Jeroen Overman1, Frank Fontaine1, Jill Wylie-Sears2, Mehdi Moustaqil3, Lan Huang2, Marie Meurer4, Ivy Kim Chiang1, Emmanuelle Lesieur1, Jatin Patel5, Johannes Zuegg1, Eddy Pasquier4, Emma Sierecki3, Yann Gambin3, Mohamed Hamdan6, Kiarash Khosrotehrani5, Gregor Andelfinger7, Joyce Bischoff2, Mathias Francois1. 1. Institute for Molecular Bioscience, The University of Queensland, Brisbane, Australia. 2. Vascular Biology Program, Department of Surgery, Boston Children's Hospital, Harvard Medical School, Boston, United States. 3. Single Molecule Science, Lowy Cancer Research Centre, The University of New South Wales, Sydney, Australia. 4. Centre de Recherche en Cancérologie de Marseille (CRCM Marseille Cancer Research Centre), Inserm UMR1068, CNRS UMR7258, Aix-Marseille University UM105, Marseille, France. 5. Translational Research Institute, Diamantina Institute, The University of Queensland, Brisbane, Australia. 6. Dubai Healthcare City, Dubai, United Arab Emirates. 7. Department of Pediatrics, University of Montreal, Ste-Justine University Hospital Centre, Montréal, Canada.
Abstract
Propranolol is an approved non-selective β-adrenergic blocker that is first line therapy for infantile hemangioma. Despite the clinical benefit of propranolol therapy in hemangioma, the mechanistic understanding of what drives this outcome is limited. Here, we report successful treatment of pericardial edema with propranolol in a patient with Hypotrichosis-Lymphedema-Telangiectasia and Renal (HLTRS) syndrome, caused by a mutation in SOX18. Using a mouse pre-clinical model of HLTRS, we show that propranolol treatment rescues its corneal neo-vascularisation phenotype. Dissection of the molecular mechanism identified the R(+)-propranolol enantiomer as a small molecule inhibitor of the SOX18 transcription factor, independent of any anti-adrenergic effect. Lastly, in a patient-derived in vitro model of infantile hemangioma and pre-clinical model of HLTRS we demonstrate the therapeutic potential of the R(+) enantiomer. Our work emphasizes the importance of SOX18 etiological role in vascular neoplasms, and suggests R(+)-propranolol repurposing to numerous indications ranging from vascular diseases to metastatic cancer.
Propranolol is an approved non-selective β-adrenergic blocker that is first line therapy for infantile hemangioma. Despite the clinical benefit of propranolol therapy in hemangioma, the mechanistic understanding of what drives this outcome is limited. Here, we report successful treatment of pericardial edema with propranolol in a patient with Hypotrichosis-Lymphedema-Telangiectasia and Renal (HLTRS) syndrome, caused by a mutation in SOX18. Using a mouse pre-clinical model of HLTRS, we show that propranolol treatment rescues its corneal neo-vascularisation phenotype. Dissection of the molecular mechanism identified the R(+)-propranolol enantiomer as a small molecule inhibitor of the SOX18 transcription factor, independent of any anti-adrenergic effect. Lastly, in a patient-derived in vitro model of infantile hemangioma and pre-clinical model of HLTRS we demonstrate the therapeutic potential of the R(+) enantiomer. Our work emphasizes the importance of SOX18 etiological role in vascular neoplasms, and suggests R(+)-propranolol repurposing to numerous indications ranging from vascular diseases to metastatic cancer.
Human mutations in the SOX18 gene give rise to Hypotrichosis-Lymphedema-Telangiectasia and Renal syndrome (HLTRS) (Irrthum et al., 2003; Moalem et al., 2015). Most disease-causing SOX18 mutations lead to a premature truncation at the C-terminus due to an early stop codon, producing defective protein products that act in a dominant negative fashion. The mutated SOX18 protein can still bind to chromatin but fails to recruit its protein partner(s) to transactivate target genes, and thereby disrupts the endogenous function of SOX18. Further, the dominant-negative mutant prevents other SOX transcription factors to act redundantly and rescue the molecular pathway (Hosking et al., 2009). From birth to adolescence HLTRS patients develop symptoms such as lymphedema and abnormalities to hair and nails for which very limited effective treatment options exist. Patients suffering from HLTRS display a certain level of variability in their phenotypic characteristics with distinct clinical manifestations (see for review Valenzuela et al., 2018) that likely depend on the specific type of SOX18 mutation and how it interferes with SOX18 transcriptional regulation.A recent report of an HLTRS patient described symptoms so mild that the initial diagnosis failed to identify this syndrome, mostly due to the absence of lymphedema up until late adolescence (Wünnemann et al., 2016). Eventually, the patient was subjected to whole-exome sequencing, which led to the discovery of a premature stop-codon in SOX18, p.Q161*; with such a mutation the patient would be expected to present a severe phenotype. A search for a potential cause of the milder course of the syndrome in this patient revealed that she had been treated with high doses propranolol since a young age due to a significant dilation of the thoracic artery causing a high blood pressure. The milder phenotype observed in this HLTRS patient coincident with the course of the propranolol treatment raised the possibility that this drug has a SOX18-dependent molecular mode of action in addition to its β-blocking activity.The main indications for propranolol therapy are hypertension, ischemic heart disease, arrhythmia, migraine and essential tremor. Sensitivity to propranolol does not always correlate with the expression levels of the β-adrenergic receptors (Wolter et al., 2014; MacDonald et al., 2006; Chang et al., 2015; Powe et al., 2010). Propranolol use in obstructive hypertrophic cardiomyopathy revealed its beneficial effects in infantile hemangioma (Léauté-Labrèze et al., 2008), raising the possibility that β-adrenergic receptor signaling, and thus by inference, propranolol, modulates VEGF levels (Chen et al., 2013; Ozeki et al., 2013; Lavine et al., 2013). Conclusive proof of such a mode of action is still lacking. Further, this drug is a racemic mixture with R(+) and S(-) enantiomers in equal proportions. The S(-) form displays most of the anti-β-adrenergic activity, whereas the R(+) enantiomer is carried over during drug synthesis. This makes the mode of action of propranolol even more elusive since therapeutic outcomes may result from a combination of effects from the two enantiomers.In this study, we report an additional case of HLTRS successfully treated with propranolol and describe a R(+) enantiomer-specific mode of action that acts through interference of SOX18 transcriptional activity and thereby functions as an anti-angiogenic agent whereas the S(-) enantiomer does not. This finding paves the way for new therapeutic applications using SOX18 transcription factor as a molecular target in the context of vascular diseases.
Results
Based on the observation that a previous case of HLTRS may have benefited from a long-term exposure to propranolol (Wünnemann et al., 2016), we considered propranolol therapy for another HLTRS patient (Bastaki et al., 2016) in an attempt to mitigate the severity of his symptoms. The patient was diagnosed with HLTRS at 11 months of age, after presenting with alopecia, edema and telangiectasia (Bastaki et al., 2016). Exome sequencing revealed that this patient had a truncation mutation in SOX18 (SOX18 c.492_505dup). In September 2015, at 17 months of age, he developed progressive pericardial effusion over 3 weeks, which required pericardiocentesis. Fluid analysis showed transudate. Two weeks after the procedure, pericardial effusion re-accumulated progressively over 6 weeks, despite strong anti-inflammatory regimens including 3 weeks of oral ibuprofen and 10 days of oral prednisone. Past clinical experience in HLTRS suggested the progression of this pericardial effusion was intractable. The effusion was large enough to cause hemodynamic compromise and to necessitate another pericardiocentesis. After obtaining parental consent, oral propranolol was introduced and increased gradually every 2–3 weeks from 0.8 mg/kg/day in three divided doses to reach a maximum of 4.1 mg/kg/day, as tolerated clinically (pulmonary wheezing). We observed spontaneous and rapid resolution of the pericardial effusion after reaching a dose threshold of 3 mg/kg/day. Bronchial side effects limited the maximal dosing in this patient to 4 mg/kg/day (Figure 1A and B). The positive outcome in this second HLTRS patient harboring SOX18 mutation suggested propranolol might act via an alternative pathway than the well characterized β-adrenergic receptor blockade.
Figure 1.
Propranolol treatment alleviates pericardial effusion severity in HLTRS patient and mediates β-adrenergic independent effects.
(A) A 17 months old HLTRS patient was treated with propranolol, starting at 0.8 mg/kg/day in three divided doses and increasing gradually every 2–3 weeks to maximum of 4.1 mg/kg/day (red curve). In parallel the volume of ventricular peri-cardial effusion was measured at the end of the diastole (blue curve). (B) Echocardiography revealed that pericardiocentesis was not required anymore after propranolol treatment due to significant reduction in pericardial effusion (pink arrow) which did not recur as of June 2018 (time of the study). (C) Fetal endothelial colony forming cells (ECFC) were isolated from term placenta from healthy donors, expanded for three passages, and subjected to propranolol treatment followed by analysis of survival (percentage) as compared to vehicle control (DMSO). Propranolol affected the survival of ECFC at equivalent doses whereas Atenolol (specific β1 blocker) and ICI118,551 (specific β2) did not. (D) Cell survival assay performed on ISO-HAS angiosarcoma cells after transfection with three different siRNA sequences targeting ADRB2 and following 72 hr incubation with propranolol (racemic mixture). Alamar Blue assay ; Points, mean of at least four independent experiments ; Error bars, standard error. (E) Combination indexes of propranolol and vinblastine in ISO-HAS angiosarcoma cells after transfection with three different siRNA sequences targeting ADRB2 and following 72 hr drug incubation (50uM). Alamar Blue assay ; Bars, mean of at least four independent experiments ; Error bars, standard error. Statistical analysis for C was performed using Mann-Whitney non parametric t-test and for D-E using an unpaired two-tailed t test.
(A and B) β-adrenergic receptor gene expression following 72 hr transfection with siRNA in ISO-HAS angiosarcoma cells (A) and SHEP neuroblastoma cells (B), as determined by qRT-PCR using specific primers for ADRB1 and ADRB2, and compared with YWHAZ as housekeeping gene. (C) Cell viability assay performed by Alamar Blue on SHEP neuroblastoma cells following siRNA transfection and 72 hr drug incubation; Data points, mean of at least four independent experiments; Error bars, standard error. (D) Change in vincristine EC50 (i.e. concentration causing a 50% reduction in cell viability after 72 hr drug incubation) in the presence of 10 or 50 µM propranolol as compared with vincristine alone following transfection of SHEP neuroblastoma cells with either ADRB1, ADRB2 or both siRNA. Bars, mean of at least four independent experiments ; Error bars, standard error. Classic unpaired Student's t test with the following legend: *p<0.05; **p<0,01; ***p<0001.
Propranolol treatment alleviates pericardial effusion severity in HLTRS patient and mediates β-adrenergic independent effects.
(A) A 17 months old HLTRS patient was treated with propranolol, starting at 0.8 mg/kg/day in three divided doses and increasing gradually every 2–3 weeks to maximum of 4.1 mg/kg/day (red curve). In parallel the volume of ventricular peri-cardial effusion was measured at the end of the diastole (blue curve). (B) Echocardiography revealed that pericardiocentesis was not required anymore after propranolol treatment due to significant reduction in pericardial effusion (pink arrow) which did not recur as of June 2018 (time of the study). (C) Fetal endothelial colony forming cells (ECFC) were isolated from term placenta from healthy donors, expanded for three passages, and subjected to propranolol treatment followed by analysis of survival (percentage) as compared to vehicle control (DMSO). Propranolol affected the survival of ECFC at equivalent doses whereas Atenolol (specific β1 blocker) and ICI118,551 (specific β2) did not. (D) Cell survival assay performed on ISO-HAS angiosarcoma cells after transfection with three different siRNA sequences targeting ADRB2 and following 72 hr incubation with propranolol (racemic mixture). Alamar Blue assay ; Points, mean of at least four independent experiments ; Error bars, standard error. (E) Combination indexes of propranolol and vinblastine in ISO-HAS angiosarcoma cells after transfection with three different siRNA sequences targeting ADRB2 and following 72 hr drug incubation (50uM). Alamar Blue assay ; Bars, mean of at least four independent experiments ; Error bars, standard error. Statistical analysis for C was performed using Mann-Whitney non parametric t-test and for D-E using an unpaired two-tailed t test.
