Literature DB >> 31308707

Genetic characterization of two vancomycin-resistant Staphylococcus aureus isolates in Kerman, Iran.

Mahsa Ziasistani1,2, Mohammad Reza Shakibaie3,4, Davood Kalantar-Neyestanaki3.   

Abstract

AIM: The aim of this study was the genetic characterization of two clinical vancomycin-resistant Staphylococcus aureus (VRSA) isolates.
MATERIALS AND METHODS: Resistance to vancomycin was determined by phenotypic method. PCR was used for detection of mecA, vanA, ermA, ermB, ermC, msrA/B, aph(2")-Ic, aph(3')-IIIa, pvl, Immune Evasion Cluster [sea, sep, chip, sak and scn] genes and biofilm operon icaABCD. On the other hand, multilocus sequence typing and agr typing methods were performed for the determination of clonal relationship and van operon was detected and sequenced.
RESULTS: Vancomycin-resistant Staphylococcus aureus strain 1 (VRSA-1) was positive for vanA, ermA, ermC, aph(2")-Ic, aph(3')-IIIa, sea, sep, icaD genes, belonging to agr type I; SCCmec type III; spa type t030; and ST239. However, the genetic characterization of Vancomycin-resistant Staphylococcus aureus strain 2 (VRSA-2) revealed the presence of various types of resistance genes vanA, ermA, ermC, aph(2")-Ic, aph(3')-IIIa, sea, icaD, relating to agr type I; SCCmec type III; spa type t459; and ST239. The presence of transposon Tn1546 was determined by PCR sequencing.The Basic Local Alignment Search Tool analysis of van operon in the VRSA isolates showed 99.6% sequence homology to Tn1546 in vancomycin-resistant enterococci, indicating the vanA operon has an enterococcal origin.
CONCLUSION: In conclusion, the ST239 is one of the most common clones of MRSA isolates which involved the hospital-associated infections, therefore, the emergence of VRSA isolates with ST239 increased the spread of resistance to vancomycin in the hospital settings.

Entities:  

Keywords:  MLST; SCCmec; VRSA; agr type; spa; van operon

Year:  2019        PMID: 31308707      PMCID: PMC6619737          DOI: 10.2147/IDR.S205596

Source DB:  PubMed          Journal:  Infect Drug Resist        ISSN: 1178-6973            Impact factor:   4.003


Introduction

Staphylococcus aureus is one of the most destructive causes of bacterial infections in hospital settings.1 The rapid spread of this type of bacterial infections has been accompanied by a rise in antibiotic-resistant strains.2 The high-level vancomycin-resistant S. aureus (VRSA) was reported in 2002, Michigan, USA, for the first time and was subsequently detected in different hospitals around the world.3,4 However, VRSA strains are rarely reported from all over the world.5 So far, the VRSA strains have been reported, belonging to sequence types (STs) including ST1, ST5, ST8 ST85, ST231, ST239, ST250, ST371, ST923, and ST1283, and ST231.5–7 The VRSA strains belonging to ST5, ST8, ST239 and ST1283 were recently reported in Iran.6,7 The sequence type 239 is the most common clone of methicillin-resistant S. aureus (MRSA) which has been reported in the hospital settings around the world that would be resistant to the widespread antibacterial agents.8,9 Transposon Tn1546, a Tn3-related transposon,causing vancomycin resistance, was associated with a cluster of seven genes including vanS, vanR, vanH, vanA, vanX, vanY, and vanZ.10 Generally, the horizontal transfer of Tn1546 transposon from vancomycin-resistant Enterococci spp to S. aureus strains is responsible for resistance to vancomycin in S. aureus strains as well as the emergence of VRSA.5 Herein, we reported the genetic characterization of two vancomycin-resistant S. aureus strains which were collected from hospitalized patients, Kerman, Iran.

