Literature DB >> 31362241

ANXA3 Silencing Ameliorates Intracranial Aneurysm via Inhibition of the JNK Signaling Pathway.

Yang Wang1, Chun Wang2, Qi Yang3, Yan-Li Cheng4.   

Abstract

Intracranial aneurysm (IA) rupture is a major cause of stroke death. Alteration of vascular smooth muscle cell (VSMC) function and phenotypic modulation plays a role in aneurysm progression. In the present study, we investigated the role of Annexin A3 (ANXA3) silencing in IA with the interaction of the c-Jun N-terminal kinase (JNK) signaling pathway. In IA and VSMCs of IA, the relationship between ANXA3 and the JNK signaling pathway was verified. To investigate the specific mechanism of ANXA3 silencing in IA, we transfected VSMCs with the overexpressed or small interfering RNA (siRNA) of ANXA3, or treated them with an inhibitor of the JNK signaling (SP600125). Cell counting kit-8 (CCK-8) assay was conducted to detect cell viability, and flow cytometry was conducted to assess cell cycle and apoptosis so as to evaluate the gain- and loss-of-function of ANXA3 and investigate the involvement of the JNK signaling pathway. The aneurysm wall of IA cells demonstrated an elevated level of ANXA3 expression and an activated JNK signaling pathway. VSMCs treated with siRNA-ANXA3 or SP600125 showed decreased expression of JNK, caspase-3, osteopontin (OPN), Bax, and matrix metalloproteinase-9 (MMP-9), as well as phosphate (p)-JNK, but increased the expression of α smooth muscle actin (α-SMA), β-tubulin, and Bcl-2. ANXA3 silencing or inactivation of the JNK signaling pathway also enhanced proliferation and repressed apoptosis of VSMCs. Collectively, this study shows that the silencing of ANXA3 can rescue VSMC function in IAs by inhibiting the phosphorylation and activation of the JNK signaling pathway. These findings may provide a potential therapy for the molecular treatment of IAs.
Copyright © 2019 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  ANXA3 silencing; JNK signaling pathway; apoptosis; intracranial aneurysm; proliferation; vascular smooth muscle cell

Year:  2019        PMID: 31362241      PMCID: PMC6661453          DOI: 10.1016/j.omtn.2019.06.005

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   8.886


Introduction

Intracranial aneurysm (IA) is a bulge or ballooning of the cranial blood vessels in the brain, which can cause severe complications including subarachnoid hemorrhage, vasospasm, and re-bleeding that might lead to death. The spontaneous rupture of IAs is a substantial cause of morbidity and mortality in IA patients, and seriously influences the treatment of the patients with IA.2, 3 In the general population, women with fibromuscular dysplasia have a higher risk for IA. The Hunterian carotid ligation was traditionally and initially used to treat IA s. To date, more experienced and advanced aneurysm clip designs were used for the IA treatment. However, the elucidation of a more specific and credible pathophysiology of IA rupture and formation is needed, as well as the specific genes and signaling pathways that might be crucial factors that contributed in the progression of IA. Annexin A3 (ANXA3) belongs to the Annexin family, which are a well-known multigene family of membrane-binding proteins and Ca2+-regulated phospholipid proteins. ANXA3 has been found to be correlated with cancer proliferation, colony-forming ability, invasion, and migration.8, 9 In this study, microarray-based gene expression analysis implied that ANXA3 was closely correlated with IA. Besides, the association between the c-Jun N-terminal kinase (JNK) signaling pathway and IA progression was also confirmed by previous studies.10, 11 As a family member of mitogen-activated protein kinase (MAPK), JNK was also correlated with IA, where JNK mainly undergoes cell proliferation, migration, differentiation, apoptosis, and inflammation. Recent studies have demonstrated that excessive apoptosis of vascular smooth muscle cells (VSMCs) may be an important factor for the cerebral aneurysm formation, and the JNK pathway may be the pro-apoptotic pathway of VSMCs. It has been found that ANXA3 promoted the tumor formation by JNK signaling pathway activation in the liver cancer stem cells. However, studies to further investigate the relationship of ANXA3 and the JNK signaling pathway in VSMCs of IA, as well as their interaction effect on progression of IA, are still lacking. Based on the biological characteristics of ANXA3, JNK, and VSMC in IA, the present study aimed to explore the effect of ANXA3 silencing on proliferation and apoptosis of VSMCs in IA via phosphorylation and activation of JNK, which may provide a new potential therapeutic target for the treatment of IA.

Results

ANXA3 Is the Most Differentially Expressed Gene in IA

The microarray gene expression data of GEO: GSE36791 showed that the expression levels of 25 genes were notably elevated, and 6 gene expression levels were decreased in IA samples as compared with normal control samples. Figure 1A showed the expression levels of those 31 differentially expressed genes (DEGs; illustrated in the heatmap. Gene Ontology (GO) was used to analyze the functional enrichment of DEGs (Figure 1B). The enrichment analysis results showed that the 31 DEGs were mainly enriched in biological processes that related to immunity, such as “immune system process” and “immune response.” It has been reported in many tumor diseases where the tumor development was intimately correlated with the immune system process and the immune response.15, 16, 17 It has also been reported that there is an association between immunity and IA disease.18, 19 These results showed that there is a close relationship between the DEGs and the development of IA. Further screening on IA-related DEGs was performed, and the first 10 DEGs with a larger fold change were chosen. Among the 10 genes, only HP, ANXA3, CST7, and matrix metalloproteinase-9 (MMP9) were intimately correlated to the proliferation and apoptosis, where ANXA3 was the DEG with the largest fold change in IA samples and was mainly enriched in the immune-related literature shown in GO enrichment. These results predicted the close relationship between ANXA3 and the development of IA. Furthermore, previous studies showed that JNK signaling pathway was also closely related to the development of IA.10, 11 In addition, it has been documented that ANXA3 plays a significant functional role in the JNK signaling pathway.14, 20 Nevertheless, the correlation between ANXA3 and JNK signaling pathway in IA has not been studied, and the results imply that ANXA3 may be involved in the JNK signaling pathway regulation to influence proliferation and apoptosis of IA.
Figure 1

The Microarray Analysis Results Showed the Close Relationship between ANXA3 and the Development of IA