β-adrenergic independent effects of propranolol.
(A and B) β-adrenergic receptor gene expression following 72 hr transfection with siRNA in ISO-HAS angiosarcoma cells (A) and SHEP neuroblastoma cells (B), as determined by qRT-PCR using specific primers for ADRB1 and ADRB2, and compared with YWHAZ as housekeeping gene. (C) Cell viability assay performed by Alamar Blue on SHEP neuroblastoma cells following siRNA transfection and 72 hr drug incubation; Data points, mean of at least four independent experiments; Error bars, standard error. (D) Change in vincristine EC50 (i.e. concentration causing a 50% reduction in cell viability after 72 hr drug incubation) in the presence of 10 or 50 µM propranolol as compared with vincristine alone following transfection of SHEP neuroblastoma cells with either ADRB1, ADRB2 or both siRNA. Bars, mean of at least four independent experiments ; Error bars, standard error. Classic unpaired Student's t test with the following legend: *p<0.05; **p<0,01; ***p<0001.We next investigated the potential of propranolol to exert β-adrenergic independent effects in cancer cell lines and in human endothelial cells (Figure 1C–D). Survival of primary placentally-derived endothelial colony forming cells (ECFC) was measured in presence of increasing concentrations (5–500 μM) of propranolol and specific β1 (Atenolol) and β2 (ICI 118,551) adrenergic-receptor blockers. Results showed that pharmacological inhibition of specific β-adrenergic receptors did not replicate the marked effect propranolol had in the ECFC survival assay (Figure 1C).To further explore β-adrenergic independent effects of propranolol we knocked down ADRB2 in a propranolol-sensitive angiosarcoma cell line (ISO-HAS, Figure 1—figure supplement 1A). The cytotoxic activity of propranolol (Figure 1D) and its enhancement of vinblastine cytotoxicity (Figure 1E) were unaltered when ADRB2 was silenced. These results show that the anti-survival and sensitization to chemotherapy activities of propranolol are independent of β-adrenergic receptor expression. Of note, ADRB1 is expressed at low levels in the angiosarcoma cell line (not shown) but is expressed at higher levels in the SHEP neuroblastoma cell line, where its expression can be reduced by siRNA (Figure 1—figure supplement 1B). Similar results were obtained when using a non-endothelial cell type (SHEP neuroblastoma cell line) whereby knock-down of ADRB1 and ADRB2 alone or in combination did not affect the ability of propranolol to block the proliferative response and its ability to enhance response to chemo-therapies (Figure 1—figure supplement 1C and 1D).
Figure 1—figure supplement 1.
β-adrenergic independent effects of propranolol.
(A and B) β-adrenergic receptor gene expression following 72 hr transfection with siRNA in ISO-HAS angiosarcoma cells (A) and SHEP neuroblastoma cells (B), as determined by qRT-PCR using specific primers for ADRB1 and ADRB2, and compared with YWHAZ as housekeeping gene. (C) Cell viability assay performed by Alamar Blue on SHEP neuroblastoma cells following siRNA transfection and 72 hr drug incubation; Data points, mean of at least four independent experiments; Error bars, standard error. (D) Change in vincristine EC50 (i.e. concentration causing a 50% reduction in cell viability after 72 hr drug incubation) in the presence of 10 or 50 µM propranolol as compared with vincristine alone following transfection of SHEP neuroblastoma cells with either ADRB1, ADRB2 or both siRNA. Bars, mean of at least four independent experiments ; Error bars, standard error. Classic unpaired Student's t test with the following legend: *p<0.05; **p<0,01; ***p<0001.
The observation that adrenergic receptors are not required for the cellular response to propranolol combined with the clinical benefit of propranolol treatment in the context of HLTRS suggests that this FDA approved drug may act by directly modulating SOX18 protein activity .Although SOX18 is involved in a variety of patho-physiological processes (Olbromski et al., 2018), HLTRS is a rare and severe vascular disorder. In order to further investigate propranolol in this disease scenario, we used a mouse model of HLTRS, SOX18 Ragged Opossum (RaOp) (Pennisi et al., 2000; Slee, 1957). This mouse mutant is considered a murine counterpart of human HLTRS syndrome since it displays the same range of cardio-vascular and hair follicle defects and exhibits the same type of dominant-negative mutation in the Sox18 gene (Pennisi et al., 2000; Downes et al., 2009; François et al., 2008; Villani et al., 2017). The Ragged mouse is characterized by pathologic corneal neo-vascularisation (CNV, Figure 2—figure supplement 1A-C) (François and Ramchandran, 2012). This phenotypic hallmark offers an indirect biological readout in vivo for aberrant SOX18 function in the control of vessel outgrowth. Propranolol was tested on CNV in the RaOp mouse model to validate its therapeutic potential. Because of early postnatal onset of HLTRS defects (between postnatal day (P)8–22), oral treatment with propranolol (25 mg/kg/day), or vehicle PBS, was initiated at P8 and continued daily through to P28. Both wild type and mutant littermates were subjected to identical treatment schemes in order to safeguard consistent maternal feeding and grooming.
Figure 2—figure supplement 1.
Time course of the corneal phenotype.
(A) Corneal flat mount from adults (8 weeks old mice) wild type control and RaOp ±animals showing blood vessel invasion. (B) Immunofluorescence further confirms blood (Endomucin, EMCN, blue, ERG, red) and lymphatic (Neuropillin-2, NRP2, green) vessels outgrowth in corneal tissues (8 weeks old mice). (C) Corneal tissues were harvested from mice at different stages, ranging from postnatal day 8 to 16 weeks of age. Penetrance of corneal vessels was analysed by immunofluorescence for vascular endothelial cells markers EMCN, NRP2 and ERG. At early stages (P8–P22), wild type pups have NRP2-positive, EMCN-negative vessels projecting from the sclera into the cornea. This is not observed at later stages. Onset of corneal neo-vessel formation in RaOp mice appears between P22 and 12 weeks. Scale bar whole corneas: 0.5 mm, detail: 0.2 mm.
Treatment with propranolol (21 days) did not affect the gross morphological appearance of either wild type or RaOp pups, nor did it significantly affect the weight of the RaOp animals (Figure 1—figure supplement 2A and B, n = 5–10 mice per group). We did not observe any obvious side effects, consistent with the safety profile of propranolol established over the past decades.
Figure 2—figure supplement 2.
Effects of propranolol on the overall morphology of treated RaOp mice and disruption of SOX18/RBPJ protein-protein interaction.
(A) DBA/2JArc wild type females were crossed with a heterozygous RaOp male (B6D2-RaOp/J) to generate Sox18 mutant pups heterozygous for the Ra allele. RaOp mice have a distinct sparse coat, and are smaller than wild type littermates. Pups were treated daily through oral gavage with vehicle PBS or 25 mg/kg/day propranolol, from P8 until P28. No obvious gross morphological defects were observed in propranolol treated mice compared to vehicle PBS. Scale bar 1 cm. (B) Weight of the mice was recorded daily throughout the time course of the treatment. RaOp weighted less than wild type littermates. Propranolol increased the mean weight of the wild type mice, but not of RaOp mice. (C) The bar graph represents ALPHAScreen signals as a measure of the protein-protein interaction between SOX18 and RBPJ (NOTCH signaling effector) transcription factors. Control conditions (ctrl and DMSO ctrl) show the reference signal for SOX18/RBPJ interaction, results are shown as a fold response compared to control. Upon addition of SOX18 small molecule inhibitor Sm4, PPI is disrupted at 50 μM, whereas propranolol showed efficacy from 5 μM. Experiments were performed in three independent replicates. **** padj ≤1e-4, 2way ANOVA Tukey multiple comparisons. Data shown is mean ± SEM, n-number is indicated in graph.
Propranolol treatment of RaOp mice, however, led to an almost complete rescue of the CNV phenotype (Figure 2A). The corneas from propranolol-treated mutant animals were devoid of blood vessels (Figure 2A, Endomucin- and ERG-positive cells) in five out of five mice, and one mutant pup only had a mild penetration of blood vessels into the cornea (Figure 2A). These pre-clinical data indicate that propranolol treatment is an effective therapeutic strategy to block aberrant vessel growth in a mouse model of HLTRS and is indicative of on-target engagement on SOX18 protein in vivo.
Figure 2.
Propranolol rescues corneal neo-vascularization phenotype in a mouse pre-clinical model of HLTRS and SOX18 dominant-negative transcriptional repression via protein-protein interaction disruption.
(A) Fluorescent images of corneal flat mounts, showing blood vessel penetration into the cornea at P28 stage using endothelial cell markers ERG and endomucin (EMCN). Sox18 WT and RaOp mice were treated from P8 to P28 with either vehicle PBS or propranolol. Propranolol has no obvious effect on WT cornea, but prevents CNV in RaOp pups. Number of predominant phenotype shown in bottom right. Scale bar left 500 µm, right 100 µm. (B) COS-7 cells were transfected with SOX18 responsive Vcam1:luciferase construct and a combination of Sox18 wild type plasmid DNA and RaOp plasmid DNA. RaOp behaves in a dominant negative fashion and is capable to inhibit SOX18 WT function even at low 30:1 (w/w DNA) allelic ratios. Addition of propranolol to the media rescues SOX18 dependent activity of the Vcam1 promoter in presence of RaOp. Effect is concentration dependent and normal SOX18 activity on this construct is achieved at 15 µM propranolol. Sox18. *** p-value≤0.001, Kruskal-Wallis multiple comparison test. Data shown is mean ± SD of n ≥ 8. (C) The bar graph shows ALPHAScreen signal as a measure of the level of protein-protein interaction between SOX18 and its mutant counterpart RaOp (red square) and SOX18 homodimer formation (blue dot) in absence or presence of propranolol treatment. Propranolol is a small compound with the ability to disrupt SOX18 self-recruitment. Statistical analysis in 2B one-way ANOVA with Bonferroni post-hoc test and in 2C ANOVA Sidak’s multiple comparison test. Analysis of the protein pair by ALPHAScreen assay was performed in three different biological experiment with three technical replicates.
(A) Corneal flat mount from adults (8 weeks old mice) wild type control and RaOp ±animals showing blood vessel invasion. (B) Immunofluorescence further confirms blood (Endomucin, EMCN, blue, ERG, red) and lymphatic (Neuropillin-2, NRP2, green) vessels outgrowth in corneal tissues (8 weeks old mice). (C) Corneal tissues were harvested from mice at different stages, ranging from postnatal day 8 to 16 weeks of age. Penetrance of corneal vessels was analysed by immunofluorescence for vascular endothelial cells markers EMCN, NRP2 and ERG. At early stages (P8–P22), wild type pups have NRP2-positive, EMCN-negative vessels projecting from the sclera into the cornea. This is not observed at later stages. Onset of corneal neo-vessel formation in RaOp mice appears between P22 and 12 weeks. Scale bar whole corneas: 0.5 mm, detail: 0.2 mm.
(A) DBA/2JArc wild type females were crossed with a heterozygous RaOp male (B6D2-RaOp/J) to generate Sox18 mutant pups heterozygous for the Ra allele. RaOp mice have a distinct sparse coat, and are smaller than wild type littermates. Pups were treated daily through oral gavage with vehicle PBS or 25 mg/kg/day propranolol, from P8 until P28. No obvious gross morphological defects were observed in propranolol treated mice compared to vehicle PBS. Scale bar 1 cm. (B) Weight of the mice was recorded daily throughout the time course of the treatment. RaOp weighted less than wild type littermates. Propranolol increased the mean weight of the wild type mice, but not of RaOp mice. (C) The bar graph represents ALPHAScreen signals as a measure of the protein-protein interaction between SOX18 and RBPJ (NOTCH signaling effector) transcription factors. Control conditions (ctrl and DMSO ctrl) show the reference signal for SOX18/RBPJ interaction, results are shown as a fold response compared to control. Upon addition of SOX18 small molecule inhibitor Sm4, PPI is disrupted at 50 μM, whereas propranolol showed efficacy from 5 μM. Experiments were performed in three independent replicates. **** padj ≤1e-4, 2way ANOVA Tukey multiple comparisons. Data shown is mean ± SEM, n-number is indicated in graph.
Propranolol rescues corneal neo-vascularization phenotype in a mouse pre-clinical model of HLTRS and SOX18 dominant-negative transcriptional repression via protein-protein interaction disruption.
