miR-27a-3p Functions as a Tumor Suppressor and Regulates Non-Small Cell Lung Cancer Cell Proliferation via Targeting HOXB8.

MicroRNA-27a-3p has been implicated to play crucial roles in human cancers. However, the biological role and underlying mechanisms of microRNA-27a-3p in regulating nonsmall lung cancer remain unclear. MicroRNA-27a-3p expression levels in non-small lung cancer cell lines were detected by quantitative real-time polymerase chain reaction, using a normal cell line as control. The effects of microRNA-27a-3p on cell proliferation and apoptosis were analyzed by Cell Counting Kit-8 assay and flow cytometry assay. Luciferase activity reporter assay and Western blot were conducted to validate the potential targets of miR27a-3p after preliminary screening by TargetScan. Effect of microRNA-27a-3p or homeobox B8 on the overall survival of patients with non-small lung cancer was analyzed at Kaplan-Meier Plotter website. MicroRNA-27a-3p expression levels were significantly reduced in non-small lung cancer cell lines compared with normal cell line. Overexpression of microRNA-27a-3p inhibits non-small lung cancer cell proliferation but promotes cell apoptosis. Homeobox B8 was further validated as a functional target of microRNA-27a-3p. Collectively, our results indicated that microRNA-27a-3p acts as a tumor suppressor in non-small lung cancer via targeting homeobox B8.

Introduction

According to the latest epidemiology data, it was estimated that there were 2.1 million new lung cancer cases and 1.8 million lung cancer-related deaths worldwide in 2018.[1] Importantly, non-small cell lung cancer (NSCLC) is reported to account for approximately 85% of all lung cancer cases.[2] Surgical resection is the main treatment approach for NSCLC; however, most cases are found at advanced stages and so the best surgical window is closed.[3]

MicroRNAs (miRNAs), a family of noncoding RNAs, act as either tumor suppressor or oncogene in human cancers.[4] MicroRNAs functionally participated in multiple cellular processes including cell growth, invasion, apoptosis, and so on.[5,6] The expression of miR-671-3p was found decreased in NSCLC cell lines and miR-671-3p overexpression inhibits NSCLC cell proliferation and invasion through targeting CCND2, indicating the tumor suppressive role of miR-671-3p.[7] miR-505 was downregulated in NSCLC and inhibited NSCLC progression both in vitro and in vivo via regulating mitogen-activated protein kinase 3 through AKT serine/threonine kinase 1 (AKT)/nuclear factor-κB pathway.[8] In the meantime, there are multiple oncogenic miRNAs been identified in NSCLC. For example, miR-19 was revealed to be a tumor accelerator in NSCLC by targeting CBX7.[9] Furthermore, miR-24 was found upregulated in NSCLC tissues and promotes the malignancy behaviors of NSCLC cells by targeting ZNF367.[10]

miR-27a-3p was reported to have dual roles in cancers. For example, miR-27a-3p was upregulated and promotes proliferation and invasion but inhibits apoptosis of osteosarcoma cells via regulating ten-eleven translocation 1, suggesting the oncogenic role of miR-27a-3p.[11] On the contrary, miR-27a-3p was found downregulated in hepatocellular carcinoma and suppressed tumor metastasis and vasculogenic mimicry through targeting Twist-1.[12] However, the role of miR-27a-3p in NSCLC remains largely unknown.

Homeobox B8 (HOXB8), a member of the Hox family, is reported to be abnormally expressed in human cancers.[13-16] It was found that knockdown HOXB8 expression inhibits colorectal cancer cell proliferation and migration via Wnt/β-catenin signaling pathway, suggesting HOXB8 might be a therapeutic target.[13] Meanwhile, it was found that HOXB8 overexpression increased gastric cancer metastasis and epithelial–mesenchymal transition.[14] Moreover, HOXB8 was found to be regulated by miRNAs including miR-196 and miR-3607-3p in human cancers.[15,16]

In this work, we analyzed miR-27a-3p expression in NSCLC cell lines by quantitative real-time polymerase chain reaction (qRT-PCR). Also, we investigated the effects and mechanism underlying miR-27a-3p in the development of NSCLC. Furthermore, we analyzed whether HOXB8 was a functional target of miR-27a-3p.

