Literature DB >> 31350935

Heterologous expression of the apple hexose transporter MdHT2.2 altered sugar concentration with increasing cell wall invertase activity in tomato fruit.

Zhengyang Wang1, Xiaoyu Wei1, Jingjing Yang1, Huixia Li1, Baiquan Ma1, Kaikai Zhang1, Yanfeng Zhang2, Lailiang Cheng3, Fengwang Ma1, Mingjun Li1.   

Abstract

Sugar transporters are necessary to transfer hexose from cell wall spaces into parenchyma cells to boost hexose accumulation to high concentrations in fruit. Here, we have identified an apple hexose transporter (HTs), MdHT2.2, located in the plasma membrane, which is highly expressed in mature fruit. In a yeast system, the MdHT2.2 protein exhibited high 14 C-fructose and 14 C-glucose transport activity. In transgenic tomato heterologously expressing MdHT2.2, the levels of both fructose and glucose increased significantly in mature fruit, with sugar being unloaded via the apoplastic pathway, but the level of sucrose decreased significantly. Analysis of enzyme activity and the expression of genes related to sugar metabolism and transport revealed greatly up-regulated expression of SlLIN5, a key gene encoding cell wall invertase (CWINV), as well as increased CWINV activity in tomatoes transformed with MdHT2.2. Moreover, the levels of fructose, glucose and sucrose recovered nearly to those of the wild type in the sllin5-edited mutant of the MdHT2.2-expressing lines. However, the overexpression of MdHT2.2 decreased hexose levels and increased sucrose levels in mature leaves and young fruit, suggesting that the response pathway for the apoplastic hexose signal differs among tomato tissues. The present study identifies a new HTs in apple that is able to take up fructose and glucose into cells and confirms that the apoplastic hexose levels regulated by HT controls CWINV activity to alter carbohydrate partitioning and sugar content.
© 2019 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Entities:  

Keywords:  apple; carbohydrate partitioning; cell wall invertase; hexose transporter; tomato; unloading

Mesh:

Substances:

Year:  2019        PMID: 31350935      PMCID: PMC6953210          DOI: 10.1111/pbi.13222

Source DB:  PubMed          Journal:  Plant Biotechnol J        ISSN: 1467-7644            Impact factor:   9.803


Introduction

Sugars in plant cells are essential molecules that not only provide energy and building blocks for growth and development but also constitute osmotic and signalling molecules (Ruan, 2014). In fruit crops, the concentration of soluble sugar is also a determinant of fruit quality, especially sweetness. Sugar content and composition depend on the regulation of sugar translocation, synthesis and metabolism (Li et al., 2018; Ruan, 2014). In the majority of plants, sucrose (Suc) is produced in photosynthetically active leaves (source, loading) and translocated to support nonphotosynthetic tissues (sink, unloading), such as the developing seed, fruit and tuber. In source leaves, Suc moves from photosynthetic cells into sieve element–companion cell (SE‐CC) complexes through a symplastic loading pathway via plasmodesmata along the Suc concentration gradient or through an apoplastic loading pathway via transporters (Comtet et al., 2017; Patrick, 1997). After long‐distance phloem transport, the Suc in phloem moving into sink cells needs to be transferred from SE‐CC complexes to utilization sites/storage tissues (Ruan, 2014). There are two pathways for Suc unloading: the symplasmic pathway and the apoplasmic pathway. In the symplasmic pathway, which typically occurs in shoot tips and roots, Suc moves along the concentration gradient from SE‐CC complexes directly to surrounding parenchyma cells (PCs) via plasmodesmata (Patrick, 1997). In the apoplasmic pathway, Suc is first released across the plasma membrane of phloem sieves or SE‐CC complexes into the apoplasmic space between cells, possibly via simple diffusion facilitated by a newly discovered family of Suc uniporters, SWEETs (Abelenda et al., 2019). Suc can then be transported into storage PCs by Suc transporters (SUTs or SUCs). Suc can also be converted into fructose (Fru) and glucose (Glc) by cell wall invertases (CWINVs) and then transported into storage cells by hexose transporters (HTs) (Slewinski, 2011). It is now well accepted that the phloem unloading capability plays an important role in the partitioning of photoassimilate, thereby to a large extent determining crop output and quality as well as fruit sugar content (Chen et al., 2017; Patrick, 1997). Although phloem unloading mechanisms have been extensively studied (Lalonde et al., 2003), how unloading processes regulate sugar metabolism and content remains poorly understood. In most fruits, Suc unloading occurs via the apoplasmic pathway during the maturation stage, for example, in apple (Zhang et al., 2004), pear (Li et al., 2017) and kiwifruit (Chen et al., 2017), whereas in grape and tomato, the Suc unloading pathway shifts from a symplasmic pathway to an apoplasmic pathway during fruit development (Ruan and Patrick, 1995; Zhang et al., 2006). In apoplasmic unloading, the SUT protein (e.g. Arabidopsis, AtSUC2; rice, OsSUT3; sorghum, SbSUT5) performs an indispensable function in taking up Suc that leaks from the apoplastic space into PCs (Milne et al., 2018; Scofield et al., 2007). Nonetheless, how Suc moves into sink cells is also important, and in cooperation with HTs, the CWINV‐mediated hydrolysis of Suc has been suggested to play an essential role in determining sink strength and regulating the balance between source and sink in ripening tomato fruit (Jin et al., 2009; Nguyen‐Quoc and Foyer, 2001; Ruan, 2014; Wan et al., 2018; Wang and Ruan, 2012). Indeed, an increase in CWINV activity enhances hexose concentration, delays leaf senescence and increases the weight of seeds in tomato (Jin et al., 2009; Liu et al., 2016). In maize (Bi et al., 2017) and rice (Hirose et al., 2002), CWINVs play a pivotal role in carbohydrate unloading into developmental seeds, which is related to increased grain filling and yield. Moreover, three SlHT genes in tomato fruit have been found to colocalize with QTLs for sugar accumulation (Prudent et al., 2011), a relationship that was further verified by RNAi mutants of these three SlHTs (McCurdy et al., 2010), which decreased hexose concentrations to 55% of those of the wild type. HTs have also been reported to increase sink strength as a mechanism for stress resistance (Lemonnier et al., 2014; Sade et al., 2013). Although it is well known that the CWINV‐HT system acts as a gateway where sugar is taken up into fruit, it remains unknown whether HT regulates CWINV activity in fruit. Apple (Malus domestica Borkh.) and other Rosaceae tree fruits synthesize sorbitol (Sor) and Suc in leaves; they both are then translocated and unloaded into the cell wall space of developing fruit via the apoplasmic pathway (Zhang et al., 2004). Sor is transferred into the cytosol of PCs by the Sor transporter, and Suc is mostly cleaved into hexoses via CWINV before being moved into fruit PCs (Zhang et al., 2004; ;Li et al., 2012). HT is needed for the efficient movement of Glc and Fru from cell wall spaces into PCs because Sor transport is inhibited by high concentrations of hexose (Gao et al., 2003; Li et al., 2018), while fructose content is more than 50% of the soluble sugar in apple fruit cells (Li et al., 2018). Particularly in the late stage of fruit development, strong HT activity is expected to result in hexose uptake against a high chemical gradient due to the high concentrations of hexose in fruit PCs. Among 30 candidate MdHTs, MdHT2.2 was found to be highly expressed in fruit, and both its mRNA and protein levels were significantly and positively correlated with sugar levels in apple fruit (Li et al., 2016; Wei et al., 2014). Thus, MdHT2.2 likely encodes a key transporter that loads hexose into PCs in apple fruit. To determine the function of MdHT2.2 in hexose unloading and its link to sugar metabolism in fruit, we performed an analysis of MdHT2.2 expression characteristics and sugar transport activity, and then heterologously expressed MdHT2.2 in Micro‐Tom tomato (Solanum lycopersicum cv. Micro‐Tom) to investigate its effect on sugar metabolism in fruit. The results confirmed that MdHT2.2, as a sugar/H+ symporter, mainly functions in the uptake of Fru and Glc from the cell wall space and the movement of these sugars into cells. Heterologous expression of MdHT2.2 in tomato increased the contents of Fru and Glc but decreased the Suc content in ripening fruit due to increased expression of SlLIN5, a key gene encoding a CWINV in tomato fruit (Jin et al., 2009; Liu et al., 2016), and increased CWINV activity. In addition to having a high soluble sugar content and large fruit size, the transgenic tomatoes also showed other advantageous traits, such as thinned pericarp, dwarfness and early flowering. The present study identifies a new low‐affinity HT in apple that is able to take up Fru and Glc into cells and implies that the apoplastic hexose level controls CWINV activity, affecting carbohydrate partitioning and sugar content. The results offer new insight into the regulation of the mechanism of carbohydrate partitioning and unloading in fruit, which will be helpful for improving fruit quality and yield.

