Literature DB >> 31366567

Long noncoding RNA-MEG3 contributes to myocardial ischemia-reperfusion injury through suppression of miR-7-5p expression.

Liyuan Zou1, Xiaokun Ma2, Shuo Lin3, Bingyuan Wu4, Yang Chen4, Chaoquan Peng5.   

Abstract

Long noncoding RNA (lncRNA) maternally expressed gene 3 (MEG3) plays an important role in protection of ischemia-reperfusion (I/R) injury in brain and liver. However, role of MEG3 in myocardial I/R injury remains unclear. Here, the role of MEG3 in protection of myocardial I/R injury and its association with microRNA-7-5p (miR-7-5p) was investigated using rat cardiac I/R model and myocardial I/R cell model. Our results showed that MEG3 was significantly up-regulated and miR-7-5p was significantly down-regulated after I/R. Following I/R, the levels of intact PARP and intact caspase-3 were reduced, while the cleaved fragments of PARP and caspase-3 were increased. TUNEL assay showed an increase in cardiomyocyte apoptosis after I/R. The levels of I/R-induced creatine kinase (CK) and lactate dehydrogenase (LDH) were inhibited by knockdown of MEG3 (siMEG3). SiMEG3 increased cell proliferation and inhibited cell apoptosis after I/R. In contrast, overexpression of MEG3 increased the I/R-induced CK and LDH activities and cell apoptosis and decreased cell proliferation. The dual-luciferase reporter system showed a direct binding of MEG3 to miR-7-5p. The level of miR-7-5p was negatively associated with the change in levels of MEG3 in H9c2 cells. The levels of intact RARP1 and caspase-3 were significantly increased by knockdown of MEG3. Co-transfection of miR-7-5p inhibitor with siMEG3 activates CK and LDH, significantly decreased cell proliferation, increased cell apoptosis, and decreased intact poly(ADP-ribose) polymerase 1 (PARP1) and caspase-3. In summary, down-regulation of MEG3 protects myocardial cells against I/R-induced apoptosis through miR-7-5p/PARP1 pathway, which might provide a new therapeutic target for treatment of myocardial I/R injury.
© 2019 The Author(s).

Entities:  

Keywords:  cardiomyocyte; ischaemia-reperfusion injury; lncRNA MEG3; miR-7-5p

Year:  2019        PMID: 31366567      PMCID: PMC6702358          DOI: 10.1042/BSR20190210

Source DB:  PubMed          Journal:  Biosci Rep        ISSN: 0144-8463            Impact factor:   3.840


Introduction

Ischemia–reperfusion (I/R) injury is a common pathological mechanism of ischemic cardiovascular disease in clinical anesthesia [1,2]. Timely reperfusion including primary percutaneous coronary intervention and thrombolytic treatment are the most efficient therapeutic strategies of ischemic heart disease, which results in cardiomyocyte damage and is commonly referred to as myocardial I/R injury [3]. Moreover, approaches for controlling and decreasing I/R injury in the perioperative period are always concerned by medical practitioners [4,5]. Although numerous drugs are utilized immediately after surgery to reduce myocardial necrosis and myocardial infarct area, the mechanism underlying cardio-protective effects, however, remains unclear. Increasing evidence suggests many cellular signaling pathways involving noncoding transcription regulation were triggered by I/R injury and responsible for cell survival or death [6-8]. Noncoding RNAs include microRNA (miRNA) and long noncoding RNAs (lncRNAs). MiRNAs contain 20–22 nt and lncRNAs contain >200 nt. Both miRNAs and lncRNAs are involved in myocardial I/R injury and cardiovascular diseases. MiR-103/107 modulates programmed necrosis and myocardial I/R injury by targeting FAS-associated protein, with death domain (FADD) [9]. LncRNA metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) regulates miR-145/Bnip3 signaling in cardioprotective effects of fentanyl against myocardial I/R injury [10]. LncRNA necrosis-related factor (NRF) regulates miR-873 in protection of cardiomyocytes against necrosis and myocardial I/R injury [11]. LncRNA urothelial carcinoma-associated 1 (UCA1) plays a pro-apoptotic role in cardiomyocytes by suppressing p27 expression after cardiac I/R injury [12]. Although the roles of many miRNAs have been well studied in myocardial I/R injury, the role of lncRNA and its association with miRNAs remains unclear. Recently, a novel rat lncRNA, human and mouse maternally expressed gene 3 (MEG3, also known as gene trap locus 2, GTL2) has been identified in many tissues and cells, such as brain and endothelial cells [13-15]. It was demonstrated that overexpression of MEG3 suppressed tumor cell growth and promote cell apoptosis in vitro [16,17]. A recent study suggested that MEG3 is involved in angiogenesis after ischemia brain injury by modulating the notch signaling [18]. MEG3 directly binds with the p53 DNA binding domain that stimulates p53-mediated transactivation and mediates ischemic neuronal death in ischemic neuronal damage [14]. MEG3 protects hepatocytes from hepatic ischemia–reperfusion through down-regulating miR-34a expression [19]. These findings suggest that MEG3 plays an important role in protection of IR injury. However, the role of MEG3 in myocardial I/R injury remains unclear. miR-7, a novel tumor suppressor, increases tumor cell apoptosis and reduced proliferation in malignant gastric cancer, breast cancer, nasopharyngeal carcinoma, and glioblastoma cells [20-23]. A recent study showed that miR-7 was up-regulated in murine heart after I/R [24]. miR-7 protects myocardial cells against I/R-induced apoptosis by targeting poly(ADP-ribose) polymerase 1 (PARP1) [25]. In the present study, we studied the role of lncRNA MEG3 in protection of myocardial I/R injury and its association with miR-7-5p in established rat cardiac I/R model and in vitro myocardial I/R cell model and its regulatory role in PARP in protecting cardiomyocytes from apoptosis.