Materials and Methods

Cell Line and Cell Culture

Both NSCLC cells (A549 and NCI-H1299) and normal human bronchial epithelial BEAS-2B cells purchased at Cell Bank of Chinese Academy of Sciences (Shanghai, China) were incubated in Roswell Park Memorial Institute (RPMI) 1640 medium (Invitrogen, Carlsbad, California) supplemented with 10% fetal bovine serum (Invitrogen) in a 37°C humidified atmosphere containing 5% CO2.

Upregulation or Downregulation of Gene Expression

For miR-27a-3p overexpression, miR-27a-3p mimic synthetized by GenePharm (Shanghai, China) was used. For HOXB8 overexpression, pcDNA3.1 containing the open reading frame of HOXB8 (pcHOXB8) designed by Gen Script (Nanjing, China) was employed. Cell transfection was conducted using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s instructions.

RNA Isolation and qRT-PCR

Total RNA extracted from the cultured cell using TRIzol reagent (Invitrogen) was reverse-transcribed into complementary DNA using M-MLV Reverse Transcriptase (Promega, Madison, Wisconsin). The qRT-PCR was conducted at ABI 7500 system (Applied Biosystems, Foster City, California) using SYBR Premix Ex Taq II (Takara, Dalian, Liaoning, China). Relative expression level of miR-27a-3p was calculated using 2−ΔΔCt method and normalized to U6 snRNA. The primers used were as follows: miR-27a-3p: F: TGCGGTTCACAGTGGCTAAG, R: CTCAACTGGTGTCGTGGA; U6 snRNA: F: CTCGCTTCGGCAGCACA, R: AACGCTTCACGAATTTGCGT.

Protein Isolation and Western Blot

Total protein isolated from cultured cells using Radio Immunoprecipitation Assay (RIPA) lysis buffer and protease inhibitor (Beyotime, Haimen, Jiangsu, China) was separated at 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, the protein sample was transfected to poly vinylidene fluoride (PVDF) membrane and blocked with fat-free milk, after which the primary antibodies (anti-HOXB8: ab125727, anti-Bcl-2: ab185002, anti-Bax: ab32503, anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH): ab181602; Abcam, Cambridge, Massachusetts) were incubated with the membranes at 4°C for overnight. After washed with Tris-HCl buffer solution Tween (TBST), membranes were incubated with horseradish peroxidase–conjugated secondary antibody (ab6721; Abcam) at room temperature for 4 hours. Band intensity was analyzed using ImageJ software (Bethesda, Maryland) after visualized using BeyoECL kit (Beyotime).

Cell Counting Kit-8 Assay

In total, 5 × 103 cells were grown in 96-well plates and incubated for 0, 1, 2 and 3 days. At indicated time, 100 μL Cell Counting Kit-8 regent (Beyotime) was added and incubated for another 2 hours. Absorbance was measured at 450 nm using Microplate Spectrophotometer (BioTek Instruments, Inc, Winooski, Vermont).

Flow Cytometry

Cell apoptosis was analyzed by flow cytometry assay using Annexin V FITC/propidium iodide (PI) apoptosis detection kit (Beyotime), following the manufacturer’s protocol. Cells were harvested, washed with phosphate buffer solution (PBS), fixed with 70% ethanol, stained with Annexin V FITC/PI, and then analyzed with flow cytometer (BD Biosciences, San Jose, California).