Materials and methods

Patients and isolates sources

In our previous studies, from April 2015 to March 2017, we detected two VRSA strains from 205 non-duplicate of S. aureus isolates. The two VRSA isolates were collected, VRSA-1 belonged to spa type t030; SCCmec III and VRSA-2 belonged to spa type t459; SCCmec III. The minimum inhibitory concentration (MIC) of isolates to vancomycin was ≥64 µg/mL and the isolates were negative for panton-valentine leukocidin (pvl) gene and were resistant to gentamicin, amikacin, erythromycin, clindamycin, tetracycline, ciprofloxacin, penicillin, cefoxitin, and trimethoprim/sulfamethoxazole11,12 The isolates were stored in Trypticase Soy Broth plus 15% Glycerol at −80°C for more investigation. The VRSA strains were isolated from two patients with a long history of hospitalization. Briefly, the VRSA-1 was associated with the bronchoalveolar lavage sample from a 76-year-old female patient, hospitalizing in ICU at Afzalipour hospital (425 beds) in Kerman along with clinical manifestations including pneumonia, fever, with a history of diabetes mellitus and hemodialysis,who died without including infections treated. The VRSA-2 isolate was obtained from a surgical wound infection of a 21-year-old male patient, hospitalized in orthopedic unit in Bahonar hospital (375 beds) in Kerman. (Other data about patient was not available.)

Antibiotic susceptibility test

The MIC of the isolates to linezolid and daptomycin was determined according to Clinical & Laboratory Standards Institute guidelines and also, disk diffusion method was used for determination of susceptibility of isolates to rifampin.13

Detection of virulence, resistance genes, and molecular typing of the VRSA isolates

In the following previous studies,11,12 the isolates were confirmed by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF MS, Bruker, Daltonics, Medical Microbiology and Clinical Microbilogy Department of Umea University, Umea, Sweden). Resistance genes including ermA, ermB, ermC, msrA/B, aminoglycoside modifying genes [(aac(6ʹ)-Ie-aph(2ʹ’)-I, aph(2ʹ’)-Ib, aph(2ʹ’)-Ic, aph(2ʹ’)-Id, aph(3ʹ)-IIIa, ant(4ʹ)-Ia)], and agr type of the isolates were determined by PCR method in FlexCycler2 PCR-Thermocycler (Analytik Jena, Co, Jena, Germany). On the other hand, the virulence genes including sea, sep, chip, sak, scn, icaABCD were detected by PCR. Table 1 shows the primers that were used in PCR amplification of virulence, resistance genes, and agr typing. Multilocus sequence typing was performed by PCR sequencing of seven housekeeping genes (arc, aro, glp, gmk, pta, tpi, and yqi) according to https://pubmlst.org/saureus/.
Table 1