(A) Fluorescent images of corneal flat mounts, showing blood vessel penetration into the cornea at P28 stage using endothelial cell markers ERG and endomucin (EMCN). Sox18 WT and RaOp mice were treated from P8 to P28 with either vehicle PBS or propranolol. Propranolol has no obvious effect on WT cornea, but prevents CNV in RaOp pups. Number of predominant phenotype shown in bottom right. Scale bar left 500 µm, right 100 µm. (B) COS-7 cells were transfected with SOX18 responsive Vcam1:luciferase construct and a combination of Sox18 wild type plasmid DNA and RaOp plasmid DNA. RaOp behaves in a dominant negative fashion and is capable to inhibit SOX18 WT function even at low 30:1 (w/w DNA) allelic ratios. Addition of propranolol to the media rescues SOX18 dependent activity of the Vcam1 promoter in presence of RaOp. Effect is concentration dependent and normal SOX18 activity on this construct is achieved at 15 µM propranolol. Sox18. *** p-value≤0.001, Kruskal-Wallis multiple comparison test. Data shown is mean ± SD of n ≥ 8. (C) The bar graph shows ALPHAScreen signal as a measure of the level of protein-protein interaction between SOX18 and its mutant counterpart RaOp (red square) and SOX18 homodimer formation (blue dot) in absence or presence of propranolol treatment. Propranolol is a small compound with the ability to disrupt SOX18 self-recruitment. Statistical analysis in 2B one-way ANOVA with Bonferroni post-hoc test and in 2C ANOVA Sidak’s multiple comparison test. Analysis of the protein pair by ALPHAScreen assay was performed in three different biological experiment with three technical replicates.
Time course of the corneal phenotype.
(A) Corneal flat mount from adults (8 weeks old mice) wild type control and RaOp ±animals showing blood vessel invasion. (B) Immunofluorescence further confirms blood (Endomucin, EMCN, blue, ERG, red) and lymphatic (Neuropillin-2, NRP2, green) vessels outgrowth in corneal tissues (8 weeks old mice). (C) Corneal tissues were harvested from mice at different stages, ranging from postnatal day 8 to 16 weeks of age. Penetrance of corneal vessels was analysed by immunofluorescence for vascular endothelial cells markers EMCN, NRP2 and ERG. At early stages (P8–P22), wild type pups have NRP2-positive, EMCN-negative vessels projecting from the sclera into the cornea. This is not observed at later stages. Onset of corneal neo-vessel formation in RaOp mice appears between P22 and 12 weeks. Scale bar whole corneas: 0.5 mm, detail: 0.2 mm.
Effects of propranolol on the overall morphology of treated RaOp mice and disruption of SOX18/RBPJ protein-protein interaction.
(A) DBA/2JArc wild type females were crossed with a heterozygous RaOp male (B6D2-RaOp/J) to generate Sox18 mutant pups heterozygous for the Ra allele. RaOp mice have a distinct sparse coat, and are smaller than wild type littermates. Pups were treated daily through oral gavage with vehicle PBS or 25 mg/kg/day propranolol, from P8 until P28. No obvious gross morphological defects were observed in propranolol treated mice compared to vehicle PBS. Scale bar 1 cm. (B) Weight of the mice was recorded daily throughout the time course of the treatment. RaOp weighted less than wild type littermates. Propranolol increased the mean weight of the wild type mice, but not of RaOp mice. (C) The bar graph represents ALPHAScreen signals as a measure of the protein-protein interaction between SOX18 and RBPJ (NOTCH signaling effector) transcription factors. Control conditions (ctrl and DMSO ctrl) show the reference signal for SOX18/RBPJ interaction, results are shown as a fold response compared to control. Upon addition of SOX18 small molecule inhibitor Sm4, PPI is disrupted at 50 μM, whereas propranolol showed efficacy from 5 μM. Experiments were performed in three independent replicates. **** padj ≤1e-4, 2way ANOVA Tukey multiple comparisons. Data shown is mean ± SEM, n-number is indicated in graph.These in vivo data prompted us to assess the transcriptional activity of Sox18 in presence of propranolol. Sox18 was overexpressed in COS-7 cells, along with a synthetic construct containing a luciferase reporter gene fused to the Vcam1 promoter fragment, a direct target of Sox18 (Hosking et al., 2004). In this assay, we interfere with wild type Sox18 function using the RaOp dominant-negative protein. We found that RaOp completely abolished the activity of the wild type protein at ratios as low as 1:30 RaOp:Sox18 WT (Figure 2B). We next tested whether propranolol could rescue the dominant-negative inhibitory effect of RaOp reproduced in this cell-based system. Propranolol restored SOX18 wild type functionality in a dose-dependent manner; it significantly increased Vcam1 reporter promoter activity to base line levels at 15 µM (p-value≤0.001) (Figure 2B).Lastly, to demonstrate the molecular mode of action of propranolol on SOX18 protein partner recruitment, we used an ALPHAScreen assay to measure pairwise protein-protein interaction (PPI). SOX18 homodimer and SOX18/RaOp (Q161*) heterodimer formation was measured in absence or presence of propranolol (Figure 2C). Propranolol showed a mild efficacy at disrupting SOX18 homodimer and was able to interfere more effectively with the assembly of the non functional SOX18/RaOp protein complex. An effector of the NOTCH signaling pathway (RBPJ) was recently shown to act as a SOX18 protein partner (Overman et al., 2017; Fontaine et al., 2017). In addition to disrupting SOX18 homodimer assembly (Figure 2C), we found that propranolol inhibits the association of SOX18 with RBPJ at low micro-molar range (5 μM) (Figure 2—figure supplement 2C). Taken together these in vivo pre-clinical data and in vitro results strongly suggest that one mechanism by which propranolol mediates its anti-angiogenic effects is via direct interference with a SOX18-dependent transcriptional activation.We have previously identified, developed and validated a small compound, Sm4, that disrupts SOX18 homodimer formation in turn affecting SOX18 ability to recruit RBPJ. Further, we have shown potential therapeutic applications in managing vascular over-growth in pre-clinical model of breast cancer metastasis (Overman et al., 2017). When using Sm4 as a reference, propranolol was equally effective at disrupting SOX18/RBPJ PPI however not as effective at blocking SOX18 homodimer formation (Figure 2—figure supplement 2C). Altogether, these results suggest that the same molecular mode of action of propranolol accounts for both the rescue of dominant-negative SOX18 loss of function by disruption of the non-functional SOX18/RaOp (Q161*) complex, and the disruption of functional SOX18 wild type PPIs, namely SOX18/RBPJ and SOX18/SOX18 dimers. In the context of the Ragged heterozygous mutation dominant negative mutation, the rescue process corresponds to the inhibition by propranolol of an inhibitor (RaOp) which in turn results to the partial restoration of the SOX18 wild type active form.This novel mode of action of propranolol, independent of its anti-adrenergic effects, prompted us to examine its mechanism of action in infantile hemangiomas, the most common vascular tumor in infancy. Although the molecular mode of action of propranolol in infantile hemangioma therapy is largely unknown, it is the mainstay of treatment for infantile hemangioma. (Léauté-Labrèze et al., 2008; Léauté-Labrèze et al., 2015a; Léauté-Labrèze et al., 2015b) A variety of propranolol-induced cellular effects have been observed in infantile hemangioma-derived stem cells (HemSCs), hemangioma endothelial cells (HemECs) and hemangioma pericytes (Lamy et al., 2010; Lee et al., 2014; Tu et al., 2013; Wong et al., 2012). To learn if SOX18 is involved, we first explored the expression of SOX18 in vivo in hemangioma tissue sections from three patients and in vitro in different cell populations derived from infantile hemangiomas: SOX18 protein was observed in a sup-population of CD31-positive endothelial cells (Figure 3A, arrows) and SOX18 mRNA was expressed in ECFC (positive control) and in HemEC, whereas HemSC showed low expression and hemangioma pericytes were completely devoid of SOX18 transcripts (Figure 3—figure supplement 1).
Figure 3.
The R(+) enantiomer of propranolol and SOX18 small molecule inhibitor halt infantile hemangioma stem cell differentiation.
(A) Infantile) hemangioma tissue section stained for SOX18 (red), Ki67 (green), CD31 (orange), D2-40 (pink) and DAPI (blue) reveals the presence of SOX18 expression in a large subset of hemangioma endothelial cells (arrows). (B) Schematic representation of infantile hemangioma stem cell (HemSC) endothelial differentiation assay. VEGF-B stimulates HemSC to differentiate into hemangioma endothelial cells (HemEC). This differentiation process is inhibited by propranolol, the R(+) enantiomer of propranolol, and by SOX18 small molecule inhibitor Sm4 (all at 5 uM). (C) VEGF-B treatment of HemSC from four different infantile hemangiomas resulted in increased CDH5 (an endothelial cell marker), SOX18 and ADBR2 (β2 adrenergic receptor) mRNA. Means and standard deviations are shown. (D) The effects of SOX18 inhibitor Sm4, its scaffold aspirin as a negative control, propranolol and its purified R(+) and S(-) enantiomers on HemSC-to-HemEC differentiation from two infantile hemangioma patients. Endothelial differentiation markers, CD31 and CDH5 and hemangioma endothelial markers NOTCH1, PLXND1 and VEGFR1 under each treatment condition in four biological replicates, determined by qPCR, were standardized as described (Willems et al., 2008). Means and standard deviations are shown. Statistical analysis in 3C and 3D was done using one-way ANOVA, Fisher Tests, and two-tailed two independent sample T-Tests.
Human ECFC served as a positive control for SOX18. Hemangioma-derived GLUT1-negative ECs, HemSC, GLUT1-positively selected ECs, and pericytes were analysed for SOX18 mRNA expression by qPCR analysis.
(A) VEGF-B treatment of HemSC from four different infantile hemangiomas resulted in increased CD31 and CDH5 (endothelial cell markers), and hemangioma endothelial markers NOTCH1, PLXND1 and VEGFR1, determined by qPCR. Inclusion of SOX18 inhibitor (Sm4) or propranolol blocked the VEGF-B induced increases in these markers. Results from eight biological replicates were standardized as described (Willems et al., 2008). Means and standard deviations are shown. All P values were < 0.001 for Control versus DMSO (VEGF-B treated); DMSO versus Sm4 and DMSO versus propranolol. (B–D) VEGFR2 protein and phosphorylation were not affected by pre-treatment with propranolol, R + enantiomer or S(-) enantiomer (each tested at 5 uM). (B) Human endothelial colony forming cells (ECFC) were pre-treated for one hour with drug as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, lysed and analysed by Western blotting. (C) HemSC were induced to differentiate for 5 days with VEGF-B; control indicates cells in differentiation media without VEGF-B. Differentiated cells were pre-treated for one hour with drugs as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, and lysed for VEGFR2 Western blotting. (D) HemSCs were treated as in B, cell lysates were immunoprecipitated with anti-VEGFR2, followed by Western blotting for phosphorylated VEGFR2 and total VEGFR2. B-D, M indicates lane with molecular weight standards.
Fluorescent images of corneal flat mounts, showing blood vessel penetration into the cornea at P28 stage using endothelial cell markers endomucin (EMCN). Sox18 WT and RaOp mice were treated from P8 to P28 with either vehicle PBS or propranolol or R-enantiomer or the S-enantiomer at 25 mg/Kg/day. Propranolol has no obvious effect on WT cornea, but prevents CNV in RaOp pups. Number of predominant phenotype shown in bottom right.
Ear whole mount immunofluorescence for Podoplanin (white), ERG (red) and CD31 (green) was performed after wild type and RaOp mutant animals were treated by propranolol, S(-) and R (+)enantiomer (P1-P28 at 25 mg/kg/day). Quantification of the number of valves in pre-collector and collector vessels, LEC vessel density and LEC cell number showed that none of the drug treatment was efficient to mitigate the RaOp phenotype. n = 3–6 animal per genotypes and drug treatment.
Figure 3—figure supplement 1.
SOX18 expression in infantile hemangioma-derived cells.
Human ECFC served as a positive control for SOX18. Hemangioma-derived GLUT1-negative ECs, HemSC, GLUT1-positively selected ECs, and pericytes were analysed for SOX18 mRNA expression by qPCR analysis.
The R(+) enantiomer of propranolol and SOX18 small molecule inhibitor halt infantile hemangioma stem cell differentiation.
