfected with the p62 siRNAs (sc-29679) for 48 h. HEK293T cells with either wild type (WT) or mutated p62 plasmid (d). The lysates were analyzed by immunoblotting (8–13% PAGE) following ST (8 μM/L or as indicated) treatment for 4 h in the presence or absence of CQ (ACHN: 10 μM/L; HeLa: 15 μM/L; 786-O: 20 μM/L; HEK293T 20 μM/L). Actin was used as the loading control. The results were similar among experiments repeated three times. (L-Exp: long exposure; Actin: A).

Deprivation of p62 reverses the inhibition of ST-induced autophagy. 786-O (a), ACHN (b) and HeLa (c) cells were transfected with the p62 siRNAs (sc-29679) for 48 h. HEK293T cells with either wild type (WT) or mutated p62 plasmid (d). The lysates were analyzed by immunoblotting (8–13% PAGE) following ST (8 μM/L or as indicated) treatment for 4 h in the presence or absence of CQ (ACHN: 10 μM/L; HeLa: 15 μM/L; 786-O: 20 μM/L; HEK293T 20 μM/L). Actin was used as the loading control. The results were similar among experiments repeated three times. (L-Exp: long exposure; Actin: A). To confirm the inhibitory effect of p62 on ST-induced autophagy, we transfected HEK293T cells with either wild type (WT) or mutated p62 plasmid (Fig. 4d). As expected, overexpression of WT p62 completely inhibited the ST-induced autophagic flux, as CQ failed to accumulate LC3-II in these cells (Fig. 4d), whereas the mutated p62, which lacks the ubiquitin (UB) binding domain, displayed less inhibition of ST-activated autophagy compared with WT p62 (Fig. 4d).

ST fails to abolish the H2O2-autophagic flux in p62-depleted cells

As the depletion of p62 could reverse the inhibitory effect of ST on autophagy, we next determined whether p62 also played a regulatory role in the inhibitory effect of ST on H2O2-induced autophagy. Compared with the Mock-control, H2O2-induced autophagic flux was greatly inhibited in p62-depleted 786-O cells (Fig. 5a), suggesting the likely requirement for p62 in H2O2-induced autophagy under these circumstances. In contrast to the Mock-control, ST failed to completely inhibit the H2O2-activated autophagic flux in p62-depleted 786-O cells (Fig. 5a). Similar results were also obtained in HeLa cells (Fig. 5b). Notably, H2O2 combined with ST induced normal autophagy in p62-deprived HeLa cells compared with the Mock-control ones (Fig. 5b). Using a different siRNA, we obtained similar results in 786-O cells (Fig. S3c,d). Moreover, we observed that ST was able to abolish H2O2-increased phosphorylation of ACC in either Mock-control or p62-depleted cells (Fig. 5c,d). In p62-depleted HeLa cells, H2O2 at a dose of 0.5 mM/L failed to induce autophagy concurrent with an increase in the phosphorylation of ACC (Fig. 5e,f), suggesting that p62 could mediate H2O2-induced autophagy in a dose-dependent manner (Fig. 5b,e). Together with the findings shown in Fig. 5c,d, these results indicated that p62 could function downstream of AMPK signaling to regulate the autophagic process. While p62 silencing alone increased H2O2-induced phosphorylation of both extracellular signal-regulated kinase (ERK)1/2 and AMPK, its loss mediated basal ACC phosphorylation in a cell type-dependent manner (Fig. 5d,e). In 786-O cells, the deprivation of p62 decreased basal phosphorylation of ACC (Fig. 5d), whereas p62 loss increased the phosphorylated ACC in HeLa cells (Fig. 5e). Uncoupling between the phosphorylation of AMPK and ACC was clearly present. For example, while ST blocked the H2O2-induced phosphorylation of ACC in both cell lines (Fig. 5d,e), its presence increased H2O2-induced AMPK phosphorylation in HeLa cells (Fig. 5e). Given that p62 loss increased the phosphorylation of ERK1/2 (Fig. 5d,e), we speculated that mitogen-activated protein kinases (MAPK) signaling might play a role in either ST- or H2O2-induced autophagy.
Figure 5