Materials and methods

Animals and cardiac I/R model

Male Sprague–Dawley (SD) rats (250–300 g) were obtained from the Animal Laboratory of Sun Yat-sen University for the present study. The rats were housed in cages and fed standard food and water in the Animal Laboratory of Sun Yat-sen University. The Sun Yat-sen University Animal Care and Use Committee, China, approved the animal experimental protocol and all animal experiments were carried out according to its guidance. The rats were randomly divided into sham and I/R groups (n=8). For I/R, the rats were anesthetized with pentobarbital sodium (3%, intraperitoneal injection). The left anterior descending branch (LAD) was occluded for 30 min using a 4-silk suture and reperfused for 2 h as previously described [26]. The sham control rats underwent surgery with the silk beneath the coronary artery, but the LAD was not ligated [25]. The cardiac function parameters including heart rate, maximum and minimum action potential, and peak-peak value were detected by BL-410 bio-functional experiment system (Sichuan Taimeng, China). To identify the infarct size, the harvested hearts were cut into slices (1-mm-thick) and rinsed with 1% 2,3,5-triphenyltetrazolium chloride (TTC, Sigma, U.S.A.) at 37°C for 10 min. After fixing with 4% paraformaldehyde, the infarct size was not stained by TTC (white).

Echocardiography analysis

Rats were kept on a heating pad in a left lateral decubitus or supine position under isoflurane (2%) anesthesia and two-dimensional images were recorded. LV parameters including interventricular septum thickness, LV posterior wall thickness, LV internal diastolic diameter (LVIDd) and LV internal systolic diameter (LVIDs) were obtained from M-mode interrogation in a long-axis view. The LV percentage fractional shortening (LVFS%) and LV ejection fraction (LVEF) were calculated as follows: LVFS% = (LVIDd − LVIDs)/LVIDd × 100; and LVEF = [(LVIDd)3 − (LVIDs)/(LVIDd)3 × 100. All echocardiographic measurements were performed at least three times.

General histology and TUNEL assay

The heart of each rat was fixed in 10% formalin, embedded in paraffin to obtain 5-μm-thick sections, and viewed under an optical microscope after HE staining as previously described [27]. TUNEL was conducted to detect the DNA fragmentation using DeadEnd™ Fluorometric TUNEL system (Promega, U.S.A.) according to the manufacturer’s manual.

Cell culture, transfection, and I/R model

Rat ventricular cell lines, H9c2 and 293 cells (American Type Culture Collection (ATCC), U.S.A.), were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS, Gibco, U.S.A.) and 100 µg/ml penicillin/streptomycin at 37°C. The MEG3 expressing or shRNA plasmid and miR-7-5p inhibitor were purchased from Genepharma, China. For transfection, H9c2 cells were seeded in 100-mm plate at 1 × 106 until 50% confluence. Then, 0.5 nmol MEG3 expressing or shRNA vector and miR-7-5p mimics/inhibitor were transfected into cells using Lipofectamine 2000 (Invitrogen, U.S.A.) according to the manufacturer’s manual. After 48 h, the expression of MEG3 or miR-7 was detected and the cells were used for further experiments. To simulate I/R, the cells were kept in a hypoxic chamber at 37°C for 10 h with serum- and glucose-deficient DMEM and reoxygenated for 2 h with DMEM containing 10% FBS.