(A) Infantile) hemangioma tissue section stained for SOX18 (red), Ki67 (green), CD31 (orange), D2-40 (pink) and DAPI (blue) reveals the presence of SOX18 expression in a large subset of hemangioma endothelial cells (arrows). (B) Schematic representation of infantile hemangioma stem cell (HemSC) endothelial differentiation assay. VEGF-B stimulates HemSC to differentiate into hemangioma endothelial cells (HemEC). This differentiation process is inhibited by propranolol, the R(+) enantiomer of propranolol, and by SOX18 small molecule inhibitor Sm4 (all at 5 uM). (C) VEGF-B treatment of HemSC from four different infantile hemangiomas resulted in increased CDH5 (an endothelial cell marker), SOX18 and ADBR2 (β2 adrenergic receptor) mRNA. Means and standard deviations are shown. (D) The effects of SOX18 inhibitor Sm4, its scaffold aspirin as a negative control, propranolol and its purified R(+) and S(-) enantiomers on HemSC-to-HemEC differentiation from two infantile hemangioma patients. Endothelial differentiation markers, CD31 and CDH5 and hemangioma endothelial markers NOTCH1, PLXND1 and VEGFR1 under each treatment condition in four biological replicates, determined by qPCR, were standardized as described (Willems et al., 2008). Means and standard deviations are shown. Statistical analysis in 3C and 3D was done using one-way ANOVA, Fisher Tests, and two-tailed two independent sample T-Tests.
SOX18 expression in infantile hemangioma-derived cells.
Human ECFC served as a positive control for SOX18. Hemangioma-derived GLUT1-negative ECs, HemSC, GLUT1-positively selected ECs, and pericytes were analysed for SOX18 mRNA expression by qPCR analysis.
SOX18 inhibitor (Sm4) and propranolol block HemSC to EC differentiation.
(A) VEGF-B treatment of HemSC from four different infantile hemangiomas resulted in increased CD31 and CDH5 (endothelial cell markers), and hemangioma endothelial markers NOTCH1, PLXND1 and VEGFR1, determined by qPCR. Inclusion of SOX18 inhibitor (Sm4) or propranolol blocked the VEGF-B induced increases in these markers. Results from eight biological replicates were standardized as described (Willems et al., 2008). Means and standard deviations are shown. All P values were < 0.001 for Control versus DMSO (VEGF-B treated); DMSO versus Sm4 and DMSO versus propranolol. (B–D) VEGFR2 protein and phosphorylation were not affected by pre-treatment with propranolol, R + enantiomer or S(-) enantiomer (each tested at 5 uM). (B) Human endothelial colony forming cells (ECFC) were pre-treated for one hour with drug as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, lysed and analysed by Western blotting. (C) HemSC were induced to differentiate for 5 days with VEGF-B; control indicates cells in differentiation media without VEGF-B. Differentiated cells were pre-treated for one hour with drugs as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, and lysed for VEGFR2 Western blotting. (D) HemSCs were treated as in B, cell lysates were immunoprecipitated with anti-VEGFR2, followed by Western blotting for phosphorylated VEGFR2 and total VEGFR2. B-D, M indicates lane with molecular weight standards.
The racemic mixture Propranolol and its enantiomer (R(+) and S(-)) rescues corneal neo-vascularization phenotype in a mouse pre-clinical model of HLTRS.
Fluorescent images of corneal flat mounts, showing blood vessel penetration into the cornea at P28 stage using endothelial cell markers endomucin (EMCN). Sox18 WT and RaOp mice were treated from P8 to P28 with either vehicle PBS or propranolol or R-enantiomer or the S-enantiomer at 25 mg/Kg/day. Propranolol has no obvious effect on WT cornea, but prevents CNV in RaOp pups. Number of predominant phenotype shown in bottom right.
Propranolol and its R(+) and S(-) enantiomers do not rescue the dermal lymphatic vascular phenotype of the Ragged Opossum mutant mouse model.
Ear whole mount immunofluorescence for Podoplanin (white), ERG (red) and CD31 (green) was performed after wild type and RaOp mutant animals were treated by propranolol, S(-) and R (+)enantiomer (P1-P28 at 25 mg/kg/day). Quantification of the number of valves in pre-collector and collector vessels, LEC vessel density and LEC cell number showed that none of the drug treatment was efficient to mitigate the RaOp phenotype. n = 3–6 animal per genotypes and drug treatment.To interrogate whether propranolol inhibits SOX18 in this setting (Figure 3B), we induced patient derived HemSCs to differentiate into HemECs using VEGF-B and low serum media (Khan et al., 2008). CDH5 (a pan-endothelial marker), SOX18, and ADBR2 mRNAs were increased in VEGF-B-treated HemSC (Figure 3C) further showing a process by which differentiation of stem cells results in endothelial cells expressing SOX18. This was extended to other genes such as CD31, NOTCH1, PLXND1 and VEGFR1 (Table 1 and Figure 3—source data 1), each of which are expressed in infantile hemangioma endothelium in vivo (Boscolo et al., 2011; Nakayama et al., 2015; Wu et al., 2010), further confirming the successful differentiation of HemSCs into HemECs (Figure 3D and Figure 3—figure supplement 2A). Using this differentiation assay as a read-out, we next evaluated the capacity of propranolol to inhibit the differentiation of HemSCs isolated from four infantile hemangioma patients. The pharmacologic treatments of HemSC included: propranolol, Sm4 (SOX18 small molecule inhibitor), aspirin (a negative control [Overman et al., 2017; Fontaine et al., 2017]) compared to vehicle control. Of note, SOX18 has been shown to directly up-regulate Notch1 transcription via an intronic enhancer during arterial specification in vertebrates (Chiang et al., 2017), hence transcriptional output of this target gene indirectly reflects SOX18 activity. Propranolol significantly decreased VEGF-B induced expression of all five endothelial markers in HemSC to levels also achieved by Sm4 as compared to controls (see p-values in Figure 3—source data 1).
Table 1.
qPCR primer sequences.
Gene
Forward primer
Reverse primer
CD31
CACCTGGCCCAGGAGTTTC
AGTACACAGCCTTGTTGCCATGT
CDH5
CCTTGGGTCCTGAAGTGACCT
AGGGCCTTGCCTTCTGCAA
PLXND1
CAAGTTTGAGCAGGTGGTGGCTTT
ATTTCCCAGTCTGAGTCACAGGCA
NOTCH1
CGGTGAGACCTGCCTGAATG
GCATTGTCCAGGGGTGTCAG
VEGFR1
CTCAAGCAAACCACACTGGC
CGAGCTCCCTTCCTTCAGTC
SOX18_2
GTGTGGGCAAAGGACGAG
AGCTCCTTCCACGCTTTG
ADBR2
CACCAACTACTTCATCACTTCAC
GACACAATCCACACCATCAG
ATP5B
CCACTACCAAGAAGGGATCTATCA
GGGCAGGGTCAGTCAAGTC
Figure 3—figure supplement 2.
SOX18 inhibitor (Sm4) and propranolol block HemSC to EC differentiation.
(A) VEGF-B treatment of HemSC from four different infantile hemangiomas resulted in increased CD31 and CDH5 (endothelial cell markers), and hemangioma endothelial markers NOTCH1, PLXND1 and VEGFR1, determined by qPCR. Inclusion of SOX18 inhibitor (Sm4) or propranolol blocked the VEGF-B induced increases in these markers. Results from eight biological replicates were standardized as described (Willems et al., 2008). Means and standard deviations are shown. All P values were < 0.001 for Control versus DMSO (VEGF-B treated); DMSO versus Sm4 and DMSO versus propranolol. (B–D) VEGFR2 protein and phosphorylation were not affected by pre-treatment with propranolol, R + enantiomer or S(-) enantiomer (each tested at 5 uM). (B) Human endothelial colony forming cells (ECFC) were pre-treated for one hour with drug as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, lysed and analysed by Western blotting. (C) HemSC were induced to differentiate for 5 days with VEGF-B; control indicates cells in differentiation media without VEGF-B. Differentiated cells were pre-treated for one hour with drugs as indicated, stimulated with 25 ng/ml VEGF-A for 5 min, and lysed for VEGFR2 Western blotting. (D) HemSCs were treated as in B, cell lysates were immunoprecipitated with anti-VEGFR2, followed by Western blotting for phosphorylated VEGFR2 and total VEGFR2. B-D, M indicates lane with molecular weight standards.
Propranolol exists as a 1:1 mixture of the S(-) and R(+) enantiomers. The S(-) form displays potent anti-β-adrenergic activity whereas the R(+) enantiomer presents strongly reduced antagonist activity towards β2 adrenergic receptors on peripheral arteries (Stoschitzky et al., 1995). To test whether HemSC were affected by propranolol in a stereoselective manner, we assessed VEGF-B-induced HemSC to HemEC differentiation from two infantile hemangioma in the presence of separated enantiomers.The R(+) enantiomer recapitulated propranolol and Sm4-induced inhibition on all markers, whereas the S(-) enantiomer showed only weak or no inhibition on hemangioma markers (Figure 3D and Figure 3—source data 1). These results are consistent with a SOX18-dependent, β-adrenergic receptor independent blockade of hemangioma endothelial differentiation, which strongly suggests that blockade of SOX18 activity is the main mode of action of propranolol in this setting. Further, analysis of VEGF-R2 expression and phosphorylation levels in ECFC and HemSC to EC differentiation assay ruled out that the propranolol racemic mixture, the R(+) enantiomer or Sm4 interfere with the VEGF signaling pathway (Figure 3—figure supplement 2B-D).As a final demonstration of the therapeutic utility of the R(+) enantiomer we performed a corneal neo-vascularisation rescue assay using the Ragged Opossum mutant mouse model. In this in vivo setting both propranolol and the R(+) enantiomer prevented aberrant vessel growth in the corneal tissue of the heterozygous mutant animals. Of note the S(-) enantiomer was also active at disrupting corneal vessel outgrowth, suggesting that conformational changes that occur in the SOX18 mutated protein may attenuate the discrepancy in enantiomeric activities previously observed in the hemangioma endothelial differentiation model (Figure 3—figure supplement 3).
Figure 3—figure supplement 3.
The racemic mixture Propranolol and its enantiomer (R(+) and S(-)) rescues corneal neo-vascularization phenotype in a mouse pre-clinical model of HLTRS.
Fluorescent images of corneal flat mounts, showing blood vessel penetration into the cornea at P28 stage using endothelial cell markers endomucin (EMCN). Sox18 WT and RaOp mice were treated from P8 to P28 with either vehicle PBS or propranolol or R-enantiomer or the S-enantiomer at 25 mg/Kg/day. Propranolol has no obvious effect on WT cornea, but prevents CNV in RaOp pups. Number of predominant phenotype shown in bottom right.
In order to investigate whether propranolol treatment might improve the morphogenesis defects of other vascular beds, we analysed the patterning of the lymphatic vasculature in the ear skin tissue of the adult RaOp animals. As previously reported the RaOp mouse presented with a highly disorganized lymphatic vascular network (François et al., 2008) (Figure 3—figure supplement 4, top graph). In the skin, neither the propranolol racemic mixture nor its enantiomers rescued the lymphatic vascular phenotype caused by the RaOp mutation (Figure 3—figure supplement 4); this is most likely due to the post-natal timing of the treatment: lymphatic vascular defects are acquired in the RaOp mutant during the initial steps of embryonic lymphangiogenesis (early to mid-organogenesis), which precedes the drug treatment window.
Figure 3—figure supplement 4.
Propranolol and its R(+) and S(-) enantiomers do not rescue the dermal lymphatic vascular phenotype of the Ragged Opossum mutant mouse model.
Ear whole mount immunofluorescence for Podoplanin (white), ERG (red) and CD31 (green) was performed after wild type and RaOp mutant animals were treated by propranolol, S(-) and R (+)enantiomer (P1-P28 at 25 mg/kg/day). Quantification of the number of valves in pre-collector and collector vessels, LEC vessel density and LEC cell number showed that none of the drug treatment was efficient to mitigate the RaOp phenotype. n = 3–6 animal per genotypes and drug treatment.
In summary, we suggest the R(+) enantiomer of propranolol is a potent selective inhibitor of SOX18 activity and it is sufficient to achieve the effects of propranolol racemic mixture in the context of infantile hemangioma and other SOX18-dependent vascular diseases.