Depletion of p62 inhibits H2O2-induced autophagy and reverses the inhibitory effect of ST on H2O2-dependent autophagic flux. 786-O (a,c) and HeLa (b,d–f) cells were transfected with p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following treatment with H2O2 (A, B, C and D: 0.1 mM/L; C and F: 0.5 mM/L) with or without ST (8 μM/L) for 2 h in the presence or absence of CQ (786-O: 20 μM/L; HeLa: 15 μM/L). The results were similar among experiments repeated twice. (L-Exp: long exposure; Actin: A).

Depletion of p62 inhibits H2O2-induced autophagy and reverses the inhibitory effect of ST on H2O2-dependent autophagic flux. 786-O (a,c) and HeLa (b,d–f) cells were transfected with p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following treatment with H2O2 (A, B, C and D: 0.1 mM/L; C and F: 0.5 mM/L) with or without ST (8 μM/L) for 2 h in the presence or absence of CQ (786-O: 20 μM/L; HeLa: 15 μM/L). The results were similar among experiments repeated twice. (L-Exp: long exposure; Actin: A). To further explore the regulatory role of p62 in H2O2/ST-mediated autophagy, we prolonged the treatment of 786-O cells with H2O2 up to 4 h. As shown in Fig. 6a, ST failed to inhibit H2O2-activated autophagy in the p62-depleted cells, whereas it still abolished the H2O2-induced autophagic flux in Mock-control ones (Fig. 6a). In contrast to the 2 h time point, loss of p62 alone increased the phosphorylation of ACC and decreased the phosphorylation of ERK1/2 at the 4 h time point (Fig. 6b), suggesting that p62 regulated both activities of AMPK and ERK1/2 in a time-dependent manner.
Figure 6

Detailed evaluation of the regulatory role of p62 in H2O2/ST-mediated autophagy. 786-O (a,b) cells were transfected with p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following treatment with H2O2 (0.1 mM/L) with or without ST (8 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). The results were similar among experiments repeated twice.

Detailed evaluation of the regulatory role of p62 in H2O2/ST-mediated autophagy. 786-O (a,b) cells were transfected with p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following treatment with H2O2 (0.1 mM/L) with or without ST (8 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). The results were similar among experiments repeated twice.

Inhibition of MEK/ERK signaling abolishes the ST-induced autophagic flux

Consistent with the aforementioned results (Fig. 4a), knockdown of p62 reversed the inhibitory effect of ST (8 μM/L) on autophagy in 786-O cells (Fig. 7a). A former study has shown that p62 loss leads to enhanced ERK activity[32], and here we also found that p62 depletion increased both basal and ST-induced phosphorylation of ERK1/2 (Fig. 7b). Therefore, we speculated that p62 loss reversed the inhibitory effect of ST on autophagy by upregulating ERK1/2 signaling. To test this hypothesis, we employed U0126, a specific inhibitor of mitogen-activated protein kinase(MEK)/ERK signaling[33], in the following experiments. While either ST or U0126 activated the autophagic process, their combination failed to induce autophagy because CQ was unable to accumulate LC3-II in ST/U0126-treated cells (Fig. 7c). As expected, U0126 inhibited both basal and ST-induced phosphorylation of ERK1/2 (Fig. 7d). Furthermore, U0126 suppressed the H2O2-induced ERK1/2 phosphorylation and attenuated the autophagic flux induced by H2O2 (Fig. 7e,f). Although U0126 attenuated the phosphorylation of ACC (Fig. 7d), it enhanced H2O2-induced ACC phosphorylation (Fig. 7f), suggesting the presence of a crosstalk between AMPK and ERK1/2.
Figure 7

p62 deprivation reduces AMPK activity, and MEK/ERK inhibition suppresses the ST-induced autophagic flux. (a,b) 786-O cells were transfected with the p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following ST treatment (8 μM/L) for 4 h in the presence or absence of CQ (20 μM/L). (c–f) 786-O cells were treated with ST (4 μM/L) or H2O2 (0.1 mM/L, 2 h) with or without U0126 (10 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated twice. (Actin: A)