Target Prediction and Luciferase Reporter Assay

Bioinformatics analysis was performed at TargetScan (http://www.targetscan.org/vert_72/). The 3′-untranslated region (UTR) of HOXB8 amplified from genomic was inserted into pmiR-REPORT (Promega) and named as HOXB8-wt. The mutant type of HOXB8 3′-UTR was generated using site-directed mutagenesis kit (Takara) and named as HOXB8-mt. For reporter assays, cells were cotransfected with HOXB8-wt or HOXB8-mt and miR-27a-3p mimic or NC-miR. Dual-luciferase reporter assay system (Promega) was conducted to measure relative luciferase activity after 48-hour transfection according to the manufacturer’s instructions with Renilla luciferase as endogenous control.

Kaplan-Meier Plotter

Kaplan-Meier (KM) plotter (www.kmplot.com) was used to assess the effect of miR-27a-3p or HOXB8 expression on the overall survival of patients with cancer.[17] The data they presented were obtained from Gene Expression Omnibus (GEO), European Genome-phenome Archive (EGA), and The Cancer Genome Atlas (TCGA). Cutoff value was autoselected in the algorithm. Patients were divided into 2 groups using quantile expression. Then, KM survival plot was employed and hazard ratio with 95% confidence intervals and log-rank P value are calculated.

Statistical Analysis

Data were presented as the mean ± standard deviation after analyzed using SPSS 15.0 software (SPSS Inc, Chicago, Illinois). For group difference analysis, Student t test or one-way analysis of variance and Tukey post hoc test was employed. P < .05 was considered as statistically significant.

Results

Downregulation of miR-27a-3p, While Upregulation of HOXB8 in NSCLC

We found miR-27a-3p expression level was significantly downregulated in NSCLC cell lines compared with the normal cell line (Figure 1A). Importantly, we found low miR-27a-3p was associated with poor overall survival of patients with cancer (Figure 1B). Furthermore, we showed HOXB8 expression was elevated in NSCLC cell lines in comparison with normal cell line (Figure 1C). Interestingly, high HOXB8 expression level was also associated with poor overall survival of patients with cancer (Figure 1D).

Figure 1.

miR-27a-3p expression was downregulated while HOXB8 expression was upregulated in NSCLC. A, miR-27a-3p expression was examined in NSCLC cells (A549 and NCI-H1299) and normal human bronchial epithelial BEAS-2B. B, Low miR-27a-3p was a predictor for poor overall survival of patients with cancer. C, The expression of HOXB8 was examined in NSCLC cells (A549 and NCI-H1299) and normal human bronchial epithelial BEAS-2B. D, High HOXB8 was a predictor for poor overall survival of patients with cancer. HOXB8 indicates homeobox B8; miR-27a-3p, microRNA-27a-3p; NSCLC, non-small cell lung cancer.

miR-27a-3p Overexpression Inhibits NSCLC Cell Proliferation but Promotes Apoptosis

To investigate the biological role of miR-27a-3p, NSCLC cells were transfected with miR-27a-3p mimic. The qRT-PCR confirmed that miR-27a-3p expression was significantly increased by miR-27a-3p mimic compared with NC-miR (Figure 2A). Cell Counting Kit-8 assay and flow cytometry assay were conducted to examine the effect of miR-27a-3p on cell proliferation and apoptosis. Results showed that miR-27a-3p overexpression inhibited cell proliferation but promoted cell apoptosis (Figure 2B and C). We also detected the expression of Bcl-2 and Bax in NSCLC cells with synthetic miRNA transfection. We found Bax expression was increased, while Bcl-2 expression was decreased by miR-27a-3p mimic (Figure 2D). These results indicated that miR-27a-3p may function as a tumor suppressive role in NSCLC.

Figure 2.

miR-27a-3p overexpression inhibits NSCLC cell proliferation but promotes apoptosis: (A) miR-27a-3p expression, (B) cell proliferation, (C) cell apoptosis, and (D) Bcl-2 and Bax expression in NSCLC cells transfected with miR-27a-3p mimic or NC-miR. miR-27a-3p indicates microRNA-27a-3p; NC-miR, negative control miRNA; NSCLC, non-small cell lung cancer.

miR-27a-3p Targets the 3′-UTR of HOXB8

Bioinformatic analysis showed HOXB8 was a potential target of miR-27a-3p (Figure 3A). Dual-luciferase reporter assay showed relative luciferase activity of NSCLC cells transfected with HOXB8-wt was significantly inhibited by miR-27a-3p mimic (Figure 3B). Moreover, Western blot showed that HOXB8 expression was inhibited by miR-27a-3p MIMIC (Figure 3C).