Creatine kinase and lactate dehydrogenase release assays

At the end of reperfusion of rats and treatment of cells, plasma samples and culture media were collected form the coronary effluent and cell cultures, respectively. The activities of lactate dehydrogenase (LDH) and creatine kinase (CK) were assayed using LDH and CK kits (Nanjing Jiancheng Bioengineering, China) according to the manufacturer’s instructions.

Quantitative real-time PCR

After reperfusion, total RNA was isolated from hearts with TRIzol reagent (Invitrogen, U.S.A.) according to the manufacturer’s manual. Complementary DNA (cDNA) was synthesized using the TaqMan microRNA reverse Transcription Kit (Applied Biosystems, U.S.A.) with U6 and miRNA specific stem-loop primers. Taqman MicroRNA assays and Taqman Universal PCR Master Mix detected miR-7-5p. For MEG3, quantitative real-time PCR (qRT-PCR) analysis was performed with a SYBR ExScript RT-PCR kit (Takara, China). The primers used to target sequences of miR-7-5p, U6, MEG3, and β-actin were as following (5′–3′): miR-7-5p: forward, ACACTCCAGCTGGGTGGAAGACTAGTGATTTT; reverse, CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACAAA; U6: forward, CTCGCTTCGGCAGCACA; reverse, AACGCTTCACGAATTTGCGT; MEG3 (rat): forward, GGGTAGTGGGGACATTAGG; reverse, GAAGGAAAGCAGCGAGTG; MEG3 (human), forward: CTGACTCGCTCTACTCCGTG; reverse, AGGGGATGCTAAGAACGAGA; β-actin (rat): forward, GGAGATTACTGCCCTGGCTCCTA; reverse, GACTCATCGTACTCCTGCTTGCTG; β-actin (human): forward, ATCGTGCGTGACATTAAGGAGAAG; reverse, AGGAAGGAAGGCTGGAAG AGTG. Relative expression level of miR-7-5p was normalized to U6, and that of MEG3 was normalized to β-actin.

Cell counting kit-8 assay

Cell proliferation was detected by a cell counting kit-8 (CCK-8, Beyotime, China) assay. The cells were seeded and incubated in 96-well plates for 24, 48, and 72 h. The cells were added to 10 μl CCK-8 solution (Beyotime, China) and incubated for 2 h in the dark. The absorbance (OD value) of solution was calculated at 450 nm using the microplate reader (Bio-Rad, U.S.A.).

Flow cytometry

After I/R, cell apoptosis was assessed by Annexin V-FITC and propiduim iodide (BD Biosciences, U.S.A.) according to the manufacturer’s instructions. The stained cells were analyzed by flow cytometry (BD, U.S.A.).

Luciferase reporter system

After miR-7-5p mimics were transfected to 293 cells, GV126-MEG3-3′UTR-wide type (WT) or its mutant type (MUT) vectors expressing firefly luciferase and pRL-cmv vectors expressing Renilla luciferase (Geneparam, U.S.A.) were transfected using Lipofectamine 2000. The luciferase activity was measured using the Dual-Luciferase Reporter System (Promega, U.S.A.). The Renilla luciferase activity was set as internal control.

Western blot analysis

Proteins were isolated from homogenized hearts and cultured with H9c2 cells, and quantified by BCA assay (Beyotime, China). Proteins (50 μg) were separated by 10% SDS/PAGE and transferred to PVDF membrane (Millipore, U.S.A.). The blots were incubated with anti-PARP1, anti-Caspase 3, and GAPDH (all 1:1000; Cell Signaling Technology, U.S.A.) overnight at 4°C and incubated with horseradish peroxidase (HRP)–conjugated anti-IgG secondary antibody (1:2000) for 1 h. The blots were visualized with an enhanced chemoluminescence kit (Amersham Pharmacia, U.S.A.).

Statistical analysis

All the data were expressed as means ± SD from three or more independent experiments. Statistical analysis was carried out using two-tailed Student’s t test or the ANOVA test using SPSS 15.0. Statistical significance was considered at P<0.05.