(A) Heatmap analysis of IA-associated gene expression microarray data. The horizontal coordinate represents the sample number, and the vertical coordinate represents the gene name. The upper blue-red bar represents sample type: blue indicates normal control samples, whereas red indicates IA samples. The left tree map represents the cluster analysis of gene expression. The upper right histogram color indicates the level of expression: red indicates high expression value, whereas blue indicates low expression value. The left dendrogram represents the clustering results among genes; each square indicates the expression of a gene in a sample. (B) The biological process enrichment analysis of DEGs. The horizontal coordinate represents GeneRatio, and the vertical coordinate represents BP items. The size of circles refers to the gene quantity included in BP items, and a bigger circle indicates more genes. The color showed Qvalue of the item: red indicates low Qvalue, and green indicates high Qvalue. The left Count and Qvalue are legends. (C) Link analysis between the top five genes with the most differential expression and IA, proliferation, and apoptosis. The red pane refers to disease name and development keywords, whereas the blue pane refers to gene names. The lines between panes indicate the relationship between two elements, and the number indicates the closeness degree. The lines with different color indicate different relationships: green indicates stimulatory relationship, red indicates inhibitory relationship, yellow indicates both stimulatory and inhibitory, whereas gray indicates neither stimulatory nor inhibitory. ANXA3, Annexin A3; BP, biological process; DEG, differentially expressed gene; IA, intracranial aneurysm.

The Microarray Analysis Results Showed the Close Relationship between ANXA3 and the Development of IA (A) Heatmap analysis of IA-associated gene expression microarray data. The horizontal coordinate represents the sample number, and the vertical coordinate represents the gene name. The upper blue-red bar represents sample type: blue indicates normal control samples, whereas red indicates IA samples. The left tree map represents the cluster analysis of gene expression. The upper right histogram color indicates the level of expression: red indicates high expression value, whereas blue indicates low expression value. The left dendrogram represents the clustering results among genes; each square indicates the expression of a gene in a sample. (B) The biological process enrichment analysis of DEGs. The horizontal coordinate represents GeneRatio, and the vertical coordinate represents BP items. The size of circles refers to the gene quantity included in BP items, and a bigger circle indicates more genes. The color showed Qvalue of the item: red indicates low Qvalue, and green indicates high Qvalue. The left Count and Qvalue are legends. (C) Link analysis between the top five genes with the most differential expression and IA, proliferation, and apoptosis. The red pane refers to disease name and development keywords, whereas the blue pane refers to gene names. The lines between panes indicate the relationship between two elements, and the number indicates the closeness degree. The lines with different color indicate different relationships: green indicates stimulatory relationship, red indicates inhibitory relationship, yellow indicates both stimulatory and inhibitory, whereas gray indicates neither stimulatory nor inhibitory. ANXA3, Annexin A3; BP, biological process; DEG, differentially expressed gene; IA, intracranial aneurysm.

VSMC Apoptosis Is Observed in IA Specimens

The tissue ultra-micro-structure was morphologically observed in the control and aneurysm groups. There was no obvious VSMC apoptosis in the control group (Figure 2, left). Nevertheless, in the aneurysm group, VSMC layers were notably reduced on the aneurysm vessel wall; polymerization shrinkage phenomenon and characteristic spots occurred in VSMC chromatins; part of the VSMC nuclei were fully shrunken; and cytoplasm or nuclei were partially detached, accompanied with typical apoptosis bodies and swollen mitochondrion (Figure 2, right). These findings confirmed that VSMC apoptosis was increased in IA.
Figure 2

Tissue Ultra-Micro-Structure in the Control and Aneurysm Groups

The tissue ultra-micro-structure in the control (left) and aneurysm groups (right) (×6,000). The arrow refers to the apoptotic bodies.

Tissue Ultra-Micro-Structure in the Control and Aneurysm Groups The tissue ultra-micro-structure in the control (left) and aneurysm groups (right) (×6,000). The arrow refers to the apoptotic bodies.

Increased Expression of ANXA3 and PCNA in IA

Immunohistochemistry assay demonstrated that in both control and aneurysm groups, the affirmative expression of ANXA3 was mainly shown in the cytoplasm and cell membrane, whereas expression of proliferating cell nuclear antigen (PCNA) was mainly shown in the cell nucleus, as shown in Figures 3A and 3B. The positive expression rates of ANXA3 and PCNA in the control group were 4.78% ± 0.55% and 2.63% ± 0.22%, respectively, whereas in the aneurysm group they were 51.34% ± 5.49% and 29.67% ± 2.41%, respectively. The results showed that the positive expressions of ANXA3 and PCNA were both significantly elevated in the aneurysm group and in comparison with the control group. These findings suggested that ANXA3 and PCNA were elevated in IA.
Figure 3

Positive Expressions of ANXA3 and PCNA Were Upgraded in IA

(A) Results of immunohistochemistry assay in the control group and aneurysm group (original magnification ×400). (B) The positive expression of ANXA3 and PCNA in the control group and aneurysm group. *p < 0.05 compared with the control group. ANXA3, Annexin A3; PCNA, proliferating cell nuclear antigen.

Positive Expressions of ANXA3 and PCNA Were Upgraded in IA (A) Results of immunohistochemistry assay in the control group and aneurysm group (original magnification ×400). (B) The positive expression of ANXA3 and PCNA in the control group and aneurysm group. *p < 0.05 compared with the control group. ANXA3, Annexin A3; PCNA, proliferating cell nuclear antigen.

Enhanced VSMC Apoptosis in IA

In both control and aneurysm groups, terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end-labeling (TUNEL) staining was used to detect the cell apoptosis. The results showed that some cells were dead in the control group, and the cell nuclei were not colored with orderly shape and equal in size; but in the aneurysm group, many more cells died, and the nuclei of apoptotic cells were blue-violet and irregularly shaped with unequal size (Figures 4A and 4B). The apoptosis index was higher in the aneurysm group (70.22 ± 6.91) when compared with the index in the control group (4.97 ± 0.55) (p ˂ 0.05). Thus, it can be concluded that cell apoptosis was enhanced by IA.
Figure 4

TUNEL Staining Revealed that the IA Causes the Increase in Cell Apoptosis

(A) TUNEL staining figures of control and aneurysm groups (original magnification ×400). (B) The comparison of apoptosis indexes between the control and aneurysm groups. *p ˂ 0.05 compared with the control group. TUNEL, terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end-labeling.

TUNEL Staining Revealed that the IA Causes the Increase in Cell Apoptosis (A) TUNEL staining figures of control and aneurysm groups (original magnification ×400). (B) The comparison of apoptosis indexes between the control and aneurysm groups. *p ˂ 0.05 compared with the control group. TUNEL, terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end-labeling.

