Literature DB >> 31321339

First case of fungal keratitis due to Aspergillus minisclerotigenes in Iran.

Mahmoud Karimizadeh Esfahani1, Alireza Eslampoor2, Somayeh Dolatabadi3, Mohammad J Najafzadeh1, Jos Houbraken4.   

Abstract

BACKGROUND AND
PURPOSE: Herein, we report the first case of fungal keratitis due to Aspergillus minisclerotigenes in a 68-year-old rural woman admitted to the Ophthalmology Center of Khatam-Al-Anbia Hospital in Mashhad, northeast of Iran. CASE REPORT: The patient presented with severe pain, burning, foreign body sensation, and reduced vision in her right eye. She had long-term uncontrolled diabetes and was not able to close her eye due to an anatomical problem with the eyelid. The cornea smear sample was cultured, and the fungus was initially identified as Aspergillus flavus. The isolated strain was further identified by sequencing a part of the calmodulin gene as A. minisclerotigenes. The patient did not respond to any antifungal treatments (e.g., amphotericin B and voriconazole drops, and fluconazole 300 mg/day); therefore, she was eventually subjected to corneal transplantation surgery.
CONCLUSION: Fungal keratitis can be caused by the less common species. The reliable identification of the causative agents can be accomplished by the implementation of molecular methods.

Entities:  

Keywords:  Aspergillus minisclerotigenes; Fungal keratitis; Iran

Year:  2019        PMID: 31321339      PMCID: PMC6626709          DOI: 10.18502/cmm.5.2.1162

Source DB:  PubMed          Journal:  Curr Med Mycol        ISSN: 2423-3420


Introduction

Mycotic keratitis, also known as fungal keratitis, is a fungal infection of the cornea due to a defect in the corneal epithelium presenting with the inflammation of the corneal stroma [1]. Fungal keratitis can cause visual loss and accounts for up to 44% of all cases of microbial keratitis, depending on the geographical location [2]. According to the World Health Organization, 1.5-2 million individuals annually go blind due to keratitis [3]. Keratitis is the most important cause of ocular morbidity and mainly occurs in outdoor and agricultural workers as an occupational disease [4, 5]. Moreover, this disease is mostly common in the tropical and subtropical areas. Fungal keratitis may affect individuals in any age group and gender; however, the males performing agricultural or other outdoor work are the most susceptible group [6]. The local predisposing factors for fungal keratitis include trauma (with plant material, animal origin, and dust particles), contact lenses, and iatrogenic agents (following cataract surgery, refractive surgery, and penetrating keratoplasty). In addition, the systemic predisposing factors for this disease are diabetes mellitus, rheumatoid arthritis, human immunodeficiency virus infection, and the use of topical corticosteroids or traditional eye medicines [7, 8]. The common causative agents of cornea infection include species belonging to the genera Fusarium, Aspergillus, Curvularia, Bipolaris, and Candida [9]. Aspergillus species has been frequently reported as the etiological agent of fungal keratitis in tropical countries, such as India [10]. The most common species are A. flavus, A. fumigatus, A. terreus, and A. niger, while A. glaucus, A. ochraceus, A. tamari, A. brasiliensis, A. tubingensis, and A. viridinutans are less frequently occurring [10, 11]. It is crucial to identify the causative agents of keratomycosis at the species level as these agents show differences in their pathogenicity and intrinsic antifungal susceptibility. Herein, we reported the first case of fungal keratitis caused by Aspergillus minisclerotigenes, a species belonging to section Flavi of the genus Aspergillus.

Case report

The case was a 68-year-old female from Bardaskan, Northeast of Iran, admitted to the Ophthalmology Center of Khatam-Al-Anbia Hospital in Mashhad, Iran. The patient was a farmer dealing with livestock. She presented with severe pain, burning, foreign body sensation, and reduced vision in her right eye. She had long-term uncontrolled diabetes and was unable to close her right eye due to the anatomical problem of the eyelid. The patient did not remember if she had received any inoculation in the past. Direct microscopic analysis of the corneal scraping smear showed branched septated mycelium indicating a fungal infection. The corneal scraping samples were cultured on malt extract agar and incubated at 25°C and 37°C for 7 days. Both uni- and biseriate Aspergillus heads and black colored sclerotia resembling A. flavus were observed and the latter measured 300-500 µm in diameter (Figure 1).
Figure 1

Aspergillus minisclerotiogenes CBS 145094; A) a 7-day-old colony on MEA, B) details of colony showing black colored sclerotia, C) uniseriate conidiophores, D) details of a biseriate conidial head, E) conidia (Scale bar=10 µm)

The patient was initially misdiagnosed; accordingly, she did not respond to any of the antifungal therapies (e.g., amphotericin B (1 mg/ml, Q2H) and voriconazole (1 mg/mL, Q2H) eye drops, and fluconazole [300 mg/day]). This irresponsiveness may be due to the delay in the treatment and spread of infection, which eventually led to a corneal transplantation surgery after obtaining informed consent (Figure 2).
Figure 2

A photo from the eye of the patient two weeks after corneal transplant surgery

Final identification was performed using partial calmodulin (CaM) gene sequencing. DNA extraction was accomplished by means of the UtracleanTM Microbial DNA isolation kit (MoBio, Solana Beach USA). Amplification of a part of the CaM gene and sequencing were performed using two primer pairs, namely cmd5 (CCGAGTACAAGGAGGCCTTC) and cmd6 (CCGATAGAGGTCATAACGTGG) [12], following the study by Frisvad et al. [13]. Aspergillus minisclerotiogenes CBS 145094; A) a 7-day-old colony on MEA, B) details of colony showing black colored sclerotia, C) uniseriate conidiophores, D) details of a biseriate conidial head, E) conidia (Scale bar=10 µm) A photo from the eye of the patient two weeks after corneal transplant surgery The partial CaM sequences of our isolate were 100% identical to those of A. minisclerotigenes deposited in the GenBank under the accession numbers of HM803026, HM803016, and HM803014. The generated sequence in this study was deposited in the GenBank under accession number MG490650. In addition, the isolate was deposited in the culture collection of the Westerdijk Fungal Biodiversity Centre, Utrecht, the Netherlands, under collection number CBS145094.