Results

Isolation, homology analysis and expression assay of MdHT2.2

The MdHT2.2 (MD15G1193400/MDP0000154362) ORF was cloned from the cDNA of ripening apple fruit. The gene was localized to chromosome 15 of the Malus genome, and the mRNA sequence is 2943 bp. The complete open reading frame, as cloned from ‘Gala’ apple, is 1569 bp and encodes 522 amino acids. Phylogenetic analysis of the predicted MdHTs and HTs/STPs from other species (Figure S1A) indicated that different members of the same subfamily share high homology. The putative amino acid sequence of MdHT2.2 shows approximately 77% homology with the predicted peptide of AtSTP14, a galactose transporter involved in drought/senescence‐mediated cell wall recycling (Poschet et al., 2010). The predicted transmembrane structure indicated that MdHT2.2 has 12 transmembrane domains with a cytoplasm‐exposed loop (Figure S1B). To examine the spatiotemporal expression levels of MdHT2.2, qRT‐PCR was performed with RNA extracted from different tissues of apple plants. MdHT2.2 was found to be highly expressed in flowers and mature fruits (especially the flesh) (Figure 1a); however, in tissues with low hexose accumulation (e.g. leaves and roots), its transcript levels were correspondingly very low (Figure 1a). The trend of the change in MdHT2.2 expression was highly similar to that of sugar accumulation (especially fructose and sucrose) during fruit development (Figures 1b and S2, Table S1). In mature fruit, the enriched parenchymal cell region had a much higher expression level of MdHT2.2 than the region of the petal and sepal vascular bundles (Figure S3). To determine the relationship between MdHT2.2 expression and sugar content, fruit flesh was exposed to different sugars, and mRNA transcript levels were assayed. Compared to the control, which was exposed to sorbitol, MdHT2.2 expression was significantly induced by Fru and Glc (Figure 1c). These results indicate that MdHT2.2 might play an important role in the control of sugar accumulation and the uptake of hexose in apple fruit.
Figure 1

Spatiotemporal expression level analysis of Md. (a) Relative Md expression levels in different tissues from flower, young fruit, mature fruit, mature fruit peel and flesh, young leaf, mature leaves, old leaf, root, fruit pedicel, leaf pedicel, phloem and xylem of apple trees. The expression level in flower was set to 1. (b) Trends in relative expression of Md at different developmental stages of apple fruit. Samples from 0 days after bloom (DAB) were set to 1. (c) Change in the relative transcript level of Md after treating flesh samples for 6 h with 2% exogenous sugar (Sor: sorbitol; Glc: glucose; Fru: fructose; and Suc: sucrose, with ddH2O as a negative control, set to 1). Expression levels were calculated relative to that of MdActin. Bars represent the mean value ± SE (n ≥ 3). Different letters indicate significant differences.

Spatiotemporal expression level analysis of Md. (a) Relative Md expression levels in different tissues from flower, young fruit, mature fruit, mature fruit peel and flesh, young leaf, mature leaves, old leaf, root, fruit pedicel, leaf pedicel, phloem and xylem of apple trees. The expression level in flower was set to 1. (b) Trends in relative expression of Md at different developmental stages of apple fruit. Samples from 0 days after bloom (DAB) were set to 1. (c) Change in the relative transcript level of Md after treating flesh samples for 6 h with 2% exogenous sugar (Sor: sorbitol; Glc: glucose; Fru: fructose; and Suc: sucrose, with ddH2O as a negative control, set to 1). Expression levels were calculated relative to that of MdActin. Bars represent the mean value ± SE (n ≥ 3). Different letters indicate significant differences.

Subcellular localization of the MdHT2.2 protein

To examine the location of the MdHT2.2 protein, its ORF was cloned and linked to the GFP reporter gene to produce fusion proteins MdHT2.2‐GFP and GFP‐MdHT2.2 driven by the CaMV35S promoter. Confocal laser scanning microscopy (CLSM) showed the green fluorescence signal to be outside the vacuole (Figure 2), clearly demonstrating plasma membrane localization for MdHT2.2.
Figure 2

Subcellular localization of C/N‐terminal GFP fusion proteins in Arabidopsis protoplasts. (a,c) GFP expressed in the protoplast membrane, which is indicated by the green ring outside the tonoplast. (b,d) Bright‐field images of the left side images. (e,f) CaMV35S:GFP was widely expressed in the protoplast as the control. The tonoplast is indicated by white arrows.

Subcellular localization of C/N‐terminal GFP fusion proteins in Arabidopsis protoplasts. (a,c) GFP expressed in the protoplast membrane, which is indicated by the green ring outside the tonoplast. (b,d) Bright‐field images of the left side images. (e,f) CaMV35S:GFP was widely expressed in the protoplast as the control. The tonoplast is indicated by white arrows.

Functional characterization of MdHT2.2 in yeast

To examine the transport property of MdHT2.2, we cloned the MdHT2.2‐ORF into the vector pYST2.0 in either the sense or antisense orientation and expressed it in the HTs‐deficient yeast mutant EBY.VW4000, which is able to grow normally only on maltose (Wieczorke et al., 1999). EBY.VW4000 was transformed with pYST2.0‐MdHT2.2 in the sense orientation to analyse growth‐based complementation, and EBY.VW4000 transformed with MdHT2.2 in the antisense orientation was used as a control. Expression of the MdHT2.2 gene in the antisense orientation in this null mutant background did not restore growth on test sugar‐containing media (Figure 3a).
Figure 3

Heterologous expression of Md in yeast. (a) Growth complementation of a yeast mutant strain. The HT‐deficient yeast mutant carrying the empty pYST2.0 vector or the Md‐antisense recombinant plasmid could not grow normally on 4 monosaccharides, whereas the Md‐sense mutant yeast grew normally on fructose and glucose but slowly on galactose and xylose. (b) Relative uptake rates of feeding with 100 μm [14C]‐labelled exogenous sugars. For the inhibition assay, 50 μm CCCP (proton pump uncoupler) was applied for 30 s before the addition of [14C] fructose. The fructose uptake rate was set to 100%. Different letters indicate significant differences. (c) Time course of the sugar uptake assay by the strain carrying pYST2.0‐Md (black spot) and pYST2.0 empty vector (black rings, as negative control) at 100 μm exogenous [14C] fructose at pH = 5.5. Uptake rates were determined after the addition of fructose. The inset image shows a typical Km = 220.91 μm. Bars represent the mean value ± SE (n ≥ 4).