Results

Expression of MEG3 and miR-7-5p in established rat I/R model

The cardiac function of the two groups in response to reperfusion is shown in Figure 1. The hearts of the rats were subjected to myocardial ischemia for 30 min followed by 2 h of reperfusion. The I/R model group showed a decrease in value of ST segments’ elevations with increased heart rate, increased maximum action potential and minimum action potential, and decreased peak-peak value, compared with the sham group (Figure 1A).
Figure 1

The establishment of rat I/R model

The hearts were subjected to myocardial ischemia for 30 min followed by 2 h of reperfusion. (A) Cardiac function detection. (B) The infarct size of hearts was assessed by TTC staining. (C,D) The myocardial damage was evaluated by activity of (n-control = 6; n-Model = 5). (C) CK and (D) LDH released into the coronary effluent. (E) The morphology and HE staining. (F) TUNEL assay detected the cardiomyocyte apoptosis. (G) Detection of PARP and caspase-3 by Western blotting. (H) Expression of MEG3 in heart tissues. (I) Expression of miR-7-5p in heart tissues. **P<0.01 I/R model (model) vs. sham control (Con). In other assays, more than three mice in each group were assayed. Experiments were done thrice. P-values were determined using Student’s t tests.

The establishment of rat I/R model

The hearts were subjected to myocardial ischemia for 30 min followed by 2 h of reperfusion. (A) Cardiac function detection. (B) The infarct size of hearts was assessed by TTC staining. (C,D) The myocardial damage was evaluated by activity of (n-control = 6; n-Model = 5). (C) CK and (D) LDH released into the coronary effluent. (E) The morphology and HE staining. (F) TUNEL assay detected the cardiomyocyte apoptosis. (G) Detection of PARP and caspase-3 by Western blotting. (H) Expression of MEG3 in heart tissues. (I) Expression of miR-7-5p in heart tissues. **P<0.01 I/R model (model) vs. sham control (Con). In other assays, more than three mice in each group were assayed. Experiments were done thrice. P-values were determined using Student’s t tests. To detect the infarct size in the heart, TTC staining was performed after reperfusion (Figure 1B). The I/R model group showed an increase in the size of infarct. The myocardial damage was evaluated by measuring the activity of CK and LDH released into the coronary effluent (Figure 1C,D). The activities of CK and LDH were significantly increased in the I/R group compared with the sham group. To detect the infarct size in the heart, TTC staining was performed after reperfusion (Figure 1B). The I/R model group showed the presence of an infarct in hearts. Further, transthoracic echocardiography and M-mode tracings were used to evaluate LVIDd, LVIDs, LVFS% and LVEF%. As expected, I/R injury significantly increased the LVIDd and LVIDs (Supplementary Figure S1A,B), while reduced LVFS% and LVEF% (Supplementary Figure S1C,D) relative to sham group. The myocardial damage was evaluated by activity of CK and LDH released into the coronary effluent (Figure 1C,D). The activities of CK and LDH were significantly increased in the I/R group in comparison with the sham group. The myocardial damage was evaluated by activity of CK and LDH released into the coronary effluent (Figure 1C,D). The activities of CK and LDH were significantly increased in the I/R group in comparison with the sham group. The alterations in the morphology of myocardial tissues were evaluated by HE staining (Figure 1E). Myocardial tissues in I/R model group showed loosely and irregularly arranged muscle fibers and necrosis of muscle fibers, while normal morphology with tightly and orderly arranged cardiomyocytes, and no necrosis of muscle fibers were observed in the sham group (Figure 1E). As I/R-induced cell apoptosis contributes significantly to impairment of cardiac function, TUNEL assay was performed to observe the cardiomyocyte apoptosis (Figure 1F). The apoptosis rate in I/R model group was significant higher compared with sham group. It was reported that miR-7 was up-regulated in H9c2 cells after simulating I/R by negatively regulating PARP [25]. To detect the levels of MEG3 and miR-7-5p and their roles in I/R injury, the expression of PARP1 and caspase 3 were detected by Western blot (Figure 1G) and the levels of MEG3 and miR-7-5p were detected by qRT-PCR (Figure 1H,I). After I/R, the levels of intact PARP and intact caspase-3 were reduced and the cleaved fragments of PARP and caspase-3 were increased (Figure 1G), which could be attributed to the cardiomyocyte apoptosis. MEG3 was markedly up-regulated and miR-7-5p was significantly down-regulated (Figure 1H,I), thereby indicating an important role of MEG3 and miR-7-5p in I/R-induced cardiomyocyte apoptosis.