The JNK Signaling Pathway Is Activated in IA

qRT-PCR assay was used to detect the relative mRNA and protein levels in the control and aneurysm groups as shown in Figures 5A–5C. When compared with the control group, mRNA and protein levels of ANXA3, JNK, caspase-3, osteopontin (OPN), Bax, MMP-9, and PCNA, as well as the extent of JNK phosphorylation, were significantly increased, and those of α-smooth muscle actin (α-SMA), tubulin, and Bcl-2 were remarkably decreased in the aneurysm group (p < 0.05). The results showed that ANXA3 expression was increased and the JNK signaling pathway was activated in IA.
Figure 5

qRT-PCR and Western Blot Analysis Assay Revealed that the JNK Signaling Pathway Was Activated in the Aneurysm Group

(A) Bar graph of mRNA expression. (B) Bar graph of protein expression. (C) Protein bands of different genes. *p < 0.05 compared with control group. JNK, c-Jun N-terminal kinase.

qRT-PCR and Western Blot Analysis Assay Revealed that the JNK Signaling Pathway Was Activated in the Aneurysm Group (A) Bar graph of mRNA expression. (B) Bar graph of protein expression. (C) Protein bands of different genes. *p < 0.05 compared with control group. JNK, c-Jun N-terminal kinase.

siRNA1 Is Selected for Subsequent Experiments as Silencing Vector for ANAX3 mRNA

The fluorescence microscope observation showed that the transfection efficiency of all plasmids reached over 80%, as shown in Figure 6. Small interfering RNA1 (siRNA1), siRNA2, and siRNA3 showed a lower level of ANAX3 mRNA when compared with the siRNA (−) group (p ˂ 0.05). In addition, the siRNA1 group showed a lower level of ANAX3 mRNA. The results showed that the interference of siRNA1 was the most effective. Therefore, subsequent experiments were carried out using the siRNA1.
Figure 6

The Silencing Vector siRNA1 Exhibited the Highest Silencing Efficiency Compared with Other siRNAs

*p < 0.05 compared with the siRNA (−) group; #p < 0.05 compared with the siRNA2 group; &p < 0.05 compared with the siRNA3 group.

The Silencing Vector siRNA1 Exhibited the Highest Silencing Efficiency Compared with Other siRNAs *p < 0.05 compared with the siRNA (−) group; #p < 0.05 compared with the siRNA2 group; &p < 0.05 compared with the siRNA3 group.

Silencing ANXA3 or SP600125 Represses the Activation of the JNK Signaling Pathway

Figures 7A–7C demonstrated the expression level of relative gene mRNA and the protein levels in each group after transfection. Compared with the blank group, all indexes in the NC group showed no obvious difference (p > 0.05): the mRNA and protein levels of ANXA3, JNK, caspase-3, OPN, PCNA, Bax, and MMP-9, as well as the extent of JNK phosphorylation, were significantly decreased, and those of α-SMA, β-tubulin, and Bcl-2 were significantly increased in the si-ANXA3 group and the si-ANXA3 + SP600125 group; the mRNA and protein levels of NXA3, JNK, caspase-3, OPN, PCNA, and Bax, as well as the extent of JNK phosphorylation, were significantly elevated, and those of α-SMA, β-tubulin, and Bcl-2 were significantly reduced in the ANXA3 vector group; the mRNA and protein levels of ANXA3 showed no differences in the SP600125 group (p > 0.05), whereas the mRNA and protein levels of JNK, caspase-3, OPN, PCNA, and Bax, as well as the extent of JNK phosphorylation, were lower, and those of α-SMA, β-tubulin, and Bcl-2 were enhanced (p > 0.05). In comparison with the si-ANXA3 group, the SP600125 group had much lower mRNA and protein levels of JNK, caspase-3, OPN, PCNA, Bax, and MMP-9, as well as the extent of JNK phosphorylation, but much higher levels of α-SMA, β-tubulin, and Bcl-2 (p > 0.05). It can be concluded that when si-ANXA3 and SP600125 work together, the phosphate (p)-JNK was inhibited the most.
Figure 7

Silencing of ANXA3 Inhibited the Activation of the JNK Signaling Pathway

(A) mRNA expression of ANXA3, JNK, caspase-3, OPN, Bax, MMP-9, PCNA, α-SMA, β-tubulin, and Bcl-2. (B and C) Protein bands (B) and protein expression (C) of ANXA3, JNK, caspase-3, OPN, Bax, MMP-9, PCNA, α-SMA, β-tubulin, and Bcl-2 were measured by western blot assay. *p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group. ANXA3, Annexin A3; JNK, c-Jun N-terminal kinase.

Silencing of ANXA3 Inhibited the Activation of the JNK Signaling Pathway (A) mRNA expression of ANXA3, JNK, caspase-3, OPN, Bax, MMP-9, PCNA, α-SMA, β-tubulin, and Bcl-2. (B and C) Protein bands (B) and protein expression (C) of ANXA3, JNK, caspase-3, OPN, Bax, MMP-9, PCNA, α-SMA, β-tubulin, and Bcl-2 were measured by western blot assay. *p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group. ANXA3, Annexin A3; JNK, c-Jun N-terminal kinase.

ANXA3 Silencing or SP600125 Promotes VSMC Proliferation

As shown in Figure 8, the results of cell counting kit-8 (CCK-8) assay represented that compared with the blank group, the optical density (OD) values of cells in the si-ANXA3 group and the SP600125 group, suggesting a significant increase of cell viability after 24, 48, and 72 h. Whereas the OD values of cells in the ANXA3 vector group were all significantly decreased after 24, 48, and 72 h, showing a significant reduction of cell proliferation (p < 0.05). In comparison with the si-ANXA3 group and the SP600125 group, the si-ANXA3 + SP600125 group had higher cell proliferation (p < 0.05). The results showed that either si-ANXA3 or SP600125 could promote cell proliferation, whereas both si-ANXA3 and SP600125 may reach a better effect.
Figure 8

CCK-8 Assay Results Showed that si-ANXA3 and SP600125 Both Improved Cell Proliferation

*p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group and the SP600125 group. ANXA3, Annexin A3; CCK-8, cell counting kit-8.

CCK-8 Assay Results Showed that si-ANXA3 and SP600125 Both Improved Cell Proliferation *p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group and the SP600125 group. ANXA3, Annexin A3; CCK-8, cell counting kit-8.