The primer sequences were used in this study

Gene targetPrimer sequence(5ʹ-3ʹ)Annealing temperature (°C)Product (bp)Ref
nucF-GCGATTGATGGTGATACGGTT6027911,12
R-AGCCAAGCCTTGACGAACTAAAGC
mecAF-TCCAGATTACAACTTCACCAGG5616211,12
R-CCACTTCATATCTTGTAACG
vanAF-CATGAATAGAATAAAAGTTGCAATA50103012
R-CCCCTTTAACGCTAATACGATCAA
erm AF-TATCTTATCGTTGAGAAGGGATT56.513911,12
R-CTACACTTGGCTTAGGATGAAA
erm BF-CTATCTGATTGTTGAAGAAGGATT56.514211,12
R-GTTTACTCTTGGTTTAGGATGAAA
erm CF-AATCGTCAATTCCTGCATGT55.529711,12
R-TAATCGTGGAATACGGGTTTG
msrAF-GCAAATGGTGTAGGTAAGACAACT56.540211,12
R-ATCATCATGTGATGTAAACAAAAT
aac(6ʹ)-Ie-aph(2ʹ’)-IF-CAGGAATTTATCGAAAATGGTAGAAAAG6036914
R-CACAATCGACTAAAGAGTACCAATC
aph(2ʹ’)-IbF-CTTGGACGCTGAGATATATGAGCAC6086714
R-GTTTGTAGCAATTCAGAAACACCCTT
aph(2ʹ’)-IcF-CCACAATGATAATGACTCAGTTCCC6044414
R-CCACAGCTTCCGATAGCAAGAG
aph(2ʹ’)-IdF-GTGGTTTTTACAGGAATGCCATC6064114
R-CCCTCTTCATACCAATCCATATAACC
aph(3ʹ)-IIIaF-GGCTAAAATGAGAATATCACCGG6052314
R-CTTTAAAAAATCATACAGCTCGCG
ant(4ʹ)-IaF-CAAACTGCTAAATCGGTAGAAGCC6029414
R-GGAAAGTTGACCAGACATTACGAACT
chpF-GAAAAAGAAATTAGCAACAACAG4841015
R-CATAAGATGATTTAGACTCTCC
sakF-AAGGCGATGACGCGAGTTAT5022315
R-GCGCTTGGATCTAATTCAAC
seaF-AGATCATTCGTGGTATAACG5040815
R-TTAACCGAAGGTTCTGTAGA
sepF-AATCATAACCAACCGAATCA5050015
R-TCATAATGGAAGTGCTATAA
scnF-AGCACAAGCTTGCCAACATCG4925815
R-TTAATATTTACTTTTTAGTGC
icaAF-TCTCTTGCAGGAGCAATCAA6018815
R-TCAGGCACTAACATCCAGCA
icaBF-ATGGCTTAAAGCACACGACGC6152615
R-TATCGGCATCTGGTGTGACAG
icaCR-CTCTCTTAACATCATTCCGACGCC63101315
F-ATCATCGTGACACACTTACTAACG
icaDF-GAACCGCTTGCCATGTGTTG6148315
R-GCTTGACCATGTTGCGTAACC
pvlF-TCATTAGGTAAAATGTCTGGACATGATCCA5543311,12
R-GCATCAASTGTATTGGATAGCAAAAGC
agrPan-ATG CAC ATG GTG CAC ATG C5044157532365916
I-GTCACAAGTACTATAAGCTGCGAT
II-TATTACTAATTGAAA AGT GGC CATAGC
III-GTA ATG TAATAGCTTGTATAATAATACCCAG
IV-CGATAATGCCGTAATACCCG
The primer sequences were used in this study

Detection and sequencing of van operon

The van operon including vanR, vanS, vanH, vanA, vanX, vanY, and vanZ were detected and sequenced by primer walking method, using 12 specific primer pairs (Table 2) that were designed by primer designing tool in NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast) for different regions of Tn1546 by PCR technique. We used the Tn1546 sequences with accession numbers HM565172.1, M97297, KR349520, KR047792, and KX496042.1 in GenBank for primer designing (https://www.ncbi.nlm.nih.gov/nuccore). The PCR products for van genes were sequenced by Applied Biosystems 3730/3730Xl DNA Analyzers (Bioneer, Co, South Korea). The sequences were assembled by Lasergene package software (DNASTAR) and were analyzed by the basic local alignment search tool (BLAST) in NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Open reading frames (ORFs) of van genes were determined by Open Reading Frame Finder software (https://www.ncbi.nlm.nih.gov/orffinder).
Table 2

Primers used for amplification and sequencing of van operon

Name of primersPrimer sequence(5ʹ-3ʹ)Annealing temperature (°C)PCR product (bp)Ref
Tn1F-CCATTTTCGCTCCTCTAACG50.51025This study
R-CGAATCTGGAAAGCGAAAAG
Tn2F-CTTTTCGCTTTCCAGATTCG51802
R-AGAATGGTGTGGGAAGCAAG
TnReF-GATGGATGCTGCGAGGTAAT51.5849
R-ATCCATTCCGATCTCGTTCA
Tn,Re,VanRF-CCCGTTTGGAAAAAGTGAAG501074
R-TCGGCAATTTCATGTTCATC
VanRSF-GTATTCCGCTAATGGGCAAT501027
R-GATCCAATCCCCAAGTTTCC
VanSF-TTCAATGATCCGAGGGAAAC521009
R-CGCTGGAAGCTCTACCCTAA
VanS,IS1251F-ACGCGGAAAGCAATGATAAC521297
R-TATTGTGCGTTGGGGTACAA
IS1251,VanHF-GCTGACAAGCTTTGCATTTG521203
R-CGCTATTTTGCAGCAACTCA
VanHAF-GCTTATAGTCGCAGCCGAAG52.51273
R-TTTTGCCGTTTCCTGTATCC
VanAXF-TTATAACCGTTCCCGCAGAC52.5847
R-TGGGGTATGGTTCGTCTCTT
VanX,IS1216EF-CATGGAAAACAGTGGGTTTG51.51200
R-ACGGCACAATCTCGTTTGA
VanYF-TTGTCAACAGGCAGTTCAGC511143
R-TTTCATTCCGCCATCCTTAC
VanYZF-CACCATTCATGTGCCGACTA52862
R-TTTTCCCCTCACTTCACACC
RevF-CCCTTCACGTTGTCTCATCCPan
Primers used for amplification and sequencing of van operon