Discussion
Despite being the front line therapy for infantile hemangioma, approximately 20% of the patient population fails to respond to propranolol treatment and/or experience tumor regrowth when the medication is discontinued too early (Bagazgoitia et al., 2011; Xiao et al., 2013). Our finding opens up new treatment options using enantiopure R(+) propranolol instead of the racemic mixture. This could potentially allow a dose adjustment to achieve optimal benefit for the patients while mitigating adverse events that may result from long-term propranolol treatment, particularly in the refractory population of patients that currently do not respond to the highest dose of propranolol. In addition, the side effects associated with long-term exposure to propranolol could be greatly reduced if β-adrenergic receptors blockage would be minimized.This discovery is of broad interest because propranolol, comprised of 2 enantiomers, has been used clinically for decades. Clinical trials of the R(+) versus the S(-) form have been performed and deemed safe with full toxicology data available (Stensrud and Sjaastad, 1976). Pharmacokinetic studies suggest that propranolol therapy results in an accumulation of the S(-) enantiomer following drug metabolism, which could be problematic if one is interested in the activity of the R(+) form (Mehvar and Brocks, 2001). Indeed toxicology studies further suggest that propranolol in its racemic form is more toxic than either enantiomer alone (Stoschitzky et al., 1992). This study presents indirect evidence that in a HLTRS patient treated with propranolol, SOX18 wild type function is at least partly restored. The observation that the S(-) enantiomer also has the capability to rescue the corneal neo-vascularisation phenotype in a pre-clinical model of HTLRS suggests that the effects of propranolol as a racemic mixture are likely to be a combination of the blockade of beta-adrenergic receptor activity and SOX18 RaOp mutant protein inhibition. Of importance, in the hemangioma HemSC-EC differentiation assay the R(+) enantiomer was as efficient as propranolol and more efficient than the S (-) enantiomer at blocking this differentiation process. This may suggest that the SOX18 wild type protein blockade displays some enantio-selectivity, whereas conformational changes in the SOX18/RaOp complex caused by the RaOp mutation sensitize the dominant-negative protein complex to both R(+) and S(-) enantiomers.The studies in human patients with HLTRS and the murine RaOP model suggest that there may be critical time windows in which treatment with R(+) propranolol would be most efficient as an anti-angiogenic compound via a blockade of SOX18 transcriptional activity.The low number of patients with HLTRS – less than 10 documented survivors have been reported – makes it difficult to establish genotype-phenotype relationships in greater detail. In contrast, the unambiguous phenotypic rescue by propranolol racemic mixture in two human patients and by the R(+) enantiomer in the Ragged Opossum mouse model is strongly supported by our in vitro mechanistic results. Our findings outline that the R(+) enantiomer is a SOX18 small molecule inhibitor with weak anti-beta adrenergic activity whereas the S(-) molecule is both a beta-blocker and a weak SOX18 inhibitor which introduces variability in net efficacy of propranolol treatment.The strong monogenic effect of human SOX18 mutations and their rescue with propranolol allowed us to identify its mode of action. We suggest the dosing and duration of propranolol therapy may be adjusted by using R(+) propranolol in potential future trials of HLTRS and infantile hemangioma.
Materials and methods
Hemangioma cell isolation and culture
Specimens of infantile hemangioma were obtained under an IRB-protocol approved by the Committee on Clinical Investigation, Boston Children’s Hospital. The clinical diagnosis was confirmed in the Department of Pathology. Informed consent was obtained for the specimens, according to the Declaration of Helsinki. Single cell suspensions were prepared from the proliferating phase hemangioma specimens and HemSCs were selected and expanded as described (Khan et al., 2008; JCI).HemSC were seeded on fibronectin (10 ng/cm2, EMD Millipore, Billerica, MA)-coated plates at a density of 20,000 cells/cm2. The culture medium was composed of Endothelial Growth Medium-2 (EGM-2), which includes Endothelial Basal Medium (EBM2, Lonza, Allendale, NJ) supplemented to 10% FBS, Endothelial Growth Media-2 SingleQuots (Lonza), and 1X GPS (Mediatech Inc, Manassas,VA, 100 U/milliliter (mL) penicillin, 100 μg/mL streptomycin, 292 μg/mL Glutamine). Cells were cultured at 37°C in a humidified incubator with 5% CO2.To induce HemSC to undergo endothelial differentiation, HemSCs were seeded on fibronectin-coated plates at a density of 20,000 cells/cm2 in EBM2/10%FBS. After 18–24 hr, the medium was replaced with serum-free EBM-2 containing 10 ng/ml VEGF-B (R&D Systems), 1 × insulin transferrin-selenium, 1:5000 linoleic acid–albumin, 1 μM dexamethasone, 60 μM ascorbic acid–2–phosphate. Cells were cultured in the VEGF-B, serum-free media,±indicated drugs for 5–8 days. ((±)-Propranolol hydrochloride (Sigma-Aldrich Cat# P0884), (R)-(+)-Propranolol hydrochloride (Sigma-Aldrich Cat# P0689), and (S)-(−)-Propranolol hydrochloride (Sigma-Aldrich) Cat# P8688).Total cellular RNA was extracted from HemSCs with an RNeasy Micro extraction kit (Qiagen, Valencia, CA, #74004). Reverse transcriptase reactions were performed using an iScript cDNA Synthesis Kit (Bio-Rad, CA, USA #170–8890). qPCR was performed using Kapa Sybr Fast ABI Prism 2x qPCR Master Mix (KAPA BioSystems, MA, USA # KK4604). Amplification was carried out in an ABI 7500 (Applied Biosystems, Foster City, CA). A standard curve for each gene was generated to determine amplification efficiency. ATP5B was used as housekeeping gene expression reference. Fold increases in gene expression were calculated according to two delta CT method, with each amplification reaction performed in triplicate.
Angiosarcoma cell culture
ISO-HAS angiosarcoma cells were kindly provided by Prof Masuzawa [Masuzawa, Int J Cancer 1999] and SHEP neuroblastoma cells were obtained from the Children’s Cancer Institute Australia (Sydney, Australia). Both cell lines were grown in DMEM supplemented with 10% FCS, 2 mM L-glutamine and 1% penicillin streptomycin, and kept in culture at 37°C in a humidified atmosphere containing 5% CO2. Cell lines were regularly screened and are free from mycoplasma contamination.
Gene silencing
ISO-HAS and SHEP cells were transfected with Lipofectamine RNAiMax (Life Technologies) and 5 nM Silencer Select siRNA sequences targeting ADRB1 and/or ADRB2 (Ambion, Life Technologies). A non-silencing control siRNA, which has no sequence homology to any known human gene sequence, was used as a negative control.
Quantitative RT-PCR
The expression of adrenergic receptor genes ADRB1 and ADRB2 was examined in angiosarcoma and neuroblastoma cell lines following siRNA transfection using real-time quantitative RT-PCR. Total RNA was extracted using the Qiagen Mini RNeasy kit (Qiagen, Courtaboeuf, France) and RNA concentration was determined from the absorbance at 260 nm. cDNA synthesis was performed using the Quantitect Reverse Transcription kit (Qiagen). Real time PCR was run on a LightCycler 480 (Roche, Boulogne-Billancourt, France) for ADRB1 and ADRB2 using DNA primer sequences previously described (Cao et al., 2010) and endogenous control gene YWHAZ. Gene expression levels were determined using the ΔΔCt method, normalized to the YWHAZ control gene.
Cell viability assay
Cell viability assays on angiosarcoma and neuroblastoma cell lines were performed as previously described (Pasquier et al., 2013). After 72 hr drug incubation, metabolic activity was detected by addition of Alamar blue and spectrophotometric analysis. Cell viability was determined and expressed as a percentage of untreated control cells. The determination of EC50 values was performed using GraphPad Prism software (GraphPad Sofware Inc, La Jolla, CA, USA). Combination indexes (CI) were calculated for all tested drug concentrations according to the Chou and Talalay method (Chou and Talalay, 1984).Statistics qPCR data from different HemSC-to EC differentiation were standardized as described Willems (51). Data were analyzed by one-way ANOVA, Fisher Tests, and two-tailed two independent sample T-Tests. Statistical programs were from Excel and XLStat Pro.
CNV model
All procedures involving mice were approved by the University of Queensland Animal Ethics Committee. Heterozygous RaOp pups were produced by crossing DBA/2JArc wild type females (purchased from the Animal Resource Centre) with a B6D2-RaOp/J heterozygous male (purchased from the Jackson Laboratory).For the treatment of with propranolol, entire litters were exposed to identical treatment conditions, being either Propranolol or PBS vehicle and data shown is from three different litters per condition. Propranolol was dissolved in PBS (20 mg/ml) and orally administered at 25 mg/kg/day (l μl per gram of bodyweight per day) starting at postnatal day eight through to P28. Pups were sacrificed (CO2) 2 hr after their last dose on P28, blood plasma was collected through cardiac puncture and the pictures were captured for gross morphological analysis.Eyes were harvested, corneas were dissected and tissues were fixed in 4% PFA O/N at 4°C for morphological analysis. Fixed tissues were washed in PBTX and further dissected for gross morphological analysis and processed for immunofluorescent staining. Antibodies used were anti-mouse Endomucin (Santa Cruz Biotechnology, cat# sc-53941) anti-mouse ERG (Abcam, cat# ab92513), anti-mouse NRP2 (R and D systems, cat# AF567). Whole corneas were flatmounted on glass slides in 70% glycerol and high-resolution images were captured using a 10x (whole cornea) and 20x (detail image) objective on a Zeiss LSM 710 confocal microscope.
Luciferase reporter assays
COS-7 cells were cultured at 37°C, 5% CO2 in DMEM (Life technologies, 11995) with added FBS, sodium pyruvate, L-glutamine, penicillin, streptomycin, non-essential amino acids and HEPES (N-2-hydroxyethylpiperazine-N'−2-ethanesulfonic acid). COS-7 cells were grown in 96-well plates to 80–90% confluency, and transfected using X-tremegene 9 DNA transfection reagent (Roche, 06365787001) according to the manufacturer’s instructions. Constructs used were mouse pSG5 Sox18 (30 ng), mouse pSG5 myc-RaOp (30 ng) and pGL2 Vcam1:luc (40 ng). For titration of RaOp dominant negative allelic ratios, pSG5 Sox18 was kept at 30 ng, while the amount of pSG5 myc-RaOp plasmid was reduced accordingly (supplemented to 30 ng plasmid DNA with pSG5 empty vector). Propranolol hydrochloride was added to low serum COS-7 media to obtain concentrations of 1, 3, 6, and 15 μM. Propranolol treatment extended 24 hr after the end of transfection until cells were harvested for luciferase detection.
Plasmid preparation and cell free-expression
Proteins were genetically encoded with enhanced GFP (GFP), mCherry and cMyc (myc) tags, and cloned into the following cell free expression Gateway destination vectors: N-terminal GFP tagged (pCellFree_G03), N-terminal Cherry-cMyc (pCellFree_G07) and C-terminal Cherry-cMyc tagged (pCellFree_G08) (Gagoski et al., 2015). Human SOX18 (BC020780), SOX18.Q161* (Modified as describe below from BC020780), Open Reading Frames (ORFs) were sourced from the Human ORFeome collection, version 5.1, and the Human Orfeome collaboration OCAA collection (Open Biosystems), as previously described (Sierecki et al., 2013) and cloned at UNSW. The entry clones pDONOR223 vectors were exchanged with the ccdB gene in the expression plasmid by LR recombination (Life Technologies, Australia). The full-length human SOX18 gene was synthesized (IDT DNA, USA) and transferred to pCellFree vectors using Gateway PCR cloning. Translation competent Leishmania tarentolae extract (LTE) was prepared as previously described (Kovtun et al., 2011; Mureev et al., 2009). Protein pairs were co-expressed by adding 30 nM of GFP template plasmid and 60 nM of Cherry template plasmid to LTE and incubating for 3 hr at 27°C.
Construction of the SOX18.Q161* construct
The SOX18.Q161* construct was made by adding a codon stop (UAA) at the original Glutamine acid in position 161 of the Human SOX18 (BC020780).The SOX18.Q161 was obtained as a gBlock (IDT), and was exchanged with the ccdB gene in the donor plasmid (pDONOR223) by BP recombination (Life Technologies, Australia), then with the ccdB gene in the expression plasmid (pCellFree_G03 and pCellFree_G08) by LR recombination (Life Technologies, Australia) as described previously.