p62 deprivation reduces AMPK activity, and MEK/ERK inhibition suppresses the ST-induced autophagic flux. (a,b) 786-O cells were transfected with the p62 siRNAs (sc-29679) for 48 h. The lysates were analyzed by immunoblotting (8–13% PAGE) following ST treatment (8 μM/L) for 4 h in the presence or absence of CQ (20 μM/L). (c–f) 786-O cells were treated with ST (4 μM/L) or H2O2 (0.1 mM/L, 2 h) with or without U0126 (10 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). Cells were lysed and subjected to immunoblotting (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated twice. (Actin: A)

ST mediates the interaction between p62 and ERK1/2

Consistent with a former report[32], we found that p62 could mediate the phosphorylation of ERK1/2, and thus we next examined whether MEK/ERK could regulate the expression of p62. Not only U0126 alone increased the levels of p62 but it further increased the levels of p62 in ST-treated cells (Fig. 8a). Although CQ alone increased the levels of p62 (Fig. 8a), it failed to further enhance the expression of p62 in ST- but not U0126-treated cells. CQ clearly failed to accumulate p62 in ST-challenged cells in relation to ERK1/2 signaling, as U0126 prevented the decrease in p62 in ST/CQ-treated cells (Fig. 8a,b). While CQ decreased the expression of p62 in ST-treated cells concurrent with a marked increase in ERK1/2 phosphorylation, U0126 inhibited the ST/CQ-induced phosphorylation of ERK1/2 and increased p62 levels in those cells (Fig. 8a,b). Consequently, these results may indicate a mutual regulatory relationship between p62 and phosphorylated ERK signaling, which may be related to the direct interaction between p62 and ERK1/2[34].
Figure 8

MEK/ERK could regulate the expression of p62. 786-O cells (a–c) and HeLa cells (d) were treated with ST (4 μM/L) with or without U0126 (10 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). Cells were lysed and subjected to immunoblotting (8–13% PAGE) and co-immunoprecipitated (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated twice. (L-Exp: long exposure; HC: heavy chain; Actin: A)

MEK/ERK could regulate the expression of p62. 786-O cells (a–c) and HeLa cells (d) were treated with ST (4 μM/L) with or without U0126 (10 μM/L) up to 4 h in the presence or absence of CQ (20 μM/L). Cells were lysed and subjected to immunoblotting (8–13% PAGE) and co-immunoprecipitated (8–13% PAGE) with the indicated antibodies. The results were similar among experiments repeated twice. (L-Exp: long exposure; HC: heavy chain; Actin: A) To investigate whether p62 could interact with ERK1/2, we next carried out an immunoprecipitation assay using p62 antibody. Although we failed to pull-down phosphorylated-ERK1/2 in both HeLa and 786-O cells (data not shown), p62 interacted with total ERK1/2 (tERK1/2) in either 786-O or HeLa cells (Fig. 8c,d). Interestingly, while ST decreased the interaction between p62 and tERK1/2 in 786-O cells (Fig. 8c), its treatment increased the binding between these proteins in HeLa cells (Fig. 8d).