ANXA3 Silencing or SP600125 Inhibits VSMC Apoptosis

Flow cytometry was used to detect the cell cycle and apoptosis as shown in Figures 9A–9D. When compared with the blank group, the si-ANXA3 group, SP600125 group, and si-ANXA3 + SP600125 group showed fewer cells in G0/G1 phase but more cells in S phase when cell-cycle progression was significantly accelerated with fewer apoptotic cells; in the ANXA3 vector group, the cells were significantly increased in G0/G1 phase but significantly decreased in S phase when cell-cycle progression was significantly slowed down with more apoptotic cells (p < 0.05). However, the three groups had no obvious differences in the number of cells in G2/M phase (p > 0.05). The results provided the evidence that either si-ANXA3 or SP600125 may suppress cell apoptosis, but both of them together works better.
Figure 9

Both the si-ANXA3 and SP600125 Suppressed Cell Apoptosis

(A) Flow chart of cell cycle. (B) Chart graph of cell cycle in each group. (C) Flow chart of cell apoptosis. (D) Chart graph of cell apoptosis in each group. *p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group and the SP600125 group. ANXA3, Annexin A3.

Both the si-ANXA3 and SP600125 Suppressed Cell Apoptosis (A) Flow chart of cell cycle. (B) Chart graph of cell cycle in each group. (C) Flow chart of cell apoptosis. (D) Chart graph of cell apoptosis in each group. *p < 0.05 compared with the blank group; #p < 0.05 compared with the si-ANXA3 group and the SP600125 group. ANXA3, Annexin A3.

Discussion

Among all the different cerebrovascular diseases, IA was one of the most severe types, with a mortality rate up to 40% despite modern treatments. ANXA3, a member of the annexin family (I–XIII), binds to the phospholipids in a Ca2+-dependent manner and functioned as a mediator in cellular growth and signal transduction pathways. The outcomes of our study revealed that ANXA3 silencing further accelerated cell proliferation and inhibited apoptosis of VSMCs in IA by inhibiting the activation of the JNK signaling pathway. Furthermore, the combination of ANXA3 silencing and JNK inhibitor may exert a better effect on the promotion of VSMC proliferation, as well as the inhibition of VSMC apoptosis, which may be the potential therapeutic target for the treatment of IA. We found that ANXA3 and PCNA were highly expressed and the JNK signaling pathway was activated in IA. PCNA was often used as a proliferation marker and usually overexpressed in cancer cells as a basic protein participating in DNA replication and DNA repair. Zeng et al. showed that AXNA3 in breast cancer was highly expressed when compared with normal breast cancer, which was closely related with axillary lymph node metastasis and tumor size. A study has shown that the phosphorylated JNK and p38 MAPK were highly activated in VSMC apoptosis. The former studies have validated the relationship between ANXA1 or ANXA2 with the tumor proliferation, but the relationship between ANXA3 and IAs was unknown. However, this present study added value to the unexplained role of ANXA3 in IAs. The present study revealed the relationship between ANXA3 and JNK signaling, but the correlations of ANXA3 and JNK with PCNA was still not well studied. The most important findings of this particular study were the inhibition of the JNK phosphorylation through ANX3 silencing, which leads to inhibition of the JNK silencing pathway. The study conducted by Zhou et al. found that si-ANXA3 effectively inhibited the proliferation of cancer cells and evidently increased apoptosis, which was suggested with ANXA3-mediated expression of Bcl-2/Bax. Besides, the apoptosis of bone marrow mesenchymal stem cells was also accompanied by the downregulated anti-apoptotic protein Bcl-2, where the Bcl-2 family also acted as the downstream factors of the JNK signaling pathway. Moreover, caspase-3 expression was downregulated by SP600125 treatment, the inhibitor of the JNK signaling pathway, which was coherent with increased Bax and decreased Bcl-2 in gastric cancer. Through a dysregulated JNK signaling pathway, secretory and endogenous ANXA3 were used to play crucial roles in promoting stem cell-like features and carcinoma in CD133+ liver residual cancer stem cells. Another important finding in the present study was that the ANXA3 silencing acted as an inhibitor of JNK expression, which led to the promotion of VSMC proliferation and reduced VSMC apoptosis. The proliferation and apoptosis of VSMCs were normally involved in maintaining the blood vessels, the layer of which was frequently lacking in tumor vessels, promoting tumor invasion and metastasis. Guo et al. have concluded that cathepsin B, caspase-3, and p-JNK in cerebral aneurysm were all related with VSMC apoptosis because the apoptosis mechanism of caspase-3 was activated by cathepsin B, and VSMC apoptosis was caused by the cathepsin B-mediated JNK signaling pathway. Consistent with previous studies, the present study also concluded that cathepsin B, caspase-3, and p-JNK participated in aneurysm therapy. Pan et al. have demonstrated that ANXA3 enhanced cell proliferation, migration, invasion, and resistance to chemotherapy, exerting an oncogenic role in hepatocellular carcinoma (HCC). Tong et al. have shown that the oncogenic properties of ANXA3 were repressed by the JNK inhibitor SP600125, which was verified by the diminished abilities of HCC cells to form colonies and hepatospheres, migrate and invade, and resist apoptosis and chemotherapy. In conclusion, the present study suggests that ANXA3 silencing promotes VSMC proliferation and inhibits their apoptosis in IA through the inhibition process of the JNK pathway (Figure 10). These findings may open novel routes for future IA. However, the experiment was carried out based on tissues and cells; the clinical side effects were unknown. Meanwhile, because the relationship between ANXA3 or JNK and PCNA was still unclear, future investigation is still needed in the research aspects, especially on the interaction among ANXA3, JNK, and PCNA that may potentially contribute to the development of therapeutic treatment for IA.
Figure 10

Schematic Diagram Showing that NXA3 Is Involved in the Progression of IA through the JNK Signaling Pathway

Schematic Diagram Showing that NXA3 Is Involved in the Progression of IA through the JNK Signaling Pathway

Materials and Methods

Ethical Statements

The study was approved by the Institutional Review Board of Taihe Hospital. Participants and their relatives agreed to sign the written informed consent to participate in this study.

Microarray-Based Gene Analysis

GEO: GSE36791 expression microarray datasets were searched from the GEO database with the keyword “intracranial aneurysm.” The microarray data comprise 61 samples, individually composed of 18 normal control samples and the 43 intracranial samples. The differences between the normal control samples and the IA samples were analyzed by R-language “limma” package, to obtain the DEGs. The DEG screening standards were |logFC| > 2 and p value < 0.05. In addition, R-language “pheatmap” package was applied to construct a heatmap of DEGs.

DEG Enrichment Analysis

The STRING database was used to analyze the linkage between the DEGs (https://string-db.org/), and Gene Oncology (GO) enrichment analysis was performed for DEGs. Then, Venn diagrams were constructed according to the enrichment analysis results.