Down-regulation of MEG3 inhibited I/R-induced levels of CK and LDH and myocardial cell apoptosis

To detect the role of MEG3 in I/R-induced cardiac injury, down- or over-expression of MEG3 in H9c2 cells was determined (Figure 2). The level of I/R-induced CK and LDH were inhibited by siMEG3, and increased by overexpression of MEG3 (Figure 2A,B), thereby suggesting that MEG3 promoted myocardial damage.
Figure 2

Role of MEG3 in I/R H9c2 cells

H9c2 cells were transfected with siMEG3 or MEG3 expressing plasmid and exposed to I/R conditions. (A) Activity of CK. (B) Activity of LDH. (C) Cell proliferation was detected by CCK-8 assay. (D) Cell apoptosis was detected by flow cytometry. **P<0.01 vs. control (con). P-values were determined using Student’s t tests. Experiments showing identical results were performed at least thrice.

Role of MEG3 in I/R H9c2 cells

H9c2 cells were transfected with siMEG3 or MEG3 expressing plasmid and exposed to I/R conditions. (A) Activity of CK. (B) Activity of LDH. (C) Cell proliferation was detected by CCK-8 assay. (D) Cell apoptosis was detected by flow cytometry. **P<0.01 vs. control (con). P-values were determined using Student’s t tests. Experiments showing identical results were performed at least thrice. The cell proliferation and apoptosis were also detected. SiMEG3 increased cell proliferation in I/R H9c2 cells; however, cell proliferation was significantly decreased by overexpression of MEG3 (Figure 2C). Similarly, siMEG3 inhibited I/R induced cell apoptosis in H9c2 cells; however, overexpression of MEG3 significantly promoted cell apoptosis in I/R H9c2 (Figure 2D). Thus, MEG3 promoted cell apoptosis, inhibited cell proliferation, and promoted myocardial damage.

MEG3 regulated cardiomyocyte by directly binding to miR-5-7p

To examine whether MEG3 promoted myocardial damage through miR-7-5p, the lentivirus with miR-7-5p mimics and GV126-MEG3-3′UTR-wide type (WT) or its mutant type (MUT) vectors were transfected into 293 cells (Figure 3A). The luciferase activity was significantly decreased in the miR-7-5p mimics and WT group, but no change in the activity was observed in the MUT group (Figure 3B), thereby suggesting a direct binding of MEG3 to miR-7-5p. The role of MEG3 in regulating miR-7-5p was evaluated by qRT-PCR (Figure 3C,D). Negatively associated with the change in levels of MEG3 in H9c2 cells that overexpressed or knocked down MEG3 (Figure 3C), the level of miR-7-5p was significantly down- or up-regulated (Figure 3D). The intact RARP1 was significantly increased by knockdown of MEG3, while significant overexpression of MEG3 was observed in the I/R-induced cleaved PARP1 levels (Figure 3E). Similarly, intact caspase-3 was significantly increased by knockdown of MEG3. These results indicated that MEG3 regulated cardiomyocyte apoptosis by directly binding to miR-5-7p.
Figure 3

MEG3 directly binds to miR-7-5p

The dual-luciferase reporter system was performed to detect the relationship between MEG3 and miR-7-5p. (A) Binding sites in GV126-MEG3-3′UTR-wild type (WT) and mutant type (MUT) vectors for dual-luciferase reporter system. (B) Relative luciferase activity. SiMEG3 and MEG3 expressing plasmids were transfected into H9c2 cells. (C) Expression of MEG3. (D) Expression of miR-7-5p. (E) Expression of PARP1 and caspase 3. **P<0.01 vs. WT or control (con). Each assay was performed more than two times. **P-values were determined using Student’s t tests.

MEG3 directly binds to miR-7-5p

The dual-luciferase reporter system was performed to detect the relationship between MEG3 and miR-7-5p. (A) Binding sites in GV126-MEG3-3′UTR-wild type (WT) and mutant type (MUT) vectors for dual-luciferase reporter system. (B) Relative luciferase activity. SiMEG3 and MEG3 expressing plasmids were transfected into H9c2 cells. (C) Expression of MEG3. (D) Expression of miR-7-5p. (E) Expression of PARP1 and caspase 3. **P<0.01 vs. WT or control (con). Each assay was performed more than two times. **P-values were determined using Student’s t tests.