Discussion

A new finding of the present study is that ST can either inhibit or induce autophagy even in the same cell line, depending on the expression of p62. Although ST was shown to suppress the induced phosphorylation of ACC, it failed to block H2O2-induced autophagic flux in p62-depleted cells. Therefore, p62 likely played a regulatory role in the inhibitory effect of activated AMPK on autophagy. Moreover, we revealed that ST regulated the interaction between p62 and ERK1/2 in a cell type-dependent manner. It is well established that AMPK triggers autophagy through an indirect mechanism by inhibiting mTORC1 signaling or through direct binding to ULK1[20,21]. However, a recent study has shown that compound C, a commonly used inhibitor of AMPK, induces autophagy by blocking the Akt/mTOR pathway in a number of cancer cell lines. AMPK has also been reported to inhibit autophagy in isolated rat hepatocytes. Shang and Wang et al. revealed that nutrient starvation induces an acute autophagic process through ULK1 dephosphorylation and its dissociation from AMPK. They considered AMPK to have dual roles in the regulation of autophagy. Consistently, we found that ST (low dose) was able to induce autophagy concurrent with an inhibition of AMPK/ACC signaling, whereas H2O2 increased AMPK activity and triggered the autophagic process. Moreover, ST inhibited both H2O2-induced AMPK activity and autophagy. The aforementioned results confirmed that AMPK could have dual roles in regulating the autophagic process. Unexpectedly, we found that p62 loss reversed the inhibitory effect of ST on basal and H2O2-induced autophagy. Therefore, we reasoned that p62 was required for the activated AMPK to inhibit autophagy under certain conditions. Despite its common use as a substrate in autophagy, growing evidence has indicated that p62 plays more active roles in the regulation of autophagy[35]. It has been demonstrated that p62 is required for RSV-induced autophagy, and RSV increases the expression of p62 mRNA and protein by mediating the activation of JNK (c-Jun N-terminal kinase)[10]. In addition, it has been reported that, to prevent oxidative liver damage, p62-dependent autophagy is required during the activation of Nrf2 (nuclear factor erythroid 2) by sestrins[36]. Consistently, we found that p62 was needed for H2O2 to stimulate the autophagic process, especially in 786-O cells. In p62-depleted HeLa cells, H2O2 at a dose of 0.5 mM/L failed to stimulate autophagy. Thus, p62 was able to regulate H2O2-induced autophagy relative to the stimulus dose. In contrast, p62 was unlikely to be required for ST-dependent autophagy, in which it actually appeared to play a negative regulatory role. Consequently, p62 could regulate autophagy in a stimulus- and cell-type dependent manner. Consistent with former reports[37,38], we found that p62 was able to mediate the phosphorylation of ERK1/2, which is a key member of the MAPK family and well established for its regulatory role in the autophagic process[39-41]. In the human colon cancer cell line HT29, ERK1/2 activation has been shown to promote macroautophagy and induce autophagic vacuolation[42], and ERK activation is also needed for the starvation-induced autophagic process[43]. Lindane, a widely used environmental carcinogen, induces sustained phosphorylation of ERK and enhances the persistent formation of large autolysosomal vesicles, which can be inhibited by pretreatment with MEK1/2 inhibitors[44]. However, other studies have shown that oncogenic activation of Ras, the upstream activator of ERK, reduces autophagy in transformed cell lines[45,46]. Our data showed that U0126 alone failed to inhibit the autophagic flux, whereas its treatment blocked or attenuated autophagy induced by either ST or H2O2. Thus, we considered MEK/ERK to potentially have differential regulatory roles in basal and induced autophagic processes. In fact, we observed that H2O2 treatment alone could induce autophagy concurrent with a downregulation of MEK/ERK signaling in HeLa cells, whereas ST blocked the H2O2-induced autophagic flux concomitantly with an increase in the phosphorylation of ERK1/2. Therefore, we speculated that a coordination might exist between AMPK and MAPK in the regulation of autophagy. This phenomenon is often found in various signaling pathways. For example, it is well known that Ras-ERK and PI3K-mTOR signaling can be either interplayed or compensated[47]. While AMPK enhances autophagy via directly phosphorylating ULK1[48], however, a recent study has revealed that, through a negative feedback loop, the latter demonstrated to influence AMPK phosphorylation[49]. Additionally, one study showed that AMPK was able to either inhibit or enhance the PI3K signaling[50]. The data presented here clearly revealed that p62 could regulate the function of AMPK relating to the cell type, and it appeared to regulate ERK1/2 signaling in a time-dependent manner, implying that p62 could function either downstream or upstream of ERK signaling in a context-dependent manner. While ST together with CQ markedly increased the level of phosphorylated ERK1/2, their combination demonstrated to inhibit the expression of p62, whereas U0126 suppressed ERK1/2 phosphorylation and prevented p62 from loss in ST/CQ-treated cells. In contrast to former reports[34], we failed to observe p62 pulled down with phosphorylated ERK; instead, p62 interacted almost equally with both ERK1 and ERK2 in 786-O cells. While ST increased the interaction between p62 and ERK1/2 in HeLa cells, it decreased the binding between these proteins in 786-O cells. Thus, the relationship between ERK1/2 and p62 may be much more complicated than previously understood.