Literature Relationship Analysis of Gene and Disease

The Chilibot online tool (http://www.chilibot.net/) was used to search the PubMed literature database (abstracts) about specific relationships between proteins, genes, or keywords. Relationships between two lists of genes, proteins, or keywords were selected to be searched. “Intracranial aneurysm,” “proliferation,” and “apoptosis” were input in list 1; the names of the 10 most DEGs in GEO: GSE3679 were input in list 2. Then, the literature relationship between the 10 genes and keywords in list 1 was searched.

Study Subjects

From November 2015 to July 2016, a total of 58 patients receiving aneurysm occlusion treatment (28 males and 30 females, aged 22–61 years, mean age: 51.9 years; or 26 patients aged <50 years and 32 patients aged ≥50 years) were selected at Taihe Hospital as the aneurysm group. In accordance to Hunt Hess Grade, these 58 patients were categorized into four grades, involving 4 patients at grade Ι, 19 at grade II, 18 at grade III, and 17 at grade IV. According to the size of the cerebral aneurysm, 39 patients were 0.6–1.5 cm, 12 patients were 1.5–2.5 cm, and 7 patients more than 2.5 cm. Based on the location of aneurysm, 9 patients were diagnosed with anterior communicating aneurysms, 11 patients were diagnosed with right posterior communicating aneurysm, 13 patients were diagnosed with left posterior communicating artery aneurysm, 16 patients were diagnosed with aneurysm of the right middle cerebral artery, and 9 patients were diagnosed with aneurysm of the left middle cerebral artery. In addition, 46 patients receiving intracranial tumor resection or the removal of intracerebral hematoma (22 males and 24 females, aged 27–65 years, mean age: 51.8 years; or 13 patients aged <50 years and 33 patients aged ≥50 years) were selected as the control group. These patients had no cerebral aneurysm or intracranial vascular malformation, and their vascular tissues in the artery were collected as samples. It was noted that the baseline information of the two groups was nearly similar.

Morphological Observation

Samples collected from the control group and the aneurysm group were treated by 3% glutaraldehyde and 1% osmium tetroxide, gradually dehydrated by acetone, embedded by Epon812, cut into semi-thin slices, and optically sliced into 6-μm ultrathin slices. Then, the slices were double-stained with uranyl acetate and lead citrate, and observed under H-600IV transmission electron microscope (Oxford Instruments, Shanghai, China).

Immunohistochemistry

The tissues from the control and aneurysm group were fixed with 4% paraformaldehyde for 24 h, and dehydrated using 80%, 90%, and 100% ethyl alcohol and butanol. The tissues were first fixed firmly and immersed in a wax box at 60°C, and 5 μm of sequential slices was prepared. The slices were then washed with 45°C water, baked for 1 h at 60°C, dewaxed by xylene, dehydrated by gradient alcohol, and then immersed in 3% H2O2 for 10 min. The tissues were then washed off in distilled water, followed by high-pressure antigen retrieval for 90 s, and cooled down at room temperature. The tissues were rinsed with PBS three times (3 min each); the slices were then blocked with 100 μL 5% BSA at 37°C for 30 min, followed by incubation with 100 μL of diluted ANXA3 primary rabbit antibody (1 μg/mL, ab127924; Abcam, MA, USA) and PCNA (1:100–1:1,000, ab92552; Abcam, MA, USA) at 4°C overnight. Then, the slices were rinsed with PBS three times (3 min for each), and the slices were added with biotinylated goat anti-rabbit secondary antibody (1:1,000, HY90046; Shanghai Hengyuan Biotechnology, Shanghai, China). After being rinsed with PBS, the slices were added with solution of streptomycin avidin-peroxidase (Beijing Zhongshan Biotechnology, Beijing, China). After being rinsed with PBS three times (3 min each), the slices were then added with diaminobenzidine (DAB) chromogenic reagent (Beijing Bioss Biotechnology, Beijing, China) at room temperature for development and then soaked in hematoxylin for 5 min. The slices were washed with tap water and were immersed in 1% hydrochloric alcohol solution for about 4 s, followed by washing with tap water for about 20 min. Finally, five high-power fields (×200) were randomly selected from every slice. One hundred cells were counted from each high-power field, and cells stained with brown granules were considered as positive cells. Based on the percentage of positive cells, if positive tumor cells/all tumor cells was >10%, it was evaluated as positive (+); if <10%, it was evaluated as negative (−). The experiment was repeated three times independently.

TUNEL Staining

The arterial vascular tissues from the control and aneurysm groups were made into paraffin-embedded sections before TUNEL staining. The paraffin-embedded sections were dewaxed twice for 10 min every time and soaked with ethanol for 5 min in every concentration of 100%, 90%, 80%, 70%, 50%, and 30%. Next, after rinsed with PBS twice for 2 min, the sections were added with Proteinase K working solution at 21°C–37°C for 20 min, then added with 0.3% methanol solution at room temperature for 30 min. After two rinses with PBS (2 min each time), the sections were treated with 0.1% Triton X-100 (dissolved in 1 × standard saline citrate [SSC] solution) for 5–10 min. Finally, the sections were rinsed twice with PBS again and dried. The TUNEL staining kit was bought from Shanghai Boyao Biotechnology (Shanghai, China) (BYJC0066); 10 μL reaction solution was added to the sections that were washed with buffer A twice (1 min each time); 50 μL blocking solution was added at 37°C for 30 min, then the blocking solution was discarded; 40 μL of chromogenic reaction reagent was added and incubated at 37°C for about 60 min; after being rinsed with buffer B twice (1 min each time), the sections were added with 40 μL of 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) chromogenic reagent and incubated in a dark box for 20 min; after being counterstained by nuclear fast red for 20 s, the sections were washed with water, then dehydrated by gradient ethanol to translucent, and finally mounted. Lastly, six non-overlapping high-power fields (×200) were randomly selected from every slice, and the average percentage of positive cells was counted. Cells with yellow-stained nuclei were considered as positive cells. The apoptosis index (AI) is the number of apoptotic nuclei/all apoptotic nuclei × 100%.