Heterologous expression of Md in yeast. (a) Growth complementation of a yeast mutant strain. The HT‐deficient yeast mutant carrying the empty pYST2.0 vector or the Md‐antisense recombinant plasmid could not grow normally on 4 monosaccharides, whereas the Md‐sense mutant yeast grew normally on fructose and glucose but slowly on galactose and xylose. (b) Relative uptake rates of feeding with 100 μm [14C]‐labelled exogenous sugars. For the inhibition assay, 50 μm CCCP (proton pump uncoupler) was applied for 30 s before the addition of [14C] fructose. The fructose uptake rate was set to 100%. Different letters indicate significant differences. (c) Time course of the sugar uptake assay by the strain carrying pYST2.0‐Md (black spot) and pYST2.0 empty vector (black rings, as negative control) at 100 μm exogenous [14C] fructose at pH = 5.5. Uptake rates were determined after the addition of fructose. The inset image shows a typical Km = 220.91 μm. Bars represent the mean value ± SE (n ≥ 4). The expression of MdHT2.2 in the sense orientation allowed the cells to grow on 2% Fru, Glc, galactose (Gal) and xylose (Xyl) (Figure 3a), and the fastest growth ratio was observed on Fru; on 0.2% Fru‐ or Glc‐containing medium, however, the transformed yeast grew very slowly. These results showed that the expression of recombinant MdHT2.2 could complement multiple deletions of endogenous yeast HT genes and that MdHT2.2 is a HTs with Fru and Glc transport activity. This finding was supported by transport assays that determined the transport capacity for 14C‐labelled hexose; the transport capacity for 14C‐Glc was slightly lower than that for 14C‐Fru, and transformed yeast cells were barely able to take up galactose and xylose (Figure 3b). The Km of MdHT2.2 for Fru was calculated to be approximately 220.91 μm (Figure 3c, inset). Additionally, a low concentration of the proton uncoupler carbonyl cyanide‐m‐chlorophenylhydrazone (CCCP) significantly reduced Fru uptake (Figure 3b), suggesting that sugar uptake via MdHT2.2 is driven by a proton gradient across the plasma membrane. Taken together, the results of heterologous expression in yeast indicate that MdHT2.2 is an energy‐dependent, low‐affinity monosaccharide/H+ symporter specific for Fru and Glc.

Heterologous expression of MdHT2.2 altered the growth status and sugar content of tomato plants

To further understand the function of MdHT2.2 in fruit sugar regulation, we heterologously expressed MdHT2.2 in tomato (S. lycopersicum cv. Micro‐Tom), which exhibits a short life cycle and a symplastic‐to‐apoplastic unloading phase change in fruit (Ruan and Patrick, 1995). Three homozygous lines (L5, L11 and L12) were obtained after evaluation at the RNA and protein levels (Figure S4C,D). The transgenic tomato plants displayed a significant dwarf phenotype with decreased height, stem diameter and internode length (Figure S4A, Table 1). However, the ripening fruit of the transgenic lines was larger than the wild‐type fruit (Figure S4B), and the fruit weight, transverse diameter and seed number were correspondingly notably increased (Table 1). Although the longitudinal diameter, carpel thickness and thousand‐seed weight did not change, the pericarp thickness decreased significantly, by approximately 35% (Table 1). The sugar concentration in the transgenic fruit was assayed at three stages of fruit development: young fruit [15 days after bloom (DAB)], breaker‐stage fruit (30 DAB) and ripening fruit (45 DAB) (Figure 4). The Suc concentrations in the fruit of transgenic lines were markedly higher than those in young (15 DAB) and breaker‐stage (30 DAB) wild‐type fruit. The Glc, Fru and starch concentrations were unchanged in those two stages. In ripening fruit (45 DAB), in which Suc is unloaded by the apoplastic pathway (Ruan and Patrick, 1995), the Suc concentrations were clearly decreased in the three transgenic lines; as expected, the Glc and Fru concentrations increased by approximately 29% and 15%, respectively, compared to those in the wild type. The soluble solid content (SSC) and starch content were also higher than those in the wild type (Figure 4). Additionally, the concentrations of citric acid and malic acid at 15 and 30 DAB were similar between transgenic lines and wild type, but at 45 DAB, malic acid level was less in the transgenic lines, opposite to citric acid (Figure S5).
Table 1

Phenotypic characteristics of transgenic tomato fruit and plants

PhenotypeWTL5L11L12
FruitFruit number (/plant)11 ± 1.2212.8 ± 1.6411.4 ± 1.6712.8 ± 2.35
Single fruit weight (g/fruit)2.48 ± 0.193.45 ± 0.48*3.19 ± 0.21*3.35 ± 0.31*
Transverse diameter (mm)16.45 ± 1.2518.40 ± 1.19*17.86 ± 1.75*18.28 ± 1.40*
Vertical diameter (mm)16.38 ± 0.6617.35 ± 1.2016.99 ± 1.6216.42 ± 0.59
Pericarp thickness (mm)2.08 ± 0.251.16 ± 0.15*1.48 ± 0.23*1.28 ± 0.11*
Carpel thickness (mm)1.10 ± 0.141.13 ± 0.151.11 ± 0.121.11 ± 0.17
Average seed number16.09 ± 1.9725.75 ± 2.54*24.66 ± 3.93*25.87 ± 2.94*
Thousand‐seed weight (g)2.76 ± 0.202.53 ± 0.342.58 ± 0.252.52 ± 0.18
PlantHeight (cm)18.76 ± 0.9213.76 ± 0.54*12.54 ± 0.87*13.46 ± 0.71*
Stem diameter (mm)6.39 ± 0.615.13 ± 0.54*5.44 ± 0.62*5.52 ± 0.69*
Internode length (cm)3.96 ± 0.142.99 ± 0.26*3.10 ± 0.12*3.23 ± 0.23*

The seeds of 10–50 independent fruits from each line were counted for the 1000‐seed weight. Values are the mean ± SE (n ≥ 3). The asterisk indicates P ≤ 0.05.

Figure 4

Sugar concentrations in tomato fruit. Glucose (Glc), fructose (Fru), sucrose (Suc) and starch concentrations at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit), and SSC (soluble solid content) in 45‐DAB fruit. Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 4). The asterisk indicates P ≤ 0.05.

Phenotypic characteristics of transgenic tomato fruit and plants The seeds of 10–50 independent fruits from each line were counted for the 1000‐seed weight. Values are the mean ± SE (n ≥ 3). The asterisk indicates P ≤ 0.05. Sugar concentrations in tomato fruit. Glucose (Glc), fructose (Fru), sucrose (Suc) and starch concentrations at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit), and SSC (soluble solid content) in 45‐DAB fruit. Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 4). The asterisk indicates P ≤ 0.05.