Conclusions

In summary, we show that p62 is responsible for the inhibition of ST in basal and H2O2-induced autophagy and reveal a previously unknown link between the activation of AMPK and the inhibition of autophagy. Future work in this direction will enable us to better understand the regulatory mechanism of autophagy, illuminate the molecular mechanism of ST resistance in cancer treatment and provide a resolution to dealing with the devastating effects of anti-angiogenesis resistance.

Methods

Chemicals and antibodies

Sunitinib (ST; S126061) was purchased from Aladdin (Seattle, WA, USA). 3-methyladenine (3-MA; M9281), chloroquine diphosphate salt (CQ; C6628), U0126 monoethanolate (u120), AICAR (A9978) and polyclonal antibodies against LC3 (L7543) were acquired from Sigma-Aldrich (St. Louis, MO, USA). H2O2 (E882) was purchased from Amresco (WA, USA). The antibodies against PARP- (9542), Phospho-AMPKα (Thr172; 2535), AMPKα (2532), Phospho-p44/42MAPK (ERK1/2; Thr202/Tyr204; 9106), Phospho-Acetyl-CoA Carboxylase (Ser79; 3661), p44/42 MAPK (total-ERK1/2; 9102) were obtained from Cell Signaling Technology (Boston, MA, USA). The antibody against LC3 (M152-3) for immunoprecipitation was purchased from Medical & Biological Laboratories (Naka-ku, Nagoya, Japan). The antibody against p62 (18420-1-AP) was bought from Proteintech (Wuhan, Hubei, China). The antibody against actin (TA-09) was acquired from ZhongShanJinQiao Biocompany (Beijing, China). MTS reagent powder (G1111) was obtained from Promega Corporation (Madision, WI, USA). Alexa Fluor 594 goat anti-rabbit IgG (H + L) (R37117) and Alexa Fluor 488 goat anti-mouse IgG (H + L) (A-11001) were purchased from Molecular Probes (Eugene, OR, USA).

siRNAs

The siRNA specific for human MAP LC3α (sc-106197), SQSTM1/p62 (sc-29679), and BECN1 (sc-29797) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), along with the control siRNA (sc-37007). The siRNA specific for human MAP1LC3B (81631), SQSTM1/p62 (8878), and BECN1 (8678) were purchased from Dharmacon Biotechnology (Lafayette, CO, USA), along with the control siRNA (D-001136-01).

Cell culture and immunoblotting analysis

786-O, ACHN, and HeLa cells were grown in DMEM media containing 10% fetal bovine serum (GIBCO, Grand Island, NY, USA) with 1% antibiotics. Cells were cultured overnight to grow about 70–80% confluency before treated with compounds. For siRNA interference, about 30% confluence cells in the media without antibiotics were transfected using DharmaFECT (Dharmacon, T2001) according to the manufacturer’s instructions. After transfection for 48 h, Cells were split and cultured overnight before treatments. Whole cell lysate was prepared with lysis using Triton X-100/glycerol buffer, containing 50 mM Tris-HCl (pH 7.4), 4 mM EDTA, 2 mM EGTA, and 1 mM dithiothreitol, supplemented with 1% Triton X-100, 1% SDS, and protease inhibitors, and then separated on a SDS-PAGE gel and transferred to PVDF membrane. Immunoblotting was performed using appropriate primary antibodies and horseradish peroxidase-conjugated suitable secondary antibodies, followed by detection with enhanced chemiluminescence (Pierce Chemical Rockford, IL, USA)[51-53].