qRT-PCR

In control and aneurysm groups, the arterial vascular tissues were immersed in liquid nitrogen. The total RNAs in the tissues were then extracted using TRIzol (15596-018; Invitrogen, Carlsbad, CA, USA) assay. The extracted RNAs were reversely transcribed into cDNAs according to the Guide for PrimeScript RT reagent kit (RRO37A; Takara, Dalian, China) in a 25-μL reactive system of which the conditions were set as follows: reverse transcription (37°C for 15 min) and reverse transcriptase inactivation (85°C for 5 s). The cDNAs acquired were then mixed with 65 μL of diethyl pyrocarbonate and then subjected to real-time qPCR assay in accordance with the Guide for SYBR Premix Ex Taq II kit (Takara, Dalian, China) in a 50-μL reactive system. Real-time qPCR assay was carried out using ABI PRISM 7300 system (ABI, USA) under the following reactive conditions: pre-denaturation at 95°C for 4 min, a total of 40 cycles for the denaturation at 94°C for 30 s, and annealing at 58°C for 30 s, and it is extended to 72°C for 1 min. All primers were designed and synthesized by Wuhan BIOJUST Company (Wuhan, China), with the internal control of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and the sequences shown in Table 1. 2−ΔCt refers to the multiple proportions of the expression of target gene between experiment group and control group, and the formulas were as follows: ΔCt = ΔCtexperimentgroup − ΔCtcontrolgroup; ΔCt = Cttargetgene − CtGAPDH. The experiment was repeated three times independently. The method is also applicable to the cell experiment.
Table 1

Primers Sequences for qRT-PCR

GenesPrimers Sequences (5′–3′)
ANXA3forward: CATCTCATGGTGGCCCTAGTG
reverse: CTGCTTTGCATCAAAGACTGCT
JNKforward: CGTCTGGTGGAAGGAGAGAG
reverse: TAATAACGGGGGTGGAGGAT
Caspase-3forward: CTCGGTCTGGTACAGATGTCGATG
reverse: GGTTAACCCGGGTAAGAATGTGCA
α-SMAforward: TCCGTAATGGGTCTGC
reverse: ATGCTTGCTAGTCCAT
β-Tubulinforward: GGCCAAGGGTCACTACACG
reverse: GCAGTCGCAGTTTTCACACTC
OPNforward: CTCCATTGACTCGAACGACTC
reverse: CAGGTCTGCGAAACTTCTTAGAT
PCNAforward: CCTGCTGGGATATTAGCTCCA
reverse: CAGCGGTAGGTGTCGAAGC
Bcl-2forward: CTGTGCTGCTATCCTGC
reverse: TGCAGCCACAATACTGT
Baxforward: CCCGAGAGGTCTTTTTCCGAG
reverse: CCAGCCCATGATGGTTCTGAT
MMP-9forward: TGTACCGCTATGGTTACACTCG
reverse: GGCAGGGACAGTTGCTTCT
GAPDHforward: AGAAGGCTGGGGCTCATTTG
reverse: AGGGGCCATCCACAGTCTTC

ANXA3, Annexin A3; α-SMA, α-smooth muscle actin; Bax, Bcl-2-associated X protein; Bcl-2, B cell leukemia/lymphoma 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; JNK, c-Jun N-terminal kinase; MMP-9, matrix metalloproteinase-9; OPN, osteopontin; PCNA, proliferating cell nuclear antigen.

Primers Sequences for qRT-PCR ANXA3, Annexin A3; α-SMA, α-smooth muscle actin; Bax, Bcl-2-associated X protein; Bcl-2, B cell leukemia/lymphoma 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; JNK, c-Jun N-terminal kinase; MMP-9, matrix metalloproteinase-9; OPN, osteopontin; PCNA, proliferating cell nuclear antigen.

Western Blot Analysis

The arterial vascular tissues were lysed using 1 mL of tissue lysis buffer (50 mmoL/L Tris, 150 mmoL/L NaCl, 5 mmoL/L EDTA, 0.1% SDS, 1% Nonidet P-40 [NP-40], 5 μg/mL aprotinin, and 2 mmoL/L PMSF) and homogenated in an ice bath. The proteins were lysed with protein lysis buffer at 4°C and triturated three times, 10 min each time. Centrifugation was then performed at 25,764 × g at 4°C for 20 min. The proteins were separated by electrophoresis using SDS separating gel (10%) and stacking gel (4%). The proteins on the gel were transferred onto the nitrocellulose filter and incubated overnight using 5% non-fat milk powder at 4°C. The membrane was added with diluted primary rabbit polyclonal antibodies (Abcam, Cambridge, MA, USA), ANXA3 (ab127924, 1 μg/mL), JNK (ab179461, 1:1,000), phosphate (p)-JNK (ab124956, 1:1,000–1:10,000), caspase-3 (ab13847, 1:500), α-SMA (ab108424, 1:1,000–1:10,000), β-tubulin (ab6046, 1:500), OPN (ab8448, 1:1,000), PCNA (ab92552, 1:1,000–1:10,000), Bcl-2 (ab32124, 1:1,000), Bax (ab32503, 1:1,000–1:10,000), and matrix metalloproteinase-9 (MMP-9) (ab38898, 1:1,000). The membrane was then washed thrice with PBS (5 min each time) at room temperature and then incubated at 37°C for 1 h with added secondary antibody goat anti-rabbit conjugated with horseradish peroxidase (HRP) immunoglobulin G (IgG; 1:1,000; Wuhan Boster Biological Technology Company, Wuhan, China) followed by three PBS washes (5 min each time). The membrane was then immersed in enhanced chemiluminescence (ECL) reaction solution (Pierce, Waltham, MA, USA) at room temperature for 1 min, followed by dehydration. The membrane was coated with preservative film and developed in the dark. The relative expression level of proteins is equal to the ratio of the gray values between target bands and the bands of internal control, namely, β-actin (the method is also applicable to cell experiment).

Vector Screening and Construction

Forward and reverse primers were designed and synthesized based on ANXA3 cDNA sequences reported by GenBank. The cDNA template was amplified by PCR assay to obtain the target fragment of ANXA3 gene, and three si-ANXAs were designed. After identification by agarose gel electrophoresis, the PCR production of purified si-ANXA3 and pGPU6/GFP/Neo plasmids carrying the marker genes were through enzyme digestion by BglII and SalI. The target fragments were retrieved by gel extraction kit and were ligated using T4 DNA ligase. E. coli-competent cells were prepared with calcium chloride, and the monoclines were chosen for the recognition of target fragments by PCR assay. The double-enzyme digestion method and sequencing were performed, and the plasmid was recombined by non-carrier plasmids. The genes of psiANXA3-1, psiANXA3-2, and psiANXA3-3 were gained by sequencing and linearized using Pmel single digestion. The positive clones were identified by enzyme digestion; the recombinant adenovirus vector was established and then used to transfer competent bacteria. The competent cells were chosen for the amplification of positive clones (Table 2).
Table 2

Sequences of siRNAs

siRNASequence
ANXA3-15′-CCGAAACATCTGGTGACTT-3′
ANXA3-25′-GCACGGATGAAGACAAATT-3′
ANXA3-35′-GCATTATGGCTATTCCCTA-3′
NC5′-TGAAGACTGGTGAATCCAT-3′

ANXA3, Annexin A3; NC, negative control; siRNA, small interfering RNA.