Co-transfection of siMEG3 and miR-7-5p inhibitor attenuated the inhibition of siMEG3 on I/R-inhibited cell proliferation and cell apoptosis

To detect the role of miR-5-7p in the protection of MEG3 against I/R injury, both siMEG3 and miR-7-5p inhibitor were transfected into H9c2 cells. Knockdown of MEG3 and miR-7-5p was observed in the co-transfected cells with I/R (Figure 4A,B). The activities of CK and LDH were significantly increased in co-transfection group compared with the siMEG3 transfected group after I/R (Figure 4C,D); thereby indicating that miR-7-5p inhibitor attenuated the role of siMEG3 in protection against the myocardial damage.
Figure 4

Role of miR-7-5p in MEG3 protected cardiomyocyte against apoptosis in I/R

H9c2 cells were transfected with siMEG3 and/or miR-7-5p inhibitor and treated with I/R. (A) Expression of MEG3. (B) Expression of miR-7-5p. (C) Activity of CK. (D) Activity of LDH. (E) Cell proliferation. (F) Cell apoptosis. (G) Expression of PARP1 and caspase 3. **P<0.01 vs. I/R. P-values were determined using Student’s t tests. One of the three independent experiments with identical results was shown.

Role of miR-7-5p in MEG3 protected cardiomyocyte against apoptosis in I/R

H9c2 cells were transfected with siMEG3 and/or miR-7-5p inhibitor and treated with I/R. (A) Expression of MEG3. (B) Expression of miR-7-5p. (C) Activity of CK. (D) Activity of LDH. (E) Cell proliferation. (F) Cell apoptosis. (G) Expression of PARP1 and caspase 3. **P<0.01 vs. I/R. P-values were determined using Student’s t tests. One of the three independent experiments with identical results was shown. Cell proliferation and apoptosis assays were also carried out. MiR-7-5p inhibitor significantly attenuated the siMEG3-induced cell proliferation in I/R cells (Figure 4E). miR-7-5p inhibitor significantly rescued siMEG3-inhibited cell apoptosis (Figure 4F). The up-regulation of target gene PARP1 of miR-7-5p by siMEG3 was significantly attenuated by miR-7-5p in I/R cells (Figure 4G). The level of intact PARP1 was decreased and cleaved PARP1 was increased in co-transfection group in I/R condition. Similarly, the level of intact caspase-3 was decreased and the cleaved caspase-3 was increased in co-transfection group in I/R condition. Thus, MEG3 protected cardiomyocyte against I/R injury by directly regulating miR-5-7p and its downstream target gene PARP1 and the caspase 3 signaling pathway.