Immunoprecipitation

Whole cell lysate was prepared with lysis using Triton X-100/glycerol buffer as mentioned above. LC3 or p62 was immunoprecipitated using the corresponding antibody at 4 °C for 3 h, and then incubated with Protein G-Sepharose (Vigorous Biotechnology Beijing, China) for 1 h. Immunoprecipitates and cell lysates were electrophoresed on SDS-PAGE and subjected to immunoblotting analysis[53].

Cell viability assay (MTS)

Cells were cultured in 96-well plates (7,500 cells per well) with 100 µL complete culture media. After overnight culturing, cells were replaced with Phenol red free complete medium which was added with either drug-free or ST or other chemicals. Cells were cultured for indicated period and the cell viability was detected by CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay (Promega)[51,52].

Electron microscopy

Wash the samples three times with PBS, trypsinize, and then centrifuge to collect them. Fix the cell pellets with 4% paraformaldehyde at 4 °C overnight, post-fix them with 1% OsO4 in cacodylate buffer at RT for 1 h, and then dehydrate stepwise with ethanol. Rinse the dehydrated pellets with propylene oxide at RT for 30 min and embed them in Spurr resin for sectioning. Finally, use a transmission electron microscope (JEM1230 Akishima, Tokyo, Japan) to observe the images of the thin sections[51,53].

RNA extraction and qPCR analysis

The total cellular RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA; 15596-018) according to the manufacturer’s protocol, and 1 μg of RNA was reversely transcribed at 42 °C for 60 min in 20 μL PrimeScriptTM RT reagent Kit (TaKaRa, Dalian, Liaoning, China; DRR037A). Reactions were stopped by heat inactivation at 85 °C for 5 s[51-53]. Primer sequences used for amplification were as follows (Table 1): qPCR (CFX96TM; Bio-Rad) was initiated with a 10 min denaturation at 95 °C in a final volume of 20 μL. The cycle profile was 95 °C (15 s), 60 °C (45 s) and 72 °C (1 min.) for up to 40 cycles. The data were calculated based on the internal control of β-actin.

Fluorescence microscopy

Cells were plated on glass cover slips and the indicated treatments were performed. Cells were washed with Ca2+- and Mg2+-free PBS (CMF-PBS), fixed with freshly prepared 4% paraformaldehyde at 4 °C for 30 min and permeabilized incubation with CMF-PBS containing 0.1% TritoX-100 and 0.5% BSA at RT for 5 min. Cells were then washed three times with CMF-PBS, blocked in CMF-PBS containing 3% BSA for 1 h, and incubated with the indicated antibodies in the presence of 0.1% TritoX-100 and 0.5% BSA. After washing three times, cells were then stained with Alex Fluor 488 or 594 secondary antibodies for 1 h. Cells were then immersed in VECTASHIELD with DAPI (H1200) to visualize the nuclei after washing three times. Images were acquired via Fluorescence microscopy (Zeiss Heidenheim, Germany)[53].

Statistical analysis

The images were analyzed to verify the linear range of chemiluminescence signals and quantifications were carried out using densitometry. The normally distributed data are shown as mean ± SD and analyzed using one-way analysis of variance and the Student-Newman-Keuls post-hoc test. Data are shown as Mean ± SD in Graphs. A P-value < 0.05 was considered to have significant differences. Supplemental Information
  53 in total

1.  Mature-onset obesity and insulin resistance in mice deficient in the signaling adapter p62.

Authors:  Angelina Rodriguez; Angeles Durán; Mohammed Selloum; Marie-France Champy; Francisco J Diez-Guerra; Juana María Flores; Manuel Serrano; Johan Auwerx; María T Diaz-Meco; Jorge Moscat
Journal:  Cell Metab       Date:  2006-03       Impact factor: 27.287

2.  Blockade of NFκB activity by Sunitinib increases cell death in Bortezomib-treated endometrial carcinoma cells.

Authors:  Anabel Sorolla; Andrée Yeramian; Joan Valls; Xavier Dolcet; Laura Bergadà; Antoni Llombart-Cussac; Rosa Maria Martí; Xavier Matias-Guiu
Journal:  Mol Oncol       Date:  2012-07-07       Impact factor: 6.603

Review 3.  p62/SQSTM1 functions as a signaling hub and an autophagy adaptor.