Sequences of siRNAs ANXA3, Annexin A3; NC, negative control; siRNA, small interfering RNA.

Cell Culture and Identification

The aneurysm samples were cut into about 1 cm3 using ophthalmic scissors and were detached using 0.1% type II collagenase at 37°C until white flocks appeared on the surface of the samples. The tissue blocks were cut into about 1 mm3 and were inoculated at the intervals of 3–5 cm in a culture flask that was kept in a 5% CO2 incubator at 37°C for about 8 h. The DMEM complete culture solution was added to the culture flask. After 24 h, the cultural flask was added with 1 mL DMEM containing 10% fetal bovine serum (FBS). On the fifth day, the culture flask was added with 3 mL DMEM containing 10% FBS, and the tissue blocks were discarded. The medium was changed every 24 h. The cells were passaged when the cells grew to 90% confluence. VSMCs at passage 3 were inoculated on the cell culture dish with a piece of cover glass and were placed in a 5% CO2 incubator at 37°C for 3 days. When the cells reached 80% confluence, the glass cover was removed and the cells were rinsed with PBS and treated with 4% paraformaldehyde. The cells were then permeabilized with 0.3% Triton X-100 in PBS. The glass was washed with PBS and added with 1 mL 5% BSA solution at room temperature for 30 min. The slide glass was washed again with PBS after being cultured overnight at 4°C with mouse anti-rat α-SMA monoclonal primary antibody (diluted by PBS/0.05% Tween [PBST] at the ratio of 1:100). The slide was kept in the dark at room temperature for an hour; every well was added with 100 μL anti-mouse fluorescent secondary antibody (diluted by PBST at the ratio of 1:400) in the dark followed by three times rinse with PBS (5 min each time). Then, the cells were incubated with 100 μL DAPI avoiding exposure to light for 5 min and rinsed with PBS. The cover glass was mounted on the glass slide with added anti-quenching agent in advance for the observation of the fluorescence signal under a fluorescence microscope and a confocal microscope. The VSMCs were successfully cultured only when it was identified that the expression of α-SMA in cells was positive with over 95% purity.

Cell Treatment

The third generation of VSMCs in logarithmic growth were prepared into 5 × 105 cells/mL cell suspension and inoculated to a six-well plate. The plate was set in an incubator for 24 h until the cells reached 75% confluency. The cells were then incubated with the culture solution without FBS at 37°C. After 1 h, the cells were taken out and assigned into six groups: blank group (VSMCs without any transfection); negative control (NC) group (VSMCs transfected with non-carrier adenovirus vector); si-ANXA3 group (VSMCs transfected with si-ANXA3); ANXA3 vector group (VSMCs transfected with overexpressed plasmid, ANXA3); SP600125 group (VSMCs transfected with the inhibitor of signaling pathway, SP600125); and si-ANXA3 + SP600125 group (transfected with si-ANXA3 and injected the inhibitor of the signaling pathway, SP600125). According to the Lipofectamine 2000 Guide for Transfection Reagent (11668-019; Invitrogen, Carlsbad, CA, USA), the cells were transfected as follows: 100 pmol non-carrier adenovirus vector solution diluted with 250 μL serum-free Opti-MEM medium (GIBCO) with the final concentration of 50 nM evenly mixed and incubated at room temperature for 5 min; 5 μL Lipofectamine 2000 diluted with 250 μL serum-free Opti-MEM was evenly mixed and incubated at room temperature for 5 min; both solutions obtained above were evenly mixed and inoculated to cell culture wells after 20 min of incubation at room temperature; the medium was changed after 6 h; and after 48 h of culture, the cells were collected for subsequent experiments.

CCK-8 Assay

After 48 h, trypsin was used to detach the transfected cells and re-attached by using 2 × 104 cells/mL of cells. An amount of 100 μL cell suspension was inoculated into the 96-well plates, and five duplicates were performed for each group. Three wells were randomly selected after 12, 24, 36, 48, and 72 h of culture in the culture box at 37°C for each group. Then, 10 μL CCK-8 was added into each well and further cultured for 2 h. Finally, the OD at 450 nm was measured using a microplate reader (Multiskan FC; Thermo Fisher, New York, NY, USA), and the cell growth curve was drawn. The experiment was repeated three times independently.

Flow Cytometry

Cell cycle was detected by propidium iodide (PI) single staining. The cells were fixed with 70% absolute alcohol and cultured overnight at 4°C. Then, the cells were rinsed twice with PBS, which was supplemented with 1% fetal calf serum, followed by centrifugation at 800 × g at 4°C with the supernatant discarded. Subsequently, the cells were incubated at 37°C for about 30 min with 50 μL RNA enzyme (Sigma-Aldrich Chemical Company, St. Louis, MO, USA), followed by incubation in the dark for 30 min with 50 μL 50 mg/L PI (Sigma-Aldrich Chemical Company, St. Louis, MO, USA). Finally, the cell cycle was assessed using flow cytometry. Cell apoptosis was evaluated by Annexin V-FITC/PI staining. The cystic fibrosis (CFPAC-1) cells were inoculated in a six-well plate with 2 × 105 cells/well. The wells were categorized into three different groups: blank group, NC group, and cell transfection group. The cells were transfected at 100 nmol/L for 72 h; then the culture solution was discarded. The cells were rinsed once with pre-cooled PBS, trypsinized, and centrifuged at 800 × g in a 15-mL centrifuge tube. The supernatant was discarded, and the precipitate was rinsed twice with PBS. The cells were then resuspended in 500 μL binding buffer according to the Annexin V-HTC Apoptosis Detection Kit I (556547; BD Company, NJ, USA) and evenly mixed with 5 μL FITC and 5 μL PI, followed by 15 min of incubation. Lastly, the cell apoptosis was analyzed by flow cytometry.

Statistical Analysis

Statistical analyses were conducted by using SPSS 19.0 (IBM, Armonk, NY, USA). Results were expressed as mean ± SD. t test was used to compare the difference between two groups. Data among multiple groups were compared by one-way ANOVA. p < 0.05 indicates that the difference was statistically significant.

Author Contributions

Y.W. participated in the conception and design of the study. C.W. and Q.Y. performed the analysis and interpretation of data. Y.-L.C. contributed to drafting the article. All authors have read and approved the final submitted manuscript.