ALPHAScreen assay
The assay was performed as previously described (Sierecki et al., 2013; Sierecki et al., 2014), using the cMyc detection kit and Proxiplate-384 Plus plates (PerkinElmer). The LTE lysate co-expressing the proteins of interest was diluted in buffer A (25 mM HEPES, 50 mM NaCl). For the assay, 12.5 μL (0.4 μg) of Anti-cMyc coated Acceptor Beads in buffer B (25 mM HEPES, 50 mM NaCl, 0.001% NP40, 0.001% casein) were aliquoted into each well. This was followed by the addition of 2 μL of diluted sample, at different concentration, and 2 μL of biotin labeled GFP-Nanotrap in buffer A. The plates were incubated for 45 min at room temperature, then 2 μL (0.4 μg) of Streptavidin coated Donor Beads diluted in buffer A was added, and the plate was incubated in the dark for 45 min at room temperature. The ALPHAScreen signal was measured on an Envision Plate Reader (PerkinElmer), using manufacturer’s recommended settings (λexc = 680/30 nm for 0.18 s, λem = 570/100 nm after 37 ms). The resulting bell-shaped curve is an indication of a positive interaction, while a flat line reflects a lack of interaction between the proteins. Measurements of each protein pair were performed in triplicate. A binding index was calculated as:, where I is the highest signal level (top of the hook effect curve) and I is the lowest (background) signal level. The signals were normalized to the I signal obtained for the strongest interaction.
Whole mount ear skin staining and cornea staining
Ear skin samples and corneal tissues were fixed in 4% paraformaldehyde (PFA) at 4°C overnight, and immunofluorescence was performed as follows: 1) Blocking solution incubated for 16 hr (10% sheep serum in PBSTx and 1% DMSO); 2) Primary and secondary antibodies were applied overnight at 4°C on a rocker. Wash solution (PBSTx and 1% DMSO) was applied for a few hours at room temperature after each antibody incubation. Ear sample are flat mounted onto a glass slide.
Quantitation of lymphatic vasculature
After immunofluorescence using anti-Podoplanin (Angiobio anti-mouse 11033), anti-CD31 (Beckton Dickinson anti-rat 550274), ERG (AbCam EPR3864, ab92513) and Endomucin (Santa Cruz Biotechnology sc53941 V.5C7 anti-mouse) antibodies, apical photographs of mouse ears were taken at 20x magnification with a confocal microscope. The averaged field counts for each parameter were collated for all sections before graphical comparisons between phenotypes were generated, and their statistical significance determined by student’s paired T-test.
Immunostaining infantile hemangioma sections
Histological sections from paraffin embedded proliferating infantile hemangiomas were stained with anti-SOX18, anti-CD31, anti-Ki67, anti-D2-40 antibody and nuclei stained with DAPI. Images were captured using a Vectra three multi-spectral imager (Vectra 3.0 Automated Quantitative Pathology Imaging System, Perkin Elmer) taking advantage of the auto-expose feature of the microscope. Image magnification is 20X objective.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Propranolol in HLTRS and infantile hemangioma: Stereoselective blockage of the SOX18 transcription factor activity" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Gou Young Koh as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Sean Morrison as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity:); Pia Ostergaard (Reviewer #2).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:While reviewers 1 and 2 are positive, the reviewers have raised some issues, which are constructive and insightful.Essential revisions:We encourage the authors to do additional experiments to address the comments raised by reviewer 1 (comments 4, 5 and 7) and reviewer 3 (comment 2). The remaining comments could be addressed by changes to the text, such as through further discussion.Reviewer #1:This study by Overman et al. suggests a new mechanistic insight of propranolol in that R(+)-propranolol enantiomer acts as a small molecule inhibitor of SOX18. They also demonstrate the therapeutic potential of the R(+)-propranolol enantiomer in a patient-derived in vitro model of infantile hemangioma. The hypothesis tested in the study is intriguing and might be clinically relevant with potential therapeutic implications for pathologies involving SOX18 mutations and/or aberrant vascular growth, such as infantile hemangioma. Therefore, I would like to support the publication of this work after addressing the following points.1) The authors suggest that the R(+)-propranolol enantiomer directly inhibits the transcriptional activity of SOX18 and thereby functions as an anti-angiogenic agent. However, the authors also demonstrate that propranolol restores SOX18 functionality in a dose-dependent manner, which is demonstrated by Vcam1 (SOX18 target) promoter luciferase assay (Figure 2B). This particular aspect seems counterintuitive. Considering that SOX18 mutations in hypotrichosis-lymphedema-telangiectasia and renal syndrome (HLTRS) act in a dominant-negative manner by impairing SOX18 function, please clearly address whether and how the R(+)-propranolol enantiomer restores or inhibits SOX18 function.2) Could the authors check the protein expression of SOX18 in infantile hemangioma tissue samples or in cell populations derived from infantile hemangioma before and/or after treatment with propranolol to test its beneficial effect in these circumstances?3) The authors demonstrated that the propranolol treatment in a patient with HLTRS dramatically improved pericardial effusion (Figure 1A-B). This change might have resulted secondarily from the process caused by SOX18 mutation (possibly including lymphedema, and/or renal syndrome), as the primary pericardial effusion itself is a relatively rare disease entity (Imazio et al., Nature Review Cardiology, 2009). Does the HLTRS patient have improvements in symptoms other than pericardial effusion, which might be directly related to HLTRS (e.g. telangiectasia, lymphedema) after propranolol treatment rather than pericardial effusion alone? Furthermore, if the mechanism of action of propranolol in the patient with SOX18 mutation is independent of anti-β-adrenergic activity as the authors suggested, how was the heart function of the patient, including tamponade physiology, improved? Is there any direct or indirect evidence to suggest that SOX18 function is restored or at least altered with propranolol treatment in this patient? These issues might need to be discussed in the Discussion section.4) The authors suggest that propranolol inhibits SOX18 activity during VEGF-B-induced differentiation of hemangioma-derived stem cells (HemSC) into the hemangioma endothelial cells (HemECs). Could the authors verify that there is no change in SOX18 activity with β-adrenergic agonist treatment to support their claim that the effect of propranolol on SOX18 is independent of a β-adrenergic mechanism?5) Does propranolol rescue only the aberrant vessel growth in Sox18 RaOp mouse cornea? Or also in other tissues such as skin, as the hypotrichosis and infantile hemangioma usually involves and grows on the skin surface.6) In Figure 2—figure supplement 1B, the authors demonstrate the lymphatic vessel outgrowth (Neuropillin-2 and Prox1) in corneal whole-mount staining of Sox18 RaOp mice. This data is not mentioned in the main text although it is demonstrated in the supplemental figure and its legend. Why do the cornea lymphatic vessels outgrow in Sox18 RaOp mice?7) Does the R(+)-propranolol enantiomer modulate VEGFR2 levels or its phosphorylation upon VEGF-A stimulation? This should be easily testable as the authors already have the cell lines, and this might partly explain and support the regression of infantile hemangioma by propranolol treatment.Reviewer #2:I have read the manuscript from Overman et al. with great interest. It is very interesting to get an insight into how some of these genetic defects can possibly be overcome using various forms of drugs. Overall, I think this manuscript represents a solid piece of work and I do not have any major comments except that it would be nice if the discussion had been a bit more comprehensive. For example, the authors mention that the propranolol increased the mean weight of the wild type mice, but not of the RaOp mice. Why is that?Reviewer #3:The key message of this study is that the block of Sox18 is a main 'mechanism of action' of propranolol in treating HLTRS and infantile hemangioma. Several experiments support this conclusion, but insufficiently.1) Abnormal SOX18 protein derived from mutation in a patient can affect downstream broadly. Thus, it is difficult to judge targets of propranolol in a HLTRS patient. The RaOp mouse model has same issue, too.2) Although both HLTRS and RaOp have mutations in Sox18, phenotypes focused in this study are different: pericardial edema in HLTRS and corneal angiogenesis in RaOp. They seem to be far away for comparison. In addition, the dose of propranolol for a HLTLS patient was 4 mg/kg/day while that for RaOp mice was 25 mg/kg/day (with an increasing potential of non-selective effects).3) Use of the R(+) enantiomer of propranolol was suggested to preclude β-adrenergic-dependent blocking activity. However, the R(+) enantiomer was not used in the assessment of corneal neo-vascularisation.4) Similarly, differentiation of hemangioma stem cells into endothelial cells relies on many factors including all SoxF members but not Sox18 alone. Downregulated genes by propranolol are representative endothelial markers rather than Sox18 targets (Figure 3C). Altogether, there may be a possibility that propranolol plays a role in a Sox18-independent manner. Additional experiments using other non-selective β-adrenergic blockers such as carvedilol may support the conclusions.5) Some in vitro experiments appear to lack a physiologic link to in vivo and patient data.– There was no link to Sox18 function in cell assays shown in Figures 1C and ID.– The cell systems used in Figures 2B and 2C may be different from lymphatic or hemangioma cells.– In the present manuscript, only numbers are presented without additional help on ALPHAScreen assay and it is very difficult to figure out how reliable the data of protein-protein interactions in the bar graph are.– Sox18 protein increased luciferase activity by two-fold in the assay in Figure 2B. This extent of enhanced activity, in general, is not enough to prove binding of transcription factors to their target regions, raising a concern whether the Vcam-1 promoter region used in Figure 2B is a convincing target region of Sox18 in this context.Essential revisions:We encourage the authors to do additional experiments to address the comments raised by reviewer 1 (comments 4, 5 and 7) and reviewer 3 (comment 2). The remaining comments could be addressed by changes to the text, such as through further discussion.Reviewer #1:This study by Overman et al. suggests a new mechanistic insight of propranolol in that R(+)-propranolol enantiomer acts as a small molecule inhibitor of SOX18. They also demonstrate the therapeutic potential of the R(+)-propranolol enantiomer in a patient-derived in vitro model of infantile hemangioma. The hypothesis tested in the study is intriguing and might be clinically relevant with potential therapeutic implications for pathologies involving SOX18 mutations and/or aberrant vascular growth, such as infantile hemangioma. Therefore, I would like to support the publication of this work after addressing the following points.1) The authors suggest that the R(+)-propranolol enantiomer directly inhibits the transcriptional activity of SOX18 and thereby functions as an anti-angiogenic agent. However, the authors also demonstrate that propranolol restores SOX18 functionality in a dose-dependent manner, which is demonstrated by Vcam1 (SOX18 target) promoter luciferase assay (Figure 2B). This particular aspect seems counterintuitive. Considering that SOX18 mutations in hypotrichosis-lymphedema-telangiectasia and renal syndrome (HLTRS) act in a dominant-negative manner by impairing SOX18 function, please clearly address whether and how the R(+)-propranolol enantiomer restores or inhibits SOX18 function.In this study we show that propranolol has the ability to disrupt both SOX18 protein-protein interactions and SOX18-SOX18mut (RaOp) protein-protein interactions (i.e. SOX18 homodimer and SOX18/SOX18RaOp heterodimer formation Figure 2C). In the context of a transcription-based assay (Figure 2B) SOX18 RaOp mutant protein is a potent repressor of SOX18 activity (even up to a 30wt/1RaOp ratio), this causes the loss of Vcam1 transactivation (Figure 2B). SOX18 RaOp mutant protein acts by “poisoning functional SOX18 protein complexes” by forming SOX18-RaOp dimers. SOX18 function is partly restored by propranolol because propranolol disrupts SOX18RaOP protein recruitment and interaction with SOX18 WT. The non “poisoned” SOX18 is then able to transactivate Vcam1.In other words the process corresponds to the inhibition (propranolol) of an inhibitor (RaOp) which in turn results to the restoration of SOX18 active form. Please find in Author response image 1 a schematic of the proposed partial agonist mechanism.
Author response image 1.
Propranolol rescues the RaOp protein-mediated inhibition by disrupting the interaction SOX18/SOX18RaOp.