Enzyme assays and expression levels of members of the sugar metabolism pathway in fruits of the transgenic lines

To determine why the sugar concentration changed in the transgenic tomato fruit expressing MdHT2.2 (especially ripening fruits with decreased Suc), enzyme activity and gene expression related to sugar metabolism were detected in developing fruit. CWINV activities in both WT and transgenic lines were increased during fruit development, although activity in the transgenic lines was increased by less than twofold compared to that of the wild type at 45 DAB (Figure 5a). Staining of acid invertase in 45‐DAB fruit also indicated greater activity in transgenic lines than in the wild type (Figure 5b). In contrast, the activities of neutral invertase (NINV), vacuolar invertase (VINV) and sucrose synthase (SUSY), all of which are related to Suc dissociation, were significantly reduced in 45‐DAB fruit of the transgenic lines compared with that of the wild type, and sucrose phosphate synthase (SPS), which is involved in Suc synthesis, showed increased activity (Figure 5a). These results indicate that the decreased Suc concentration in the MdHT2.2‐transgenic fruit was due to increased cleavage of Suc into hexose via CWINV in the cell wall space. The lower activities of CWINV and NINV compared to the wild type in the leaves of the transgenic lines (Figure S7) were consistent with the increased Suc concentration, as shown in Figure S6.
Figure 5

Assay of enzymes involved in sugar metabolism in tomato fruit. (a) Enzyme activity of CWINV (cell wall invertase), NINV (neutral invertase), SUSY (sucrose synthase), SPS (sucrose phosphate synthase) and VINV (vacuolar invertase) in tomato fruit at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit). Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 4). The asterisk indicates P ≤ 0.05. (b) Acid invertase activity staining of ripening tomato fruit in 45 DAB (ripening fruit). Black bar = 1 cm.

Assay of enzymes involved in sugar metabolism in tomato fruit. (a) Enzyme activity of CWINV (cell wall invertase), NINV (neutral invertase), SUSY (sucrose synthase), SPS (sucrose phosphate synthase) and VINV (vacuolar invertase) in tomato fruit at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit). Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 4). The asterisk indicates P ≤ 0.05. (b) Acid invertase activity staining of ripening tomato fruit in 45 DAB (ripening fruit). Black bar = 1 cm. To further identify key genes that contribute to these activities in the transgenic lines, the transcript abundance of key genes encoding these enzymes and transporters was detected. Among the four genes encoding tomato CWINV proteins, SlLIN5 was highly expressed in fruit, especially in the transgenic lines at 30 and 45 DAB, and CWINV activity was high, even though SlLIN8 expression was significantly increased only at 45 DAB. Indeed, the expression level of SlLIN5 was more than 10 times greater than that in the wild type (Figure 6); the changes in SlLIN6/7 expression levels were inconsistent with the changes in CWINV activity in developing fruit. Correspondingly, the expression levels of SlNINV, SlVINV and SlSUSY were decreased in the 45‐DAB fruit of MdHT2.2‐transgenic tomato compared with those in the wild type, but the expression of SlSPS increased in the transgenic lines. In addition, three key HTs, SlHT1/2/3, exhibited significantly decreased expression in the transgenic fruits, while expression of the tonoplast sugar transporter SlTST2 was significantly increased in 15‐ and 30‐DAB fruit of the transgenic lines. The Suc transporters SlSUT1 and SlSUT2, which move Suc into the cytosol, exhibited decreased expression in the transgenic tomato fruit, especially at 45 DAB. These findings further suggest that Suc cleavage in the cell wall space was increased in MdHT2.2‐transgenic tomato fruit but that the capacity for Suc absorption via SUT decreased.
Figure 6

Relative expression levels of several enzymes and sugar transporter genes in the unloading pathway at different developmental stages of tomato fruit. Total RNA was isolated from fruit samples collected at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit), and expression levels were calculated relative to that of SlActin. The expression of WT at 15 DAB was set to 1. Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 3). The asterisk indicates P ≤ 0.05.

Relative expression levels of several enzymes and sugar transporter genes in the unloading pathway at different developmental stages of tomato fruit. Total RNA was isolated from fruit samples collected at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit) and 45 DAB (ripening fruit), and expression levels were calculated relative to that of SlActin. The expression of WT at 15 DAB was set to 1. Bars of different colours represent different lines. Bars represent the mean value ± SE (n ≥ 3). The asterisk indicates P ≤ 0.05. In mature leaves of the transgenic lines, the expression patterns of SlLIN5/8 and SININV were consistent with the decreased activities compared with the wild type (Figure S8), and the SlHT1/2/3 and SlSUSY1/4 expression levels were obviously down‐regulated. The expression of SlTST1 in the transgenic leaves decreased to less than 40% of the expression in the wild type, whereas the opposite was observed for SlTST2.

Sugar concentration in the sllin5 mutant of MdHT2.2‐transgenic tomato fruit

To confirm whether up‐regulated SlLIN5 expression was mainly responsible for altering the sugar content in ripening tomato fruit with expressed MdHT2.2, we produced sllin5 mutant lines from the wild type and the MdHT2.2‐transgenic line L5 using the CRISPR‐Cas9 method. Special target sequences for CRISPR‐Cas9 were designed at the 5′‐end of the SlLIN5 ORF. We thereby obtained lines with mutations of sllin5, and sequencing revealed that editing the target genes had produced frameshift mutants (Figure 7a). Two mutant lines for the wild type (WT‐sllin5‐1 and WT‐sllin5‐2) and L5 (L5‐sllin5‐1 and L5‐sllin5‐2) were employed to investigate CWINV activity and sugar concentration in fruit. In ripening fruit of WT‐sllin5‐1 and WT‐sllin5‐2, the activities of CWINV were less than 50% of that in the wild type, and the concentrations of Fru, Glc and SSC were significantly decreased; however, the Suc concentration was nearly 1.5‐fold that in the wild type (Figure 7b–d). In the fruit of L5‐sllin5‐1 and L5‐sllin5‐2, CWINV activities decreased to approximately 50% of that in L5 (as the parent), but the sugar concentration returned to that of the wild type, and the Suc concentration was slightly higher than that of the wild type (Figure 7b–d). To examine the reason CWINV activity in L5‐sllin5‐knockout plants had not decreased to that in WT‐sllin5‐knockout plants, the expression levels of other CWINV genes were detected. SlLIN8 showed much more up‐regulated expression than did transgenic line L5 (Figure S9). These results suggest that SlLIN8 performs complementary functions for SlLIN5 in tomato fruit overexpressing MdHT2.2.
Figure 7

The sugar concentration and CWINV enzyme assay of lin5‐knockout mutant lines. (a) The DNA sequence of the target region; Sl was the target sequence chosen from CRISPR direct (http://crispr.dbcls.jp/) and used with the CRISPR‐Cas9 system in this study. The Sl sequence is the DNA sequence in the reference genome database of NCBI. Sequences were aligned using DNAMAN. The dark region is the target sequence, the blue region was the difference in sequence between those lines, the target sequences of WT and L5 were the same as the control, the edited lines WT‐sllin5‐1 and L5‐sllin5‐1/2 had 4 bases missing, and WT‐sllin5‐2 had 1 base insert. (b,c) CWINV activities of ripening fruit in different lines (WT, Md‐heterologous expression line L5, WT‐sllin5‐knockout lines, L5‐sllin5‐knockout lines). (d) glucose (Glc), fructose (Fru) and sucrose (Suc) concentrations and SSC (soluble solid content) in ripening fruit. Bars represent the mean value ± SE (n ≥ 4). Different letters indicate significant differences at P ≤ 0.05.