Figure 3.

miR-27a-3p regulates HOXB8 expression by 3′-UTR binding. A, The binding sites of miR-27a-3p and HOXB8 were shown. B, miR-27a-3p mimic decreased relative luciferase activity in NSCLC cells transfected with HOXB8-wt. C, miR-27a-3p mimic decreased HOXB8 expression in NSCLC cells. HOXB8 indicates homeobox B8; miR-27a-3p, microRNA-27a-3p; NSCLC, non-small cell lung cancer; NC-miR, negative control miRNA; wt, wild-type; mt, mutant; UTR, untranslated region.

miR-27a-3p Exerts Its Function Through Regulating HOXB8

Next, we investigated whether HOXB8 should be responsible for the tumor suppressive role of miR-27a-3p in NSCLC. It was found pcHOXB8 transfection increased the levels of HOXB8 (Figure 4A). In vitro functional experiments showed that overexpression of HOXB8 promoted cell proliferation but inhibited cell apoptosis (Figure 4B and C). Moreover, we found HOXB8 overexpression partially reversed the effects of miR-27a-3p on NSCLC cell proliferation and apoptosis (Figure 4B and C). Not surprisingly, Bcl-2 expression was increased, while Bax expression was decreased by pcHOXB8 (Figure 4D).

Figure 4.

miR-27a-3p regulates NSCLC cell behaviors through targeting HOXB8: (A) HOXB8 expression, (B) cell proliferation, (C) cell apoptosis, and (D) Bcl-2 and Bax expression in NSCLC cells transfected with pcHOXB8, pcDNA3.1, pcHOXB8 and miR-27a-3p mimic, or pcDNA3.1 and miR-27a-3p mimic. HOXB8 indicates homeobox B8; miR-27a-3p, microRNA-27a-3p; NSCLC, non-small cell lung cancer.

Discussion

Lung cancer makes up the first most common diagnosed and cancer-related mortality worldwide.[1] Targeting miRNAs have been recognized as a promising therapeutic target for disease treatment.[18] In this study, we found the expression level miR-27a-3p, a miRNA reported to have dual roles in human cancers, was decreased in NSCLC cell lines compared with the normal cell line. Meanwhile, low miR-27a-3p was found as a predictor for poor overall survival of patients with cancer. In addition, we found miR-27a-3p overexpression inhibited NSCLC cell proliferation but promoted apoptosis, which indicated the tumor suppressive role of miR-27a-3p in NSCLC.

Our results showed that HOXB8 expression was upregulated in NSCLC cell lines compared with the normal cell line. More importantly, we found high HOXB8 expression was correlated with poor overall survival of patients with cancer. We found overexpression of HOXB8 promoted cell proliferation and at the same time inhibited cell apoptosis in vitro.

It is well recognized that miRNAs exert their functions by regulating target gene expression through 3′-UTR binding.[5-12] Considering the precise molecular mechanism through which miR-27a-3p influences NSCLC progression remains largely unknown, therefore, we are interested to investigate whether HOXB8 was a target of miR-27a-3p. Finally, rescue experiments demonstrated that the overexpression of HOXB8 could partially reversed the effects of miR-27a-3p on NSCLC cell behaviors.

In conclusion, our results demonstrated that miR-27a-3p expression was downregulated while HOXB8 expression was upregulated in NSCLC. Moreover, we found low miR-27a-3p or high HOXB8 expression was a predictor for poor overall survival of patients with cancer. In addition, HOXB8 was recognized as a novel target of miR-27a-3p and it possibly mediated the tumor suppressive role of miR-27a-3p in NSCLC.