Results

Genetic characterization of isolates

The isolates were resistant to rifampin and sensitive to linezolid and daptomycin with MIC ≤0.5 µg/mL (antibiotic resistance profile to other antibiotic is given in “Material and methods“ section). The expected molecular size 1030 bp product referring to the vanA gene was detected and sequenced in both VRSA strains as shown in Figure 1. The sequence presented 100% identity with vanA gene of vancomycin-resistant enterococci (VRE), on Tn1546 as indicated in GenBank database. Furthermore, the VRSA strains were analyzed for the presence of resistance and virulence genes. VRSA-1 was positive for ermA, ermC, aph (2”)-Ic, aph (3ʹ)-IIIa, sea, sep, icaD genes. The strain belonged to SCCmec III, agrI, spa type t030 and ST239. VRSA-2 was positive for ermA, ermC, aph (2”)-Ic, aph (3ʹ)-IIIa genes, as well as the virulence genes including sea, icaD were detected. The VRSA-2 belonged to SCCmec III, agrI, spa type t459, and ST239.
Figure 1

Agarose gel electrophoresis of vanA gene detected in two VRSA strains.

Agarose gel electrophoresis of vanA gene detected in two VRSA strains.

Molecular characterization of van operon in VRSA strains

The amplification and sequencing of van operon showed that the operon contains 9 ORFs, harboring a transposase (tnp) and resolvase (rev) genes, corresponding to vanR, vanS, vanH, vanA, vanX, vanY, and vanZ operon, respectively. The analysis of the sequence results indicated that it is closely related to Tn1546 in VRE. Similar to Tn1546 sequence in VRE in the current work, the insertion sequences including IS1251 and IS1216E were also distinguished. Phylogenetic and distance analyses in BLAST revealed that Tn1546 in our VRSA strains had 99.6% similarity to Tn1546 in VRE. The sequence of Tn1546 was submitted in GenBank under accession number MG592387 (https://www.ncbi.nlm.nih.gov/nuccore/mg592387).