The sugar concentration and CWINV enzyme assay of lin5‐knockout mutant lines. (a) The DNA sequence of the target region; Sl was the target sequence chosen from CRISPR direct (http://crispr.dbcls.jp/) and used with the CRISPR‐Cas9 system in this study. The Sl sequence is the DNA sequence in the reference genome database of NCBI. Sequences were aligned using DNAMAN. The dark region is the target sequence, the blue region was the difference in sequence between those lines, the target sequences of WT and L5 were the same as the control, the edited lines WT‐sllin5‐1 and L5‐sllin5‐1/2 had 4 bases missing, and WT‐sllin5‐2 had 1 base insert. (b,c) CWINV activities of ripening fruit in different lines (WT, Md‐heterologous expression line L5, WT‐sllin5‐knockout lines, L5‐sllin5‐knockout lines). (d) glucose (Glc), fructose (Fru) and sucrose (Suc) concentrations and SSC (soluble solid content) in ripening fruit. Bars represent the mean value ± SE (n ≥ 4). Different letters indicate significant differences at P ≤ 0.05.

Discussion

MdHT2.2, as a new hexose transporter, was involved in the unloading and uptake of fructose and glucose in apple fruit

Functional characterization of HTs has mostly been performed in model plants, for example, Arabidopsis and rice (Slewinski, 2011). Most of these transporters take up hexose from the apoplasm in source or sink tissues to meet the carbon requirements of specialized cell types such as guard cells, pollen grains and pollen tubes (Rottmann et al., 2016; Slewinski, 2011), though the hexose concentrations in these tissues/cells in physiological contexts are very low and rarely exceed 10 mm. However, little is known about HTs expressed in organs that accumulate hexose to high concentrations (more than 100 mm), such as sugar beet taproots (Jung et al., 2015) and fruit flesh (e.g. apple, Li et al., 2018; grape, Afoufa‐Bastien et al., 2010; watermelon, Ren et al., 2018; tomato, McCurdy et al., 2010). The present study builds on our knowledge of HTs expressed in apple fruit (Wei et al., 2014), in which hexose accumulates to concentrations of up to 300 mm. In apple fruit, Suc and Sor enter the PCs via the apoplastic pathway after being released from the SE‐CC complex (Zhang et al., 2004) and contribute to Suc import via hydrolysis into hexose by CWINV (Zhang et al., 2004; ;Li et al., 2012). As Sor transport is inhibited by high hexose concentrations (Gao et al., 2003), high HT activity is needed to move Glc and Fru from the cell wall spaces into PCs in apple fruit (Wei et al., 2014). Phylogenetic analysis (Figure S1) demonstrated that MdHT2.2 shares high amino acid sequence identity with AtSTP14 in Arabidopsis, which is a galactose substrate‐specific transporter located at the plasma membrane (Poschet et al., 2010). In our study, MdHT2.2‐GFP and GFP‐MdHT2.2 fusion proteins were localized to the plasma membrane in Arabidopsis cells, but the MdHT2.2 protein exhibited different substrate specificity for hexose in yeast. Similar results have been reported for TST homologous proteins from different plants with different substrate specificities (Jung et al., 2015; Ren et al., 2018). As shown for most apple fruit (Li et al., 2018), the soluble sugar content of the mature fruit of ‘Gala’ apple contains more than 50% Fru, followed by Suc, though much Fru leaks into the apoplastic space because of Suc apoplastic unloading, the high Fru concentration gradient or cell damage. The high transport activity of the MdHT2.2 protein for Fru supports the requirement that leaked Fru and Glc be efficiently transported into cells. The patterns for Fru and Glc were similar in transgenic tomatoes heterologously expressing MdHT2.2. These results indicate that MdHT2.2 is a new sugar/H+ symporter with high transport activity for Fru in addition to Glc. In apple fruit, the apoplastic unloading of Suc and Sor can be affected by the unloading activity of the fruit. In many species (e.g. mature tomato fruit) that employ apoplastic unloading for Suc in sink cells, Suc is mainly converted to Glc and Fru by CWINV in the cell wall space and then transported into PCs by HT. However, in apple fruit, the expression of MdCWINVs was lower in developing fruit than in shoot tips (Li et al., 2012), and we postulate that to avoid the inhibition of Sor uptake by Suc‐derived Glc and Fru, most Suc is directly transported into PCs by plasma membrane‐bound SUCs in apple fruit (Li et al., 2016, 2018) that partly derived Glc and Fru are transported into cells by high‐activity MdHT2.2. During the late stage of fruit development, in addition to hexose derived from unloaded Suc, more Fru would passively leak from cells into the extracellular space and need to be taken up by the sugar transporter (Fillion et al., 1999), which is consistent with the higher level of MdHT2.2 expression. MdHT2.2 in apple fruit mainly functions in both the unloading and uptake of Fru and Glc from the cell wall space.

Heterologous expression of MdHT2.2 altered sugar concentration and metabolism in tomato fruit