Conflicts of Interest

The authors declare no competing interests.
  32 in total

1.  Silencing of ANXA3 expression by RNA interference inhibits the proliferation and invasion of breast cancer cells.

Authors:  Tao Zhou; Yong Li; Li Yang; Liang Liu; Yingchao Ju; Chunxiao Li
Journal:  Oncol Rep       Date:  2016-11-16       Impact factor: 3.906

2.  Immune checkpoint blockade combined with IL-6 and TGF-β inhibition improves the therapeutic outcome of mRNA-based immunotherapy.

Authors:  Lukasz Bialkowski; Kevin Van der Jeught; Sanne Bevers; Patrick Tjok Joe; Dries Renmans; Carlo Heirman; Joeri L Aerts; Kris Thielemans
Journal:  Int J Cancer       Date:  2018-03-13       Impact factor: 7.396

Review 3.  The role of annexin A3 playing in cancers.

Authors:  Na Wu; Shuqing Liu; Chunmei Guo; Zhijie Hou; Ming-Zhong Sun
Journal:  Clin Transl Oncol       Date:  2012-08-22       Impact factor: 3.405

4.  Annexin A3 is associated with a poor prognosis in breast cancer and participates in the modulation of apoptosis in vitro by affecting the Bcl-2/Bax balance.

Authors:  Chao Zeng; Zunfu Ke; Yulan Song; Yunhong Yao; Xinrong Hu; Miao Zhang; Hongmei Li; Jinbao Yin
Journal:  Exp Mol Pathol       Date:  2013-04-28       Impact factor: 3.362

5.  Annexin A3 promotes tumorigenesis and resistance to chemotherapy in hepatocellular carcinoma.

Authors:  Qiu-Zhong Pan; Ke Pan; De-Sheng Weng; Jing-Jing Zhao; Xiao-Fei Zhang; Dan-Dan Wang; Lin Lv; Shan-Shan Jiang; Hai-Xia Zheng; Jian-Chuan Xia
Journal:  Mol Carcinog       Date:  2013-12-23       Impact factor: 4.784

6.  ANXA3/JNK Signaling Promotes Self-Renewal and Tumor Growth, and Its Blockade Provides a Therapeutic Target for Hepatocellular Carcinoma.

Authors:  Man Tong; Tsun-Ming Fung; Steve T Luk; Kai-Yu Ng; Terence K Lee; Chi-Ho Lin; Judy W Yam; Kwok Wah Chan; Fai Ng; Bo-Jian Zheng; Yun-Fei Yuan; Dan Xie; Chung-Mau Lo; Kwan Man; Xin-Yuan Guan; Stephanie Ma
Journal:  Stem Cell Reports       Date:  2015-06-18       Impact factor: 7.765

7.  Development of a prognostic scoring system for patients with advanced cancer enrolled in immune checkpoint inhibitor phase 1 clinical trials.

Authors:  Shiraj Sen; Kenneth Hess; David S Hong; Aung Naing; Sarina Piha-Paul; Filip Janku; Siqing Fu; Ishwaria M Subbiah; Holly Liu; Rahil Khanji; Le Huang; Shhyam Moorthy; Daniel D Karp; Apostolia Tsimberidou; Funda Meric-Bernstam; Vivek Subbiah
Journal:  Br J Cancer       Date:  2018-02-20       Impact factor: 7.640

8.  Dynamics of the Intratumoral Immune Response during Progression of High-Grade Serous Ovarian Cancer.

Authors:  Mandy Stanske; Stephan Wienert; Dan Cacsire Castillo-Tong; Caroline Kreuzinger; Ignace Vergote; Sandrijne Lambrechts; Hani Gabra; Charlie Gourley; Ram N Ganapathi; Ivonne Kolaschinski; Jan Budczies; Jalid Sehouli; Ilary Ruscito; Carsten Denkert; Hagen Kulbe; Wolfgang Schmitt; Korinna Jöhrens; Ioana Braicu; Silvia Darb-Esfahani
Journal:  Neoplasia       Date:  2018-02-22       Impact factor: 5.715

9.  Human colorectal cancer cells induce vascular smooth muscle cell apoptosis in an exocrine manner.

Authors:  Wei-Wei Li; Hai-Yue Wang; Xi Nie; Ya-Bin Liu; Mei Han; Bing-Hui Li
Journal:  Oncotarget       Date:  2017-06-27

10.  T cell function is dispensable for intracranial aneurysm formation and progression.

Authors:  Haruka Miyata; Hirokazu Koseki; Katsumi Takizawa; Hidetoshi Kasuya; Kazuhiko Nozaki; Shuh Narumiya; Tomohiro Aoki
Journal:  PLoS One       Date:  2017-04-24       Impact factor: 3.240

View more
  4 in total

1.  Role of the MAPK pathway in human lung epithelial-like A549 cells apoptosis induced by paraquat.

Authors:  Da-Zhuang Sun; Chun-Qing Song; Yong-Min Xu; Xue-Song Dong
Journal:  Genet Mol Biol       Date:  2020-03-30       Impact factor: 1.771

Review 2.  Annexin A3 in sepsis: novel perspectives from an exploration of public transcriptome data.

Authors:  Mohammed Toufiq; Jessica Roelands; Mohamed Alfaki; Basirudeen Syed Ahamed Kabeer; Marwa Saadaoui; Arun Prasath Lakshmanan; Dhinoth Kumar Bangarusamy; Selvasankar Murugesan; Davide Bedognetti; Wouter Hendrickx; Souhaila Al Khodor; Annalisa Terranegra; Darawan Rinchai; Damien Chaussabel; Mathieu Garand
Journal:  Immunology       Date:  2020-08-31       Impact factor: 7.397

3.  Polymorphonuclear Cells Show Features of Dysfunctional Activation During Fatal Sepsis.

Authors:  Marcela Hortová-Kohoutková; Marco De Zuani; Petra Lázničková; Kamila Bendíčková; Ondřej Mrkva; Ivana Andrejčinová; Alexandra Mýtniková; Ondřej Polanský; Kamila Kočí; Veronika Tomášková; Vladimír Šrámek; Martin Helán; Jan Frič
Journal:  Front Immunol       Date:  2021-12-13       Impact factor: 7.561

4.  Identification of biomarkers in common chronic lung diseases by co-expression networks and drug-target interactions analysis.

Authors:  Mazaher Maghsoudloo; Sadegh Azimzadeh Jamalkandi; Ali Najafi; Ali Masoudi-Nejad
Journal:  Mol Med       Date:  2020-01-17       Impact factor: 6.354

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.