Discussion

Recently, due to the rapid prevalence of MRSA, reporting in health care settings and also the exposure of selective pressure of antibiotics, the emergence of VRSA strains, showing high level of resistance to antibiotics is unavoidable. The emergence of VRSA isolates has been a major concern for the physicians and hospital management systems; however, VRSA isolates are rarely reported around the world and the total reported VRSA strains in the world have been reported to be less than 20 strains since 2002.5 Long-time hospitalization, prolonged treatment with vancomycin, colonization with enterococcal as well as MRSA isolates, diabetes, chronic skin ulcers, and hemodialysis are the risk factors for colonization and infection by VRSA.17,18 This study showed VRSA isolates from two patients who suffered from diabetes, chronic skin ulcers, underlying long-time hospitalization, and prolonged vancomycin therapy. The Centers for Disease Control and Prevention reported 9 out of 13 VRSA strains in the USA that were isolated from diabetic patients.17,18 The van operon is commonly located on transposon Tn1546 and causes high-level resistance to vancomycin, initially reported in hospital strains VRE.8,9 In the present study, both the isolates carried vanR, vanS, vanH, vanA, vanX, vanY, and vanZ genes on a van operon. Furthermore, we align the van genes sequence in BLAST, and results indicated high identity with Tn1546 in VRE. Therefore, it has been suggested that the van operon has probably been transferred from VRE to S. aureus strains in simultaneous infections or colonization of VRE along with S. aureus, although we did not distinguish any evidence of mixed infection or colonization with VRE in this study. In the present work, the VRSA as well as VRE strains were not isolated from roommates, other patients, and also health care workers. Furthermore, the presence of the IS elements including IS1251 and IS1216E in Tn1546 confirmed the transfer of resistance to vancomycin from VRE to S. aureus. Similar to present study, some VRSA strains were reported in the USA, harboring IS1251 and IS1216E on Tn1546.5,19 A study which was carried out in Kerman hospitals showed that vancomycin resistant-Enterococcus faecalis isolates harbored vanA gene.20 CC5 and CC8 are the most common MRSA clones around the world. ST239 from CC8, ST5 from CC5, and ST22 from CC22 are the most prevalent VRSA sequence types which were reported in Iran, USA, and Brazil.3–7 The sequence type (ST) 239 from CC8 is the most common clone of MRSA in hospital-acquired infections in Asia.7 According to literature, the ST239 is the epidemic clone with resistance to a wide range of antibacterial agents in hospital settings around the world.7 In recent years, the VRSA isolates belonging to ST5, ST8, ST239, and ST1283 were reported in our country.6,7 According to eBURST results, ST8 and also ST1283 are the single locus variant of ST239, and these findings indicated that, in our country, the VRSA isolates are closely related to the same clone (Figure 2). Also in the present study, the molecular typing results indicated that the genetic background of the VRSA isolates (agr type I; SCCmec type III; ST239 and pvl-negative isolates) was closely related to health-care-associated MRSA strains.
Figure 2

A population snapshot of the entire S. aureus with 5 or more nearest match of seven allelic profiles with ST239 in http://bigsdb.pasteur.fr MLST database showing clonal complexes (CCs) viewed using eBURST.

A population snapshot of the entire S. aureus with 5 or more nearest match of seven allelic profiles with ST239 in http://bigsdb.pasteur.fr MLST database showing clonal complexes (CCs) viewed using eBURST. ST239 is the common clone of the MRSA isolates that involved the hospital-associated infections especially in ICU-associated infections, and so the emergence of VRSA isolate, belonging to ST239 in health care settings, would be prevalent more than the other clones of MRSA (another clone of MRSA). Therefore, clinical laboratories have an important role in the diagnosis, isolation, and infection control with VRSA strains. So, we suggest that the surveillance of long-time hospitalized patients and the use of vancomycin agar screening for detecting VRSA and VISA strains in different hospital wards especially in ICU which probability of MRSA carriage and prolonged vancomycin therapy in them is high.
  18 in total

1.  Prevalence of the ST239 clone of methicillin-resistant Staphylococcus aureus and differences in antimicrobial susceptibilities of ST239 and ST5 clones identified in a Korean hospital.

Authors:  Hwa Yun Cha; Dong Chan Moon; Chul Hee Choi; Jae Young Oh; Young Sook Jeong; Yoo Chul Lee; Sung Yong Seol; Dong Taek Cho; Hyun-Ha Chang; Shin-Woo Kim; Je Chul Lee
Journal:  J Clin Microbiol       Date:  2005-08       Impact factor: 5.948

2.  Analysis of the genetic variability of genes encoding the RNA III-activating components Agr and TRAP in a population of Staphylococcus aureus strains isolated from cows with mastitis.

Authors:  Philippe Gilot; Gérard Lina; Thierry Cochard; Bernard Poutrel
Journal:  J Clin Microbiol       Date:  2002-11       Impact factor: 5.948

3.  Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern Iran.

Authors:  Amir Azimian; Seyed Asghar Havaei; Hosein Fazeli; Mahmood Naderi; Kiarash Ghazvini; Siamak Mirab Samiee; Masoud Soleimani; Shahin Najar Peerayeh
Journal:  J Clin Microbiol       Date:  2012-08-29       Impact factor: 5.948

4.  Characterization of Tn1546 in vancomycin-resistant Enterococcus faecium isolated from canine urinary tract infections: evidence of gene exchange between human and animal enterococci.