In tomato fruit, three HT genes have been colocalized with QTLs for sugar accumulation (Prudent et al., 2011). This relationship was further verified by RNAi knockdowns of the three SlHTs (McCurdy et al., 2010), which are highly homologous to MdHT2.2. Although overexpressing or silencing in apple plants is the best way to identify the function of MdHT2.2 in controlling the sugar content in fruit, apple transformation is very difficult, and there is a 4‐ to 6‐year juvenile phase for fruit set. Therefore, we heterologously expressed MdHT2.2 in tomato to determine its role in controlling sugar concentration in fruit. As expected, the concentrations of Fru and Glc in mature fruit increased significantly due to MdHT2.2 overexpression, but the Suc concentration markedly decreased. This result was expected, as it was previously reported that the post‐translational elevation of CWINV activity by silencing its inhibitor increased tomato fruit hexose levels and reduced Suc concentrations (Jin et al., 2009). Suc is involved in apoplasmic unloading in mature tomato fruit (Ruan and Patrick, 1995), and the Suc that is transferred from SE‐CC complexes into the apoplastic space is mainly converted into hexose and then transported into PCs by the CWINV‐HT system (Jin et al., 2009; Wang and Ruan, 2012). The overexpression of MdHT2.2 increased the transport capacity for Fru and Glc from the apoplastic space into PCs, which led to a decrease in instantaneous sugar concentration in the apoplastic space. In transgenic tomato, CWINV, which is typically considered a sink‐specific enzyme (Wan et al., 2018), was greatly increased with up‐regulated expression of SlLIN5, a key gene encoding a CWINV protein in tomato fruit (Jin et al., 2009), and SlLIN8 expression was also obviously increased in ripening fruit (Figure 6). As a result, more Suc was converted to Fru and Glc by the increased CWINV activity in the cell wall space, and more hexose molecules were transported by MdHT2.2 into cells and accumulated in the transgenic tomato fruit; in contrast, less Suc was moved into PCs by SUT. The decreased expression of SlSUT1 and SlSUT2, two key Suc transporters involved in Suc unloading into PCs (Milne et al., 2018) that can be induced by increasing the Suc concentration (Milne et al., 2018), is consistent with the observed decreased concentration of Suc in the apoplastic space of the transgenic tomato fruit. This was further verified by the decreased gene expression and enzyme activities of SUSY and NINV (Figures 5 and 6), both of which regulate sugar metabolic homeostasis and are induced by Suc (Li et al., 2018; Nguyen‐Quoc and Foyer, 2001). Overall, these results suggest that the alteration in sugar concentration (increased hexose and decreased Suc) in the mature fruit of tomato heterologously expressing MdHT2.2 can be mainly attributed to up‐regulated SlLIN5 expression and increased CWINV activity. This interpretation was confirmed by the fact that in the sllin5 mutants in the MdHT2.2‐transgenic background produced by the CRISPR‐Cas9 method, the concentrations of Fru and Glc were restored almost to the wild‐type levels, and the Suc concentration was slightly higher than that in the wild type; however, the CWINV activities in the L5‐sllin5 mutant lines were reduced to the level in the wild type. For these sllin5 mutant lines in the MdHT2.2 background, greater up‐regulation of SlLIN8 expression would be the main reason CWINV activity decreased to that of the WT‐sllin5 knockout. Nonetheless, Fru and Glc concentrations did not increase in the leaves and young fruit of MdHT2.2‐transgenic tomato when compared to wild‐type tomato but rather decreased slightly, even though Suc levels were significantly increased. Photosynthesis was unchanged in the mature leaves of MdHT2.2‐transgenic tomato, but the enzyme activities of CWINV and NINV, both of which cleave Suc to hexose (Nguyen‐Quoc and Foyer, 2001), were significantly decreased, and the expression levels of SlLIN5/8, SlNINV and SlSUSY1/4 were reduced. Therefore, the increased Suc concentration in the leaves of transformed plants might be partly due to decreased Suc decomposition. MdHT2.2 should be expressed in all living cells of these transgenic plants, including phloem SE‐CC cells and leaves, because expression was driven by the constitutive CaMV35S promoter (Gittins et al., 2001). Decreased CWINV activities would decrease the hexose content in the apoplastic space around the phloem SE‐CC complexes of mature leaves, which would decrease the amount of hexose in phloem as much as possible because Fru and Glc cannot be transported in the phloem (Liu et al., 2016). Interestingly, as an adaptive response to extracellular hexose signalling, the pathway regulating SlLIN5 expression would differ in leaves and mature fruit in tomato. In the early stages of tomato fruit development, Suc moves from the SE‐CC complex directly to surrounding PCs via plasmodesmata; in mature leaves, Suc is loaded via the symplastic pathway (Ruan and Patrick, 1995). The increased Suc concentration in mature leaves should be the main reason the Suc concentration was higher in the young fruit of MdHT2.2‐expressing plants than in wild‐type plants because long‐range Suc transport in the symplastic system is determined by its chemical gradient from source to sink (Comtet et al., 2017; Patrick, 1997). Additionally, up‐regulated SlTST2 expression (as in leaves) also enhanced Suc accumulation in the vacuole of young transgenic tomato fruit, but its expression decreased in mature fruit. These results indicate that the different changes in sugars between young and mature fruit of MdHT2.2‐expressing tomato might be related to the unloading pathway of Suc and the system sensing the extracellular hexose signal. In summary, MdHT2.2 mainly functions in efficiently taking up Glc or Fru from the cell wall space and moving these sugars into cells in apple fruit. In mature apple fruit, hexose (especially Fru) accumulates to concentrations of up to 300 mm, and Suc is unloaded via the apoplastic pathway (Zhang and Turgeon, 2009). A high level of MdHT2.2 expression in mature fruit meets the requirement for transferring Fru and Glc from cell wall spaces into PCs. Although we did not directly confirm the function of MdHT2.2 at the genetic level in apple plants, the fact that heterologous expression increased fruit size and Fru and Glc contents in mature tomato fruit demonstrates its role in hexose unloading in fruit. Interestingly, the overexpression of MdHT2.2 decreased relative hexose levels in the apoplastic space of mature tomato fruit, up‐regulating the expression of SlLIN5/8 and the activity of CWINV but decreasing the Suc concentration. This result offers new insight into the regulatory mechanism by which apoplastic hexose signalling regulated by HT controls Suc partitioning and transport and the sugar content in fruit through the apoplastic unloading pathway of Suc. Conversely, in mature leaves where Suc is mainly loaded via the symplastic pathway, CWINV activity and SlLIN5/8 expression decreased with MdHT2.2 overexpression, suggesting that the response pathway of the apoplastic hexose signal differs between tomato leaves and mature fruit. This mechanism will be better understood when the factors regulating SlLIN5 expression and how apoplastic hexose signals sense and transmit in different plant tissues are verified. In addition to having a high sugar content and large fruit size, transgenic tomatoes heterologously expressing MdHT2.2 also showed other advantageous traits, such as early flowering, dwarfness, thinned pericarp, and effective pollination and fertilization. These results suggest that MdHT2.2 is a potential candidate gene for use in improving fruit quality.

Materials and methods

Plant material

The samples of ‘Gala’ apple (M. domestica) were the same as those used in our previous report (Wei et al., 2014). At 0, 15, 30, 47, 61, 75, 92, 104 and 120 DAB, fruits were sampled between 3:00 PM and 4:00 PM. On each collection date, six apples per replicate were harvested from three trees, with a total of five replicates. The fruits were immediately weighed, cut into small pieces after removing the core and frozen on‐site in liquid nitrogen; the pedicel, peel and flesh were sampled at 120 DAB. Additionally, flowers, young leaves, mature leaves, old leaves and roots were collected. All frozen samples were stored at −80 °C. Fresh tissues from the fruit of ‘Gala’ apple (104 DAB) were collected using a 1.0‐cm‐diameter cork borer and cut into discs of 0.3 cm thick. As described by Hancock et al. (2003), fresh samples were preincubated in 20 mL of buffer containing 2% sugar, 20 mm MES (pH 5.5), 5 mm MgCl2, 2 mm KCl, 1 mm CaCl2 and 1 mm CaSO4. The sugar sources were Sor, Glc, Fru and Suc, with ddH2O as the negative control. Following incubation for 6 h on a rotary shaker (100 r.p.m.) at 25 °C, samples were washed with sterile water and surface‐dried on filter paper, followed by immersion in liquid nitrogen for later investigation of MdHT2.2 expression. Tomato (S. lycopersicum cv. Micro‐Tom) was grown in a culture room at 70% relative humidity with 16 h of light at 25 °C and 8 h of darkness at 22 °C. The flowers were tagged at full bloom to determine fruit age. Fruits were sampled in this study at 15 (young fruit), 35 (breaker‐stage fruit) and 45 (mature fruit) DAB.

Cloning of MdHT2.2

The MdHT2.2 sequence (MD15G1193400/MDP0000154362) was retrieved from the Malus Genome Database (http://www.rosaceae.org). Total RNA was extracted from mature fruits of ‘Gala’ apple, and cDNA was synthesized using PrimeScript™ II Reverse Transcriptase (Takara, Dalian,China). MdHT2.2 was cloned using specific primers, and the cDNA was obtained as the template (Table S2).