Authors:  Yoshinori Katsuragi; Yoshinobu Ichimura; Masaaki Komatsu
Journal:  FEBS J       Date:  2015-10-16       Impact factor: 5.542

4.  AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1.

Authors:  Joungmok Kim; Mondira Kundu; Benoit Viollet; Kun-Liang Guan
Journal:  Nat Cell Biol       Date:  2011-01-23       Impact factor: 28.824

Review 5.  The Ras-ERK and PI3K-mTOR pathways: cross-talk and compensation.

Authors:  Michelle C Mendoza; E Emrah Er; John Blenis
Journal:  Trends Biochem Sci       Date:  2011-04-30       Impact factor: 13.807

6.  K63 polyubiquitination and activation of mTOR by the p62-TRAF6 complex in nutrient-activated cells.

Authors:  Juan F Linares; Angeles Duran; Tomoko Yajima; Manolis Pasparakis; Jorge Moscat; Maria T Diaz-Meco
Journal:  Mol Cell       Date:  2013-08-01       Impact factor: 17.970

7.  Sestrins activate Nrf2 by promoting p62-dependent autophagic degradation of Keap1 and prevent oxidative liver damage.

Authors:  Soo Han Bae; Su Haeng Sung; Sue Young Oh; Jung Mi Lim; Se Kyoung Lee; Young Nyun Park; Hye Eun Lee; Dongmin Kang; Sue Goo Rhee
Journal:  Cell Metab       Date:  2012-12-27       Impact factor: 27.287

8.  The yin yang of sunitinib: One drug, two doses, and multiple outcomes.

Authors:  Mohamed Elgendy
Journal:  Mol Cell Oncol       Date:  2017-02-23

9.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

10.  Curcumin Inhibits Apoptosis of Chondrocytes through Activation ERK1/2 Signaling Pathways Induced Autophagy.

Authors:  Xiaodong Li; Kai Feng; Jiang Li; Degang Yu; Qiming Fan; Tingting Tang; Xiao Yao; Xiaoqing Wang
Journal:  Nutrients       Date:  2017-04-21       Impact factor: 5.717

View more
  5 in total

1.  Fetuin-A exerts a protective effect against experimentally induced intestinal ischemia/reperfusion by suppressing autophagic cell death.

Authors:  Nanees F El-Malkey; Amira E Alsemeh; Wesam Mr Ashour; Nancy H Hassan; Husam M Edrees
Journal:  Exp Biol Med (Maywood)       Date:  2021-03-02

2.  The central regulator p62 between ubiquitin proteasome system and autophagy and its role in the mitophagy and Parkinson's disease.

Authors:  Woo Hyun Shin; Joon Hyung Park; Kwang Chul Chung
Journal:  BMB Rep       Date:  2020-01       Impact factor: 4.778

3.  Inhibition of Ref(2)P, the Drosophila homologue of the p62/SQSTM1 gene, increases lifespan and leads to a decline in motor function.

Authors:  Emily P Hurley; Brian E Staveley
Journal:  BMC Res Notes       Date:  2021-02-08

4.  Grb2 interacts with necrosome components and is involved in rasfonin-induced necroptosis.

Authors:  Bolin Hou; Haiwen Huang; Yueqian Li; Jingnan Liang; Zhijun Xi; Xuejun Jiang; Ling Liu; Erwei Li
Journal:  Cell Death Discov       Date:  2022-07-13

5.  A Single, Acute Astragaloside IV Therapy Protects Cardiomyocyte Through Attenuating Superoxide Anion-Mediated Accumulation of Autophagosomes in Myocardial Ischemia-Reperfusion Injury.

Authors:  Kai-Yu Huang; Yong-Wei Yu; Shuai Liu; Ying-Ying Zhou; Jin-Sheng Wang; Yang-Pei Peng; Kang-Ting Ji; Yang-Jing Xue
Journal:  Front Pharmacol       Date:  2021-07-19       Impact factor: 5.810

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.