2) Could the authors check the protein expression of SOX18 in infantile hemangioma tissue samples or in cell populations derived from infantile hemangioma before and/or after treatment with propranolol to test its beneficial effect in these circumstances?We have assessed SOX18 expression in 3 different human infantile hemangioma tissue samples from patients that did not received propranolol treatment, as patients treated with propranolol do not typically undergo surgery. We detected expression of the SOX18 protein in the pathological blood vasculature by immunofluorescence. The SOX18 protein was detected in a large subset of CD31-positive endothelial cells, in accordance with its role during hemangioma stem cell to EC differentiation process. This new result is now incorporated into Figure 3 as Figure 3A and reported in the text (Results section).We next examined the effect of Sm4 and propranolol on SOX18 gene expression levels in the differentiated HemSCs (n=4). As shown in Author response image 2 Panel A, SOX18 increased upon VEGF-B-induced endothelial differentiation (p=0.0026), consistent with results shown in Figure 3B; inclusion of Sm4 or propranolol during the differentiation assay decreased levels of SOX18 transcript, measured by qPCR. This result is expected because both inhibitors block HemSC-EC differentiation (Figure 3C and Figure 3—figure supplement 2) and therefore decrease the total number of mature ECs. We normalised the data relative to a pan-endothelial cell marker such as CD31 (Panel B), to account for the bias introduced by the lack of endothelial cells differentiation. Using CD31 as a reference gene we show that SOX18 levels were constant, with a small but significant increase when propranolol was included in the differentiation media.
Author response image 2.
HemSC were treated without (control) or with VEGF-B for 5 days to induce endothelial differentiation.
Sm4 or propranolol were included in the differentiation medium at 5μM. DMSO, the vehicle, was added at the same dilution to serve as control. SOX18 was measured by qPCR and normalized to the house keeping transcript ATP5B (A) or to the pan-endothelial marker CD31 (B). Data points are from 4 different experiments carried out with HemSC from three different infantile hemangiomas.
HemSC were treated without (control) or with VEGF-B for 5 days to induce endothelial differentiation.
Sm4 or propranolol were included in the differentiation medium at 5μM. DMSO, the vehicle, was added at the same dilution to serve as control. SOX18 was measured by qPCR and normalized to the house keeping transcript ATP5B (A) or to the pan-endothelial marker CD31 (B). Data points are from 4 different experiments carried out with HemSC from three different infantile hemangiomas.3) The authors demonstrated that the propranolol treatment in a patient with HLTRS dramatically improved pericardial effusion (Figure 1A-B). This change might have resulted secondarily from the process caused by SOX18 mutation (possibly including lymphedema, and/or renal syndrome), as the primary pericardial effusion itself is a relatively rare disease entity (Imazio et al., Nature Review Cardiology, 2009). Does the HLTRS patient have improvements in symptoms other than pericardial effusion, which might be directly related to HLTRS (e.g. telangiectasia, lymphedema) after propranolol treatment rather than pericardial effusion alone?The patient had mild improvement in both the telangectasia (especially face and lips) and lymphedema (evidenced by reducing the dose of the diuretic Furosemide). However, the dramatic improvement was in the complete resolution of the pericardial effusion which was sustained even after stopping the propranolol. The exposure to propranolol was rather short, only 16 months of treatment were necessary to improve the pericardial effusion.It is important to bear in mind that most of HLTRS symptoms are acquired during embryonic development when SOX18 is at play during the molecular process of endothelial cell specification and hair stem cell differentiation. It is therefore not expected to correct symptoms acquired during early development especially when the molecular target is not at play post-natally.Furthermore, if the mechanism of action of propranolol in the patient with SOX18 mutation is independent of anti-β-adrenergic activity as the authors suggested, how was the heart function of the patient, including tamponade physiology, improved?The systolic cardiac function (ejection fraction) was normal even during the time when there was large pericardial effusion. The diastolic function however was decreased due to the effusion. Nevertheless, the diastolic dysfunction observed did not reach the degree of tamponade.Is there any direct or indirect evidence to suggest that SOX18 function is restored or at least altered with propranolol treatment in this patient? These issues might need to be discussed in the Discussion section.So far the only indirect evidence that SOX18 function is restored has been reported in Wunnemann et al., 2015 whereby after years of propranolol treatment (from a young age to 13yo) the HTLRS patient did not develop alopecia and display normal hair growth.We agree with the comment. With the current amount of scientific evidence we cannot conclude that in HLTRS the effects are mediated via a partial restoration of SOX18 function only. This could be due to an additive or synergistic effect with β-adrenergic blockade. This is now addressed in the Discussion.4) The authors suggest that propranolol inhibits SOX18 activity during VEGF-B-induced differentiation of hemangioma-derived stem cells (HemSC) into the hemangioma endothelial cells (HemECs). Could the authors verify that there is no change in SOX18 activity with β-adrenergic agonist treatment to support their claim that the effect of propranolol on SOX18 is independent of a β-adrenergic mechanism?We tested whether or not inclusion of isoproterenol, a non-selective β-adrenergic receptor agonist, during the VEGF-B-induced differentiation would alter SOX18 activity or increase endothelial differentiation. We measured NOTCH1, a SOX18 target gene, and VE-cadherin, an EC marker, and SOX18 in VEGF-B treated HemSCs cells by qPCR. In four biological replicates with HemSC isolated from three different infantile hemangioma specimens, we did not detect a significant increase in VE-cadherin, NOTCH1 or SOX18 in isoproterenol-treated cells compared to DMSO (vehicle)-treated cells. Propranolol caused a significant decreased in VE-cadherin, NOTCH1 and SOX18 transcripts; p values <0.05 (consistent with Figure 3C and Figure 3—figure supplement 2.) This suggests SOX18 activity is not modulated by a β-adrenergic pathway. Isoproterenol in the absence of VEGF-B-induced differentiation had no effect on VE-cadherin, NOTCH1, SOX18 levels (Author response image 3).
Author response image 3.
HemSC were treated with VEGF-B for 5 days to induce endothelial differentiation.
Propranolol or isoproterenol were included in the differentiation medium at 5μM, whereas DMSO, the vehicle, was added at the same dilution to serve as control. VE-cadherin, NOTCH1 and SOX18 were measured by qPCR. Data points are from 4 different experiments carried out with HemSC from three different infantile hemangiomas.
HemSC were treated with VEGF-B for 5 days to induce endothelial differentiation.
Propranolol or isoproterenol were included in the differentiation medium at 5μM, whereas DMSO, the vehicle, was added at the same dilution to serve as control. VE-cadherin, NOTCH1 and SOX18 were measured by qPCR. Data points are from 4 different experiments carried out with HemSC from three different infantile hemangiomas.5) Does propranolol rescue only the aberrant vessel growth in Sox18 RaOp mouse cornea? Or also in other tissues such as skin, as the hypotrichosis and infantile hemangioma usually involves and grows on the skin surface.We have performed an additional in vivo experiment to assess whether propranolol, the R-enantiomer, or the S-enantiomer impact aberrant vessel patterning in skin tissues. Animals were treated at 25mg/Kg/day (oral gavage) from P1 to P28. Ear skin tissues were collected and whole mount immunofluorescence staining was performed for CD31, Podoplanin and ERG. Samples were imaged by confocal microscopy and vessel morphogenesis was quantified using IMARIS software.As previously published, we observed that the Ragged Opossum heterozygous mutant mice display severe lymphatic vascular defects (Francois et al., 2008) with major morphogenesis defects of the dermal lymphatic vasculature. The loss of a significant portion of vessels with valve structure (pre-collectors and collectors) revealed a dramatic phenotype of the mature lymphatic vascular network in the RaOp animals (Figure 3—figure supplement 4, top graph).There was no phenotypic rescue corresponding to a significant improvement of the lymphatic vasculature mis-patterning observed for any of the drug treatments in the mutant animals. This result is in accordance with the fact the drug treatment occurs at post-natal stages whereas the dermal lymphatic vascular defects are acquired from early to mid-stages of organogenesis in the embryo. This result is now indicated in the manuscript.For transparency of the review process we have appended in Author response image 4 all the images we have used for quantification of the skin lymphatic vascular experiment.
Author response image 4.
Images of whole mount skin immuno-stained for podoplanin.
Each image corresponds to the same region of interest from the inner skin flap of a mouse ear. Untreated WT, n=4; untreated ragged n=3; S(-) propranolol WT n=4; S(-) propranolol ragged n=3; propranolol WT n=5, propranolol ragged n=4; R(+) propranolol WT n=6, R(+) propranolol ragged n=4.
Images of whole mount skin immuno-stained for podoplanin.
Each image corresponds to the same region of interest from the inner skin flap of a mouse ear. Untreated WT, n=4; untreated ragged n=3; S(-) propranolol WT n=4; S(-) propranolol ragged n=3; propranolol WT n=5, propranolol ragged n=4; R(+) propranolol WT n=6, R(+) propranolol ragged n=4.6) In Figure 2—figure supplement 1B, the authors demonstrate the lymphatic vessel outgrowth (Neuropillin-2 and Prox1) in corneal whole-mount staining of Sox18 RaOp mice. This data is not mentioned in the main text although it is demonstrated in the supplemental figure and its legend. Why do the cornea lymphatic vessels outgrow in Sox18 RaOp mice?The molecular mechanism that underpins vascular outgrowth in the cornea for both blood and lymphatic vessels remains unclear. Since most causes of corneal neo-vascularisation (CNV) are indeed VEGF-dependent, and some are successfully treated with anti-VEGF based therapies, we decided to focus on the potential contribution of augmented VEGF signalling to the invasion of blood vessel into the Sox18 corneas. In the context of CNV, Flt1 is of particular interest, as the balance of distinct isoforms of this protein has been shown to be of key importance in maintaining corneal avascularity (Ambati et al., 2006). The pro- or anti-angiogenic activity of FLT1 is highly dependent on the particular splice variant that is produced (Kearney et al., 2004, Ferrara et al., 2003, Claesson-Welsh, 2016). The shorter isoform sFLT is released into the extracellular matrix to sequester endogenous pro-angiogenic VEGF-A, preventing the activation of FLT1 and VEGFR2 receptors and any downstream cellular response. Deficiency of sFLT in the cornea has been shown to be causative for CNV (Ambati et al., 2006). Further, we have recently shown that FLT1 is a potential direct target gene of SOX18 dimer complex (Moustaqil et al., NAR 2018). This observation prompted us to investigate FLT1 expression levels in the RaOp mutant mouse.In order to identify whether VEGF pathway is dysregulated in the tissue of the mutant animals we have performed qPCR analysis for VEGF receptors and soluble receptors on the whole cornea of wild type and mutant animals at different time points (8weeks, P12weeks, P16weeks). See Author response image 5. To distinguish between the different splice variants that give rise to either the full length FLT1 receptors or soluble FLT1 (sFLT1), we designed primers to specifically amplify the following regions:
Author response image 5.
Whole corneas were harvested from 8, 12 and 16 week old mice and prepared for qRT-PCR analysis.
Gene transcripts for Pecam, Flt1, Vegfr2 and Foxc were normalized to either housekeeper gene Rpl13 (top row) or vascular gene Pecam (bottom row) to normalize for total amount of endothelial cells (EC). SOX18 mice at 8 weeks of age had increased levels of Pecam, indicating an increase in ECs, and increased levels of the transcripts corresponding to the extracellular domain of the Flt1 receptor (Flt1-extra), the intracellular domain (Flt1-inra) and the exclusively soluble variant of Flt1 (sFlt1). * P-value ≤ 0.05, Holm-Sidak multiple comparison test. Individual biological replicates are shown, including mean ± s.e.m of n=2-8..
‘Flt1 (extra)’, extracellular domain that is present in both full length FLT1 and sFLT1;‘Flt1 (intra)’, intracellular domain that is only present in full length FLT1;‘sFlt1’, unique 3’end of exon 12 and 3’UTR only present on the sFlt1 transcript
Whole corneas were harvested from 8, 12 and 16 week old mice and prepared for qRT-PCR analysis.