Protoplast isolation and subcellular location

Protoplasts were obtained from Arabidopsis cell suspension cultures as described by Schirawski et al. (2000). The protoplasts of Arabidopsis thaliana suspension cells were centrifuged at 80  for 5 min, resuspended and digested by pectolyase and cellulase, filtered through a sterilized 40‐mm stainless steel sieve, washed several times with medium B and diluted. MdHT2.2 was cloned into pGWB405 and pGWB406 vectors with C‐terminal GFP and N‐terminal GFP, respectively. Both of these vectors carry a kanamycin resistance gene and the CaMV35S promoter. The recombinant plasmids were purified using a Qiagen Midi Kit (Qiagen, Hilden, Germany). For transfection, 7.5 μg of plasmid was used per 2.5 × 105 protoplasts. The plasmid was immediately mixed twice with the protoplasts and PEG‐containing solution. The mixture was left for 10 min at room temperature, after which the protoplasts were incubated in 4.5 mL of culture medium in 6‐well plates in the dark at 24 °C and 70% humidity. GFP fluorescence was visualized by CLSM.

Heterologous expression of MdHT2.2 in yeast

MdHT2.2‐ORF was inserted into the pYST2.0 vector, which carries the ampicillin‐resistance gene, and transferred into the sugar transporter‐deficient yeast strain EBY.VW4000 (Wieczorke et al., 1999). The growth of EBY.VW4000 expressing MdHT2.2 was assessed on culture media containing 2% concentrations of different sugars; controls were transformed with the vector carrying MdHT2.2 in the antisense orientation. For uptake experiments, 14C‐labelled sugars were used. A single clone of EBY.VW4000 containing the MdHT2.2 gene or empty vector was precultured on maltose–amino acid medium [0.67% (w/v) yeast nitrogen base, 1% (w/v) casamino acids, 0.002% (w/v) tryptophan and 2% (w/v) maltose] to an A 600 of 0.8, and transport tests were performed as described by McCurdy et al. (2010). For inhibitor assays, a final concentration of 50 μm CCCP (as a proton uncoupler) was added to yeast cells 30 s before the addition of [14C] Fru.

Tomato plant transformation

MdHT2.2‐ORF was inserted into the gateway vector pGWB402 carrying the CaMV35S promoter and kanamycin resistance, and the recombinant plasmid was transformed into EHA105 competent cells for plant transformation. The transformation methods for Micro‐Tom tomato are according to Sun et al. (2006). Tomato plants were grown at 25 °C, and the 16‐h photoperiod was supplemented with lamps at 120 μmol/m2/s. The transgenic lines were screened by kanamycin resistance and PCR analysis, and the homozygous lines were confirmed without character segregation until the T3 generation. For the CRISPR‐Cas9 experiment, the target sequence (TAGCCGGGATGGCGTAGTTCTGG) for SlLIN5 was designed using CRISPR direct (http://crispr.dbcls.jp/), and the sequence specificity was confirmed by BLAST in NCBI. After checking the specificity in Micro‐Tom tomato, the target sequence was synthesized and cloned into the pHSE401 vector as described by Xing et al. (2014). After transforming the plasmid into EHA105, the transgenic lines were screened by hygromycin resistance and sequencing, and the T2 generation was used in this study.

Enzyme assay and expression analysis

The exact methods described by Li et al. (2012) were used to extract and determine the activities of CWINV, NINV, VINV, SUSY and SPS in tomato fruit samples in this study. Soluble proteins were measured using Coomassie blue, and enzyme activities were expressed on a protein basis. Staining for tomato fruit acid invertase was performed according to Wang and Ruan (2012). Total RNA was isolated from frozen samples, and cDNA was synthesized using PrimeScript™ II Reverse Transcriptase (Takara, Dalian,China). Gene‐specific primers were checked in NCBI and examined by RT‐PCR and melting curve analysis. PCR products were quantified using a LightCycler® 96 real‐time PCR detection system (Roche, Basel, Switzerland) with LightCycler Ultra SYBR Mixture (CWBIO, Beijing, China). MdActin for apple and LeActin for tomato were used for the normalization of target gene transcripts using the method. The primers are listed in Table S2.

Protein detection and protein blot analysis

Protein measurements were conducted according to previous protocols (Yang et al., 2018). Total protein concentrations were determined with protein assay kits (Bio‐Rad, California, USA) using bovine serum albumin as a standard. Specific monoclonal antibodies were raised against a peptide (NVARAIKNPFRNLLC) of MdHT2.2 protein, and this antibody was raised in rabbits (GenScript, Nanjing, China). Actin was monitored using a monoclonal antibody (CWBIO). The procedures for Western blotting followed Sun et al. (2018). The antigen–antibody complexes were detected using Clarity™ Western ECL Substrate (Bio‐Rad) according to the manufacturer's instructions.

Sugar and starch concentration measurement

As previously described (Li et al., 2018; Yang et al., 2018), soluble sugars and hexose phosphates were extracted in 75% methanol with ribitol added as an internal standard and then derivatized sequentially with methoxyamine hydrochloride and N‐methyl‐N‐trimethylsilyl‐trifluoroacetamide. After derivatization, the metabolites were analysed using a Shimadzu GCMS‐2010SE (Shimadzu Corporation, Tokyo, Japan) with a DB‐5MS capillary column (20 m × 0.18 mm × 0.18 μm) and a 5‐m Duraguard column (Agilent Technology, California, USA). The residue after 75% methanol extraction for GC‐MS analysis was re‐extracted three times with 80% (v/v) ethanol at 80 °C, and the pellet was retained for the enzymatic determination of starch as Glc equivalents.

Statistical analysis

All data were analysed using IBM SPSS Statistics 21 (IBM Corp., Chicago, USA) and graphed with Sigma Plot 12.0 software (Systat software, California, USA). Data were analysed using independent t‐tests at a significance level of P ≤ 0.05. Values are presented as the means ± standard error (SE) in at least biological triplicate for each measurement.

Conflict of interest

The authors declare that they have no conflict of interest.

Author contributions

M.L. and F.M. conceived and supervised this study; M.L., Z.W. and L.C. designed the experiments; Z.W., X.W., J.Y., H.L., K.Z., Y.Z. and B.M. performed the experiments; Z.W. and M.L. wrote the original draft; and all authors reviewed and edited the manuscript. Figure S1 Phylogenetic tree analysis and transmembrane structure prediction of MdHT2.2. Click here for additional data file. Figure S2 Changes in glucose (Glc), fructose (Fru) and sucrose (Suc) concentrations at different developmental stages of apple fruit; samples were compared to 0 days after bloom (DAB). Click here for additional data file. Figure S3 Relative expression levels of MdHT2.2 in enriched parenchymal cells, the petal and sepal bundle vascular region of ripening fruit. Click here for additional data file. Figure S4 Phenotype and identification of transgenic tomato plants. Click here for additional data file. Figure S5 Malic acid and citric acid concentrations in tomato fruit at 15 DAB (young fruit), 30 DAB (breaker‐stage fruit), and 45 DAB (ripening fruit). Click here for additional data file. Figure S6 Changes in glucose (Glc), fructose (Fru), sucrose (Suc), starch, malic acid and citric acid concentrations in mature leaves of MdHT2.2‐expressing tomato. Click here for additional data file. Figure S7 Enzyme assay of CWINV (cell wall invertase), NINV (neutral invertase), SUSY (sucrose synthase), SPS (sucrose phosphate synthase) and VINV (vacuolar invertase) in mature tomato leaves. Click here for additional data file. Figure S8 Relative expression levels of several enzymes and sugar transporter genes in mature tomato leaves. Click here for additional data file. Figure S9 Relative expression levels of SlLIN6, SlLIN7 and SlLIN8 in ripening tomato fruit of lin5‐knockout mutant lines. Click here for additional data file. Table S1 Correlation analysis between MdHT2.2 expression level and sugar concentrations. Table S2 Primers used in this study. Click here for additional data file.
  40 in total

1.  An improved protocol for the preparation of protoplasts from an established Arabidopsis thaliana cell suspension culture and infection with RNA of turnip yellow mosaic tymovirus: a simple and reliable method.