Discussion

Various studies have showed that myocardial ischemia, hypoxia, and myocardial tissues damage induce release of enzymes in blood, including the significant CK and LDH [28]. The elevation of CK and LDH is proportional to the intensity of myocardial infarction [29,30]. In the present study, an increase in CK and LDH activity, enhanced size of infarction with a significantly high apoptosis rate, and decrease in values of ST segments’ elevations were observed model group compared with the sham control group. These findings suggested the establishment of rat I/R injury model. In the I/R model, MEG3 was significantly up-regulated and miR-7-5p was significantly down-regulated. The levels of intact target gene PARP of miR-7-5p and caspase-3 were reduced. It was reported that miR-7-5p targeting on PARP protects cardiomyocyte against I/R-induced cell apoptosis and reduces the intact caspase-3 [25]. This is consistent with our results. In the present study, our results demonstrated a role of MEG3 in I/R-induced myocardial injury through miR-7-5p/PARP pathway. There are at least 18 members of PARP family, of which PARP-1 is the most abundant and well studied [31]. PARP inhibitors can protect myocardial I/R injury against cell apoptosis. During the process of apoptosis, PARP was cleaved into two fragments of 89 and 24 kDa by caspase-3, thereby avoiding unnecessary DNA repair in cells and the excessive consumption of NAD+ and ATP in cells to ensure an adequate supply of energy during apoptosis [32,33]. Moreover, the activation of caspase-3 plays an important role in the process of cardiomyocyte apoptosis. Caspase-3 activity was increased in traumatic plasma-induced rat cardiomyocytes apoptosis [34]. In infarcted and ischemic myocardium of myocardial infarction mice, caspase-3 expression in heart tissues was up-regulated [35]. Hypoxia also induced caspase-3 and apoptosis in cardiomyocyte [36]. The activity of caspase-3 in cardiomyocytes is increased after I/R injury with the increase in apoptosis [37]. The levels of intact RARP1 and caspase-3 were significantly increased by knockdown of MEG3, while overexpression of MEG3 significantly increased I/R-induced cleaved PARP1 and caspase-3 levels. The levels of intact PARP1 and caspase-3 were decreased and the cleaved PARP1 and caspase-3 were increased in co-transfection group in I/R condition. Thus, MEG3 regulated PARP1 and caspase-3 levels. H9c2 is a subclone of the original clonal cell line derived from embryonic BD1X rat heart tissues that exhibits many properties of skeletal muscle. Previous evidence showed similar hypertrophic responses between H9C2 cell line and primary neonatal cardiomyocyte cells in vitro [38]. H9c2 cell line has also proved to be a valuable in vitro model to study the drug metabolizing enzymes in the heart [39]. Therefore, we chose H9C2 cell line for our in vitro study in order to exclude disturbing factors caused by diverse batches of primary cardiac myocytes. Meanwhile, male SD rats were also included for the in vivo investigation. Of note, we found that down-regulation of MEG3 protected H9c2 cells from hypoxia-induced injury and prevented cardiac fibrosis and diastolic dysfunction [40]. MEG3 modulated cardiac remodeling in cardiac hypertrophy [41]. Consistently, MEG3 promoted cell apoptosis, inhibited cell proliferation, and promoted myocardial damage. The level of miR-7-5p was negatively associated with the change in levels of MEG3 in H9c2 cells. Down-regulation of MEG3 could reduce I/R-induced apoptosis of myocardial cells, while miR-7-5p inhibitor rescued cell apoptosis. SiMEG3 increased cell proliferation and inhibited cell apoptosis in I/R H9c2 cells; however, the cell proliferation was significantly increased and apoptosis was significantly decreased by overexpression of MEG3, respectively. Other miRNAs such as miR-183 involved in hypoxia-induced injury [42]. Although miR-7-5p/PARP1 did not the only one, miR-7-5p/PARP1 pathway is responsible for the MEG3 promoted I/R injury. In conclusion, we have showed that lncRNA MEG3 plays a key role in the heart ischemia reperfusion injury via miR-7-5p/PARP1 pathway through in vivo and in vitro experiments. The mechanism of myocardial I/R injury is very complex and requires further investigation.
  42 in total

Review 1.  Apoptosis in the ischemic reperfused myocardium.

Authors:  C R Holleyman; D F Larson
Journal:  Perfusion       Date:  2001-11       Impact factor: 1.972

Review 2.  Cardiac enzymes. How to use serial determinations to confirm acute myocardial infarction.

Authors:  R S Ruzich
Journal:  Postgrad Med       Date:  1992-11-15       Impact factor: 3.840

3.  Cardioprotective effect of aprotinin on myocardial ischemia/reperfusion injury during cardiopulmonary bypass.

Authors:  Pelin Karaca; Cüneyt Konuralp; Yavuz Enc; Asuman Süzer; Onur Sokullu; Umut Ayoglu; Sertac Cicek
Journal:  Circ J       Date:  2006-11       Impact factor: 2.993

Review 4.  MEG3 noncoding RNA: a tumor suppressor.

Authors:  Yunli Zhou; Xun Zhang; Anne Klibanski
Journal:  J Mol Endocrinol       Date:  2012-04-02       Impact factor: 5.098

5.  Comparison of serum cardiac specific biomarker release after non-cardiac thoracic surgery.

Authors:  Thomas Muley; Markus Kurz; Clemens Männle; Adjmal Alekozai; Susanne Winteroll; Hendrik Dienemann; Werner Schmidt; Joachim Pfannschmidt
Journal:  Clin Lab       Date:  2011       Impact factor: 1.138

6.  The H9C2 cell line and primary neonatal cardiomyocyte cells show similar hypertrophic responses in vitro.

Authors:  Sarah J Watkins; Gillian M Borthwick; Helen M Arthur
Journal:  In Vitro Cell Dev Biol Anim       Date:  2010-11-17       Impact factor: 2.416

Review 7.  Vascular dysfunction in ischemia-reperfusion injury.

Authors:  John B Seal; Bruce L Gewertz
Journal:  Ann Vasc Surg       Date:  2005-07       Impact factor: 1.466

8.  MicroRNA-320 is involved in the regulation of cardiac ischemia/reperfusion injury by targeting heat-shock protein 20.