Authors:  S Simjee; D G White; P F McDermott; D D Wagner; M J Zervos; S M Donabedian; L L English; J R Hayes; R D Walker
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

Review 5.  Staphylococcus aureus with reduced susceptibility to vancomycin.

Authors:  S E Cosgrove; K C Carroll; T M Perl
Journal:  Clin Infect Dis       Date:  2004-07-23       Impact factor: 9.079

6.  Vancomycin-resistant Staphylococcus aureus in the absence of vancomycin exposure.

Authors:  Cynthia J Whitener; Sarah Y Park; Fred A Browne; Leslie J Parent; Kathleen Julian; Bulent Bozdogan; Peter C Appelbaum; Jasmine Chaitram; Linda M Weigel; John Jernigan; Linda K McDougal; Fred C Tenover; Scott K Fridkin
Journal:  Clin Infect Dis       Date:  2004-03-24       Impact factor: 9.079

Review 7.  VanA-type vancomycin-resistant Staphylococcus aureus.

Authors:  Bruno Périchon; Patrice Courvalin
Journal:  Antimicrob Agents Chemother       Date:  2009-06-08       Impact factor: 5.191

8.  Molecular evidence for spread of two major methicillin-resistant Staphylococcus aureus clones with a unique geographic distribution in Chinese hospitals.

Authors:  Yudong Liu; Hui Wang; Na Du; Enhua Shen; Hongbin Chen; Junqi Niu; Huifen Ye; Minjun Chen
Journal:  Antimicrob Agents Chemother       Date:  2008-11-24       Impact factor: 5.191

Review 9.  Distribution of genes encoding tetracycline resistance and aminoglycoside modifying enzymes in Staphylococcus aureus strains isolated from a burn center.

Authors:  M Emaneini; R Bigverdi; D Kalantar; S Soroush; F Jabalameli; B Noorazar Khoshgnab; P Asadollahi; M Taherikalani
Journal:  Ann Burns Fire Disasters       Date:  2013-06-30

10.  Report of the 13th vancomycin-resistant Staphylococcus aureus isolate from the United States.

Authors:  Brandi M Limbago; Alexander J Kallen; Wenming Zhu; Paula Eggers; Linda K McDougal; Valerie S Albrecht
Journal:  J Clin Microbiol       Date:  2013-12-26       Impact factor: 5.948

View more
  4 in total

1.  Pathogenic potential and antimicrobial resistance of Staphylococcus pseudintermedius isolated from human and animals.

Authors:  Paulina Glajzner; Eligia M Szewczyk; Magdalena Szemraj
Journal:  Folia Microbiol (Praha)       Date:  2022-10-12       Impact factor: 2.629

2.  Clonal diversity and genomic characterization of Panton-valentine Leukocidin (PVL)-positive Staphylococcus aureus in Tehran, Iran.

Authors:  Zahra Najafi Olya; Shahin Najar-Peerayeh; Abbas Yadegar; Bita Bakhshi
Journal:  BMC Infect Dis       Date:  2021-04-21       Impact factor: 3.090

3.  Inhibition of the Vancomycin Resistance in Staphylococcus aureus in Egypt Using Silver Nanoparticles.

Authors:  Nouran M Salah; Amal E Saafan; Eman H Salem; Haddad A El Rabey; Mohammed A Alsieni; Fuad A Alatawi; Adel I Alalawy; A B Abeer Mohammed
Journal:  Biomed Res Int       Date:  2022-04-30       Impact factor: 3.246

4.  High prevalence and expression of antiseptic resistance genes among infectious t037/ST239 methicillin-resistant Staphylococcus aureus (MRSA) strains in North Khorasan Province, Iran.

Authors:  Hamed Ghasemzadeh-Moghaddam; Amir Azimian; Ghasem Bayani; Vahid Dashti; Sara Nojoomi; Nojoomi Shirazi; Akbar Solati; Alex Van Belkum
Journal:  Iran J Basic Med Sci       Date:  2022-06       Impact factor: 2.532

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.