Authors:  J Schirawski; S Planchais; A L Haenni
Journal:  J Virol Methods       Date:  2000-04       Impact factor: 2.014

Review 2.  Evolution of Sucrose Metabolism: The Dichotomy of Invertases and Beyond.

Authors:  Hongjian Wan; Limin Wu; Yuejian Yang; Guozhi Zhou; Yong-Ling Ruan
Journal:  Trends Plant Sci       Date:  2017-11-25       Impact factor: 18.313

3.  Identification and characterization of AtSTP14, a novel galactose transporter from Arabidopsis.

Authors:  Gernot Poschet; Barbara Hannich; Michael Büttner
Journal:  Plant Cell Physiol       Date:  2010-07-13       Impact factor: 4.927

4.  Sucrose phloem unloading follows an apoplastic pathway with high sucrose synthase in Actinidia fruit.

Authors:  Cheng Chen; Yulin Yuan; Chen Zhang; Huixia Li; Fengwang Ma; Mingjun Li
Journal:  Plant Sci       Date:  2016-11-25       Impact factor: 4.729

5.  Cloning, expression, and characterization of sorbitol transporters from developing sour cherry fruit and leaf sink tissues.

Authors:  Zhifang Gao; Laurence Maurousset; Remi Lemoine; Sang-Dong Yoo; Steven van Nocker; Wayne Loescher
Journal:  Plant Physiol       Date:  2003-04       Impact factor: 8.340

6.  PHLOEM UNLOADING: Sieve Element Unloading and Post-Sieve Element Transport.

Authors:  J. W. Patrick
Journal:  Annu Rev Plant Physiol Plant Mol Biol       Date:  1997-06

7.  Combining ecophysiological modelling and quantitative trait locus analysis to identify key elementary processes underlying tomato fruit sugar concentration.

Authors:  Marion Prudent; Alain Lecomte; Jean-Paul Bouchet; Nadia Bertin; Mathilde Causse; Michel Génard
Journal:  J Exp Bot       Date:  2010-10-29       Impact factor: 6.992

8.  Expression patterns of genes involved in sugar metabolism and accumulation during apple fruit development.

Authors:  Mingjun Li; Fengjuan Feng; Lailiang Cheng
Journal:  PLoS One       Date:  2012-03-07       Impact factor: 3.240

9.  Synthesis of L-ascorbic acid in the phloem.

Authors:  Robert D Hancock; Diane McRae; Sophie Haupt; Roberto Viola
Journal:  BMC Plant Biol       Date:  2003-11-24       Impact factor: 4.215

10.  Improvement of drought tolerance by overexpressing MdATG18a is mediated by modified antioxidant system and activated autophagy in transgenic apple.

Authors:  Xun Sun; Ping Wang; Xin Jia; Liuqing Huo; Runmin Che; Fengwang Ma
Journal:  Plant Biotechnol J       Date:  2017-08-22       Impact factor: 9.803

View more
  9 in total

1.  ABA-Induced Sugar Transporter TaSTP6 Promotes Wheat Susceptibility to Stripe Rust.

Authors:  Baoyu Huai; Qian Yang; Yingrui Qian; Wenhao Qian; Zhensheng Kang; Jie Liu
Journal:  Plant Physiol       Date:  2019-09-20       Impact factor: 8.340

2.  Cell Wall Invertase Is Essential for Ovule Development through Sugar Signaling Rather Than Provision of Carbon Nutrients.

Authors:  Shengjin Liao; Lu Wang; Jun Li; Yong-Ling Ruan
Journal:  Plant Physiol       Date:  2020-04-24       Impact factor: 8.340

3.  Physiological responses and expression of sugar associated genes in faba bean (Vicia faba L.) exposed to osmotic stress.

Authors:  Emna Ghouili; Khaled Sassi; Moez Jebara; Yassine Hidri; Rim Nefissi Ouertani; Yordan Muhovski; Salwa Harzalli Jebara; Mohamed El Ayed; Souhir Abdelkarim; Oumaima Chaieb; Selim Jallouli; Fatma Kalleli; Mahmoud M'hamdi; Fatma Souissi; Ghassen Abid
Journal:  Physiol Mol Biol Plants       Date:  2021-01-29

4.  MdERDL6-mediated glucose efflux to the cytosol promotes sugar accumulation in the vacuole through up-regulating TSTs in apple and tomato.

Authors:  Lingcheng Zhu; Baiyun Li; Limin Wu; Huixia Li; Zhengyang Wang; Xiaoyu Wei; Baiquan Ma; Yanfeng Zhang; Fengwang Ma; Yong-Ling Ruan; Mingjun Li
Journal:  Proc Natl Acad Sci U S A       Date:  2020-12-21       Impact factor: 11.205

5.  First genetic maps development and QTL mining in Ranunculus asiaticus L. through ddRADseq.

Authors:  Matteo Martina; Alberto Acquadro; Davide Gulino; Fabio Brusco; Mario Rabaglio; Ezio Portis; Sergio Lanteri
Journal:  Front Plant Sci       Date:  2022-09-23       Impact factor: 6.627

6.  MdFRK2-mediated sugar metabolism accelerates cellulose accumulation in apple and poplar.

Authors:  Jing Su; Chunxia Zhang; Lingcheng Zhu; Nanxiang Yang; Jingjing Yang; Baiquan Ma; Fengwang Ma; Mingjun Li
Journal:  Biotechnol Biofuels       Date:  2021-06-15       Impact factor: 6.040

7.  Plasma membrane-localized SlSWEET7a and SlSWEET14 regulate sugar transport and storage in tomato fruits.

Authors:  Xinsheng Zhang; Chaoyang Feng; Manning Wang; Tianlai Li; Xin Liu; Jing Jiang
Journal:  Hortic Res       Date:  2021-08-01       Impact factor: 6.793

8.  Integrating Sugar Metabolism With Transport: Elevation of Endogenous Cell Wall Invertase Activity Up-Regulates SlHT2 and SlSWEET12c Expression for Early Fruit Development in Tomato.

Authors:  Lei Ru; Yong He; Zhujun Zhu; John W Patrick; Yong-Ling Ruan
Journal:  Front Genet       Date:  2020-10-19       Impact factor: 4.599

9.  Functional disruption of cell wall invertase inhibitor by genome editing increases sugar content of tomato fruit without decrease fruit weight.

Authors:  Kohei Kawaguchi; Rie Takei-Hoshi; Ikue Yoshikawa; Keiji Nishida; Makoto Kobayashi; Miyako Kusano; Yu Lu; Tohru Ariizumi; Hiroshi Ezura; Shungo Otagaki; Shogo Matsumoto; Katsuhiro Shiratake
Journal:  Sci Rep       Date:  2021-11-02       Impact factor: 4.379

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.