Discussion

Aspergillus species are ubiquitous and common outdoor fungi. The pre dominant presence of these fungi in the environment exposes the outdoor workers and farmers to contamination mostly occurring through the penetration of thorns and wood chips. However, fungal keratitis can also occur after such operations as laser in situ keratomileusis, and cataract [14] or glaucoma surgery [15]. The first reported case of keratitis due to Aspergillus species was reported in a farmer who got struck in the eye through an oat chaff [16]. Aspergillus species are the common cause of keratomycosis in tropical and subtropical countries. Aspergillus flavus has been reported as the main agent of fungal keratitis. The identification of Aspergillus species based on morphological characters is difficult, or even impossible, due to the existence of cryptic species. This variation can be reflected later on with regard to the response of these species to different antifungals. Therefore, a reliable identification of these etiological agents could be achieved by molecular methods. Our isolated strain was able to produce sclerotia on CYA media although the size was larger as commonly observed in A. minisclerotigenes which was first described as “A. flavus Group II” by Geiser et al. [17]. The occurrence of A. minisclerotigenes might have been overlooked (and probably reported as A. flavus) as many species reported in older literature were only identified on the basis of their macroscopic and microscopic characteristics.

Conclusion

The present study was the first report of fungal keratitis due to A. minisclerotigenes in the world. Fungal keratitis can be caused by the less common species. The reliable identification of the causative agents can be accomplished by the implementation of molecular methods.
  14 in total

Review 1.  Filamentous fungal infections of the cornea: a global overview of epidemiology and drug sensitivity.

Authors:  László Kredics; Venkatapathy Narendran; Coimbatore Subramanian Shobana; Csaba Vágvölgyi; Palanisamy Manikandan
Journal:  Mycoses       Date:  2015-02-27       Impact factor: 4.377

2.  Polyphasic taxonomy of Aspergillus fumigatus and related species.

Authors:  Seung-Beom Hong; Seung-Joo Go; Hyeon-Dong Shin; Jens C Frisvad; Robert A Samson
Journal:  Mycologia       Date:  2005 Nov-Dec       Impact factor: 2.696

Review 3.  Medical interventions for fungal keratitis.

Authors:  Nilo Vincent FlorCruz; Ildefonso V Peczon; Jennifer R Evans
Journal:  Cochrane Database Syst Rev       Date:  2012-02-15

4.  Epidemiology of Aspergillus keratitis at a tertiary care eye hospital in South India and antifungal susceptibilities of the causative agents.

Authors:  Palanisamy Manikandan; János Varga; Sándor Kocsubé; Raghavan Anita; Rajaraman Revathi; Tibor Mihály Németh; Venkatapathy Narendran; Csaba Vágvölgyi; Kanesan Panneer Selvam; Coimbatore Subramanian Shobana; Yendremban Randhir Babu Singh; László Kredics
Journal:  Mycoses       Date:  2012-04-10       Impact factor: 4.377

5.  Recurrent Fungal Keratitis and Blepharitis Caused by Aspergillus flavus.

Authors:  Chia-Yi Lee; Yi-Ju Ho; Chi-Chin Sun; Hsin-Chiung Lin; Ching-Hsi Hsiao; David Hui-Kang Ma; Chi-Chun Lai; Hung-Chi Chen
Journal:  Am J Trop Med Hyg       Date:  2016-09-12       Impact factor: 2.345

6.  Epidemiological profile of fungal keratitis in urban population of West Bengal, India.

Authors:  Suman Saha; Debdulal Banerjee; Archana Khetan; Jayangshu Sengupta
Journal:  Oman J Ophthalmol       Date:  2009-09

7.  Fungal keratitis after nonpenetrating glaucoma surgery.

Authors:  Nevbahar Tamcelik; Akif Ozdamar; Melda Kizilkaya; Kazim Devranoglu; Can Ustundag; Cuyan Demirkesen
Journal:  Cornea       Date:  2002-07       Impact factor: 2.651

Review 8.  Fungal infections of the cornea.

Authors:  P A Thomas
Journal:  Eye (Lond)       Date:  2003-11       Impact factor: 3.775

9.  A 5-year retrospective review of fungal keratitis at hospital universiti sains malaysia.

Authors:  Fadzillah Mohd-Tahir; A Norhayati; Ishak Siti-Raihan; M Ibrahim
Journal:  Interdiscip Perspect Infect Dis       Date:  2012-12-16

Review 10.  Recent advances in diagnosis and management of Mycotic Keratitis.

Authors:  Prafulla K Maharana; Namrata Sharma; Ritu Nagpal; Vishal Jhanji; Sujata Das; Rasik B Vajpayee
Journal:  Indian J Ophthalmol       Date:  2016-05       Impact factor: 1.848

View more
  1 in total

1.  Molecular Diversity of Aspergilli in Two Iranian Hospitals.

Authors:  Mohammad Javad Najafzadeh; Somayeh Dolatabadi; Hossein Zarrinfar; Jos Houbraken
Journal:  Mycopathologia       Date:  2021-05-30       Impact factor: 2.574

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.