Gene transcripts for Pecam, Flt1, Vegfr2 and Foxc were normalized to either housekeeper gene Rpl13 (top row) or vascular gene Pecam (bottom row) to normalize for total amount of endothelial cells (EC). SOX18 mice at 8 weeks of age had increased levels of Pecam, indicating an increase in ECs, and increased levels of the transcripts corresponding to the extracellular domain of the Flt1 receptor (Flt1-extra), the intracellular domain (Flt1-inra) and the exclusively soluble variant of Flt1 (sFlt1). * P-value ≤ 0.05, Holm-Sidak multiple comparison test. Individual biological replicates are shown, including mean ± s.e.m of n=2-8..The most obvious changes in Flt1 levels were observed at 8 weeks, in agreement with the expression pattern of Pecam (Figure 2—figure supplement 1C). At this stage, the amount of total Flt1 (Flt1 extra) in the Sox18 corneas was 4.6 fold higher than in the wild type (p-value < 0.05). This is partly explained by the fact that these corneas are covered in blood vessels, and the increased amount of endothelial cells contributes to the induction of Flt1 over the whole tissue. However, the increase in Pecam transcript levels – representing the increase in endothelial cells – is much lower than that of Flt (2 fold). In order to compensate for the increase in endothelial cells, we normalized the Flt1 transcript levels to Pecam levels, which makes it evident that total Flt1 increased disproportionality to the amount endothelial cells (2.0 fold, p-value < 0.05).Although total Flt1 is upregulated in the corneas of SOX18 mice, sFlt1 levels are unchanged regardless of the amount of vascular endothelial cells. This suggests that the ratio between the amounts of full length FLT1 and sFLT1 in the cornea shifted in favour of the full-length isoform. Transcript levels for Vegfr2 were not significantly different between wild types and mutants at 8 weeks. Since FLT1, VEGFR2 and sFLT1 all compete for the same pool of VEGF-A, the shift in Flt1 isoforms could explain the corneal phenotype. However, whether exactly this is causative for the penetration of vessels into the cornea of Sox18 mice, and whether SOX18 is directly involved in regulating the balance between Flt1/sFlt1, is uncertain at this stage.Of note FOXC1 levels remains unchanged; we tested for this gene expression level since loss of this transcription factor function has been shown to cause corneal neo-vascularisation (Axenfeld-Rieger Syndrome) (Mears et al. Am j Hum Genet 1998)7) Does the R(+)-propranolol enantiomer modulate VEGFR2 levels or its phosphorylation upon VEGF-A stimulation? This should be easily testable as the authors already have the cell lines, and this might partly explain and support the regression of infantile hemangioma by propranolol treatment.We address this question with three experiments.In panel A, normal human ECFCs were pre-treated for 1 hour with propranolol, R+ enantiomer or S-enantiomer (each tested at 5μM) and then stimulated for 5 minutes with VEGF-A. Cells were lysed and analysed for phosphorylated VEGFR2 and total VEGFR2 by Western blotting. The drug treatments had no effect on levels of VEGFR2 or levels of VEGF-A-stimulated phosphorylation. The same results were seen when drug pre-treatment was carried out for 16 hours (not shown).In Panel B, HemSC were induced to undergo endothelial differentiation with VEGF-B for 5 days, then pre-treated with propranolol, R+ enantiomer or S-enantiomer for 1 hour and next stimulated with VEGF-A for 5 minutes. Western blotting for VEGFR2 shows the drug treatments had no effect on VEGFR2 levels; the same results were seen with HemSC isolated from two different IH.In Panel C, the same experiment was performed and VEGFR2 was immunoprecipitated to increase detection of phosphorylated VEGFR2. Drug pre-treatment had no effect on phosphor-VEGFR2 levels. The lack of VEGF-A-induced phosphorylation of VEGFR2 is consistent with previous reports wherein VEGFR2 is primarily intracellular in HemSC (Khan et al., 2008) and is constitutively phosphorylated in HemEC (Jinnin et al., Nat Med 2008). In summary, we did not observe any changes to VEGFR2 protein levels or its phosphorylation upon R-enantiomer, propranolol or S-enantiomer treatment. This is now shown in the manuscript as Figure 3—figure supplement 2B-D.Reviewer #2:I have read the manuscript from Overman et al. with great interest. It is very interesting to get an insight into how some of these genetic defects can possibly be overcome using various forms of drugs. Overall, I think this manuscript represents a solid piece of work and I do not have any major comments except that it would be nice if the discussion had been a bit more comprehensive. For example, the authors mention that the propranolol increased the mean weight of the wild type mice, but not of the RaOp mice. Why is that?One of the phenotypes of the Ragged Opossum mutant is a complete lack of sub-cutaneous fat (Francois et al unpublished). The absence of adipose tissue makes it impossible for adipocytes to respond to a beta-adrenergic treatment.It is for this particular reason that we think the Ragged Opossum is not gaining weight under propranolol treatment. The adipose tissue phenotype, currently under investigation, is beyond the scope of this study.Reviewer #3:The key message of this study is that the block of Sox18 is a main 'mechanism of action' of propranolol in treating HLTRS and infantile hemangioma. Several experiments support this conclusion, but insufficiently.1) Abnormal SOX18 protein derived from mutation in a patient can affect downstream broadly. Thus, it is difficult to judge targets of propranolol in a HLTRS patient. The RaOp mouse model has same issue, too.This concern is directed to the in vivo data analysis of propranolol treatment. On the other hand, our data from in vitro and cellular assays shows strongly that propranolol mode of action is mediated via a SOX18-dependent mechanism.The recent description of the molecular function of the SOX18 homodimer in the context of endothelial cell differentiation (Moustaqil et al. NAR 2018) is an important piece of information. Here we show that the RaOp mutant protein has the capability to recruit SOX18 wild type protein and therefore interfere with the endothelial specific signature of SOX18 wild type homodimer.Further, in this study we show that use of specific β adrenergic blockers or loss of β-adrenergic receptors does not affect ECFC or cancer cell line survival. As a final demonstration of a role of SOX18-mediated mode of action in vivo we now show that treatment with the R-enantiomer of propranolol (low to no anti-β adrenergic activity) is able to rescue the corneal neo-vascularisation phenotype.2) Although both HLTRS and RaOp have mutations in Sox18, phenotypes focused in this study are different: pericardial edema in HLTRS and corneal angiogenesis in RaOp. They seem to be far away for comparison. In addition, the dose of propranolol for a HLTLS patient was 4 mg/kg/day while that for RaOp mice was 25 mg/kg/day (with an increasing potential of non-selective effects).The point of using the Ragged Opossum mouse model experiment is to show on target engagement by rescuing a phenotype which relies on the activity of the SOX18 mutant protein. We agree that the readout in human is different, but in this particular case the decision to pharmacologically manage a new HLTRS case with propranolol was guided by the results obtained from pre-clinical data. This provided a therapeutic option where none was available before.The choice of the dosage was originally guided by our experience in vivo in mice using Sm4 (SOX18 small molecule inhibitor) which we have shown is a potent anti-metastatic compound at 25mg/kg/day in pre-clinical model of breast cancer (Overman et al eLife 2017).Of note we have shown efficacy of Sm4 at lower concentration in a dose dependent manner (from 5 to 50mg/Kg/day, unpublished data). This suggests that the patient treated with low dose of propranolol (4mg/Kg/day) has received a dose of small molecule inhibitor that is able to block SOX18 activity.In the Ragged Opossum in vivo experiment we aimed at a maximum tolerated dose to get the best rescuing effect possible in turn translating into an obvious phenotypic rescue. The concentration scouting is a great suggestion but is not necessary as all in vitro data show concentration dependence and that the main goal of the rescuing approach is to show selective on-target engagement.3) Use of the R(+) enantiomer of propranolol was suggested to preclude β-adrenergic-dependent blocking activity. However, the R(+) enantiomer was not used in the assessment of corneal neo-vascularisation.We have now assessed the effect of the R(+) enantiomer in vivo in a rescue experiment of the corneal neo-vascularisation phenotype in the Ragged Opossum (RaOp) mouse model. These results are now included in the manuscript as a supplemental figure to Figure 3.In short, the R(+) enantiomer has the ability to rescue the corneal neo-vascularisation phenotype of the RaOp heterozygous mouse. Further, we have also tested the S(-) enantiomer in the same model system. Interestingly it seems that this compound has the potential to rescue the phenotype albeit to a lesser extent. This results suggests that both R(+) and S(-) enantiomers have the capability to inhibit the SOX18 RaOp mutant protein activity. This is most likely by disturbing the SOX18/SOX18RaOp or the RBPJ/SOX18RaOp protein-protein interactions as shown by our in vitro assays. Of importance, in the hemangioma hemSC-EC differentiation assay the R(+) enantiomer was as efficient as propranolol in halting this differentiation process, whereas the S(-) enantiomer showed a weak inhibitory response, suggesting an enantiomer selective blockade of the SOX18 wild type protein mediated by the R(+) enantiomer.Because of the weak activity of the S(-)enantiomer, we have revised the title of our manuscript to reflect accurately the key finding of this study: “R-propranolol is a small molecule inhibitor of the SOX18 transcription factor in a rare vascular syndrome and hemangioma.”4) Similarly, differentiation of hemangioma stem cells into endothelial cells relies on many factors including all SoxF members but not Sox18 alone. Downregulated genes by propranolol are representative endothelial markers rather than Sox18 targets (Figure 3C). Altogether, there may be a possibility that propranolol plays a role in a Sox18-independent manner. Additional experiments using other non-selective β-adrenergic blockers such as carvedilol may support the conclusions.We did not test additional non-selective β-adrenergic blockers.5) Some in vitro experiments appear to lack a physiologic link to in vivo and patient data.– There was no link to Sox18 function in cell assays shown in Figures 1C and ID.The point of experiments shown in Figure 1C and 1D is to show that propranolol acts has a mode of action which is at least in part independent to β-adrenergic receptors. The link of propranolol to SOX18 is provided by other assay such as the in vitro transcriptional report assay (Figure 2B) and ALPHAScreen assay (Figure 2C).– The cell systems used in Figures 2B and 2C may be different from lymphatic or hemangioma cells.These in vitro assays are synthetic and designed to show propranolol on target engagement on SOX18 activity.We actually use a cell based assay where SOX18 is not expressed and add exogenous SOX18 to demonstrate specific inhibition of this TF by propranolol.– In the present manuscript, only numbers are presented without additional help on ALPHAScreen assay and it is very difficult to figure out how reliable the data of protein-protein interactions in the bar graph are.We have now provided more information on the statistical analysis of the ALPHAScreen data analysis in the text of the corresponding figure legend.– Sox18 protein increased luciferase activity by two-fold in the assay in Figure 2B. This extent of enhanced activity, in general, is not enough to prove binding of transcription factors to their target regions, raising a concern whether the Vcam-1 promoter region used in Figure 2B is a convincing target region of Sox18 in this context.Although we agree that this assay efficacy window is not optimum, this result is highly reproducible and quite robust. The transactivation of the Vcam1 promoter fragment and the regulation of Vcam1 by SOX18 has been previously characterised and published, please refer to Hosking et al., 2004.
Authors: Ivy Kim-Ni Chiang; Martin Fritzsche; Cathy Pichol-Thievend; Alice Neal; Kelly Holmes; Anne Lagendijk; Jeroen Overman; Donatella D'Angelo; Alice Omini; Dorien Hermkens; Emmanuelle Lesieur; Ke Liu; Indrika Ratnayaka; Monica Corada; George Bou-Gharios; Jason Carroll; Elisabetta Dejana; Stefan Schulte-Merker; Benjamin Hogan; Monica Beltrame; Sarah De Val; Mathias Francois Journal: Development Date: 2017-06-15 Impact factor: 6.868
Authors: Jennifer K Wolter; Nikolaus E Wolter; Alvaro Blanch; Teresa Partridge; Lynn Cheng; Daniel A Morgenstern; Monika Podkowa; David R Kaplan; Meredith S Irwin Journal: Oncotarget Date: 2014-01-15
Authors: Caroline T Seebauer; Matthew S Graus; Lan Huang; Alex McCann; Jill Wylie-Sears; Frank Fontaine; Tara Karnezis; David Zurakowski; Steven J Staffa; Frédéric Meunier; John B Mulliken; Joyce Bischoff; Mathias Francois Journal: J Clin Invest Date: 2022-02-01 Impact factor: 14.808
Authors: Krista Tuohinto; Veijo Nurminen; Silvia Gramolelli; Endrit Elbasani; Thomas Günther; Riikka E Kallinen; Seppo P Kaijalainen; Raquel Diaz; Adam Grundhoff; Caj Haglund; Joseph M Ziegelbauer; Teijo Pellinen; Mark Bower; Mathias Francois; Päivi M Ojala Journal: Cancer Res Date: 2020-06-09 Impact factor: 12.701