Authors:  Jinghai Wu; Xiao-Ping Ren; Xiaohong Wang; Maureen A Sartor; Keith Jones; Jiang Qian; Persoulla Nicolaou; Tracy J Pritchard; Guo-Chang Fan
Journal:  Circulation       Date:  2009-04-20       Impact factor: 29.690

Review 9.  Myocardial ischemia-reperfusion injury: a neglected therapeutic target.

Authors:  Derek J Hausenloy; Derek M Yellon
Journal:  J Clin Invest       Date:  2013-01-02       Impact factor: 14.808

10.  H9c2 cell line is a valuable in vitro model to study the drug metabolizing enzymes in the heart.

Authors:  Beshay N M Zordoky; Ayman O S El-Kadi
Journal:  J Pharmacol Toxicol Methods       Date:  2007-06-16       Impact factor: 1.950

View more
  9 in total

Review 1.  Involvement of non‑coding RNAs in the pathogenesis of myocardial ischemia/reperfusion injury (Review).

Authors:  Qi Li; Zhuqing Li; Zhixing Fan; Ying Yang; Chengzhi Lu
Journal:  Int J Mol Med       Date:  2021-02-12       Impact factor: 4.101

2.  Icariside II protects cardiomyocytes from hypoxia‑induced injury by upregulating the miR‑7‑5p/BTG2 axis and activating the PI3K/Akt signaling pathway.

Authors:  Dongxia Hu; Yong Gu; Dan Wu; Juanjuan Zhang; Qing Li; Jun Luo; Shaochuan Li; Zhen Yuan; Bo Zhu
Journal:  Int J Mol Med       Date:  2020-07-16       Impact factor: 4.101

3.  c-MYC-induced long noncoding RNA MEG3 aggravates kidney ischemia-reperfusion injury through activating mitophagy by upregulation of RTKN to trigger the Wnt/β-catenin pathway.

Authors:  Dajun Liu; Ying Liu; Xiaotong Zheng; Naiquan Liu
Journal:  Cell Death Dis       Date:  2021-02-18       Impact factor: 8.469

Review 4.  Long Noncoding RNA/Circular RNA-miRNA-mRNA Axes in Ischemia-Reperfusion Injury.

Authors:  Chengwu Gong; Xueliang Zhou; Songqing Lai; Lijun Wang; Jichun Liu
Journal:  Biomed Res Int       Date:  2020-11-25       Impact factor: 3.411

Review 5.  Long Noncoding RNAs in Myocardial Ischemia-Reperfusion Injury.

Authors:  Zhuo Zhao; Wei Sun; Ziyuan Guo; Bin Liu; Hongyu Yu; Jichang Zhang
Journal:  Oxid Med Cell Longev       Date:  2021-04-05       Impact factor: 6.543

Review 6.  Long non-coding RNAs and microRNAs as crucial regulators in cardio-oncology.

Authors:  Sarath Babu Nukala; Jordan Jousma; Yoonje Cho; Won Hee Lee; Sang-Ging Ong
Journal:  Cell Biosci       Date:  2022-03-04       Impact factor: 7.133

7.  Long Non-coding RNA MEG3 Promotes Pyroptosis in Testicular Ischemia-Reperfusion Injury by Targeting MiR-29a to Modulate PTEN Expression.

Authors:  Jin-Zhuo Ning; Kai-Xiang He; Fan Cheng; Wei Li; Wei-Min Yu; Hao-Yong Li; Ting Rao; Yuan Ruan
Journal:  Front Cell Dev Biol       Date:  2021-06-18

8.  Lnc-MEG3 acts as a potential biomarker for predicting increased disease risk, systemic inflammation, disease severity, and poor prognosis of sepsis via interacting with miR-21.

Authors:  Lei Na; Huajie Ding; Enhong Xing; Jun Gao; Bin Liu; Huarong Wang; Jian Yu; Changyu Yu
Journal:  J Clin Lab Anal       Date:  2020-01-06       Impact factor: 2.352

9.  Down-regulation of Xist and Mir-7a-5p improves LPS-induced myocardial injury.

Authors:  Dongshi Liang; Yimei Jin; Miaomiao Lin; Xiaojiao Xia; Xiaoli Chen; Airong Huang
Journal:  Int J Med Sci       Date:  2020-09-16       Impact factor: 3.738

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.