Paula V Subirada1,2, María C Paz1,2, Magali E Ridano1,2, Valeria E Lorenc3, Claudio M Fader4,5, Gustavo A Chiabrando1,2, María C Sánchez1,2. 1. Departamento de Bioquímica Clínica, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Córdoba, Argentina. 2. Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Centro de Investigaciones en Bioquímica Clínica e Inmunología (CIBICI), Córdoba, Argentina. 3. Nanomedicine and Vision Group, Facultad de Ciencias Biomédicas, Instituto de Investigaciones en Medicina Traslacional, Universidad Austral, Consejo Nacional de Investigaciones en Ciencia y Tecnología (CONICET), Pilar, Argentina. 4. Facultad de Odontología Mendoza, Universidad Nacional de Cuyo, Mendoza, Argentina. 5. Instituto de Histología y Embriología (IHEM), Facultad de Ciencias Médicas, Universidad Nacional de Cuyo, Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Mendoza, Argentina.
Abstract
Hypoxia is one of the main insults in proliferative retinopathies, leading to neovascularization and neurodegeneration. To maintain homeostasis, neurons require efficient degradation and recycling systems. Autophagy participates in retinal cell death, but it is also a cell survival mechanism. Here, we analyzed the role of autophagy at the three characteristic time periods in the oxygen-induced retinopathy (OIR) mouse model and determined if its modulation can improve vascular and non-vascular alterations. Experiments were performed with chloroquine (CQ) in order to monitor autophagosome accumulation by lysosomal blockade. Post natal day (P)17 OIR mouse retinas showed a significant increase in autophagy flux. In particular, an intense LC3B and p62 staining was observed in inner layers of the retina, mainly proliferating endothelial cells. After a single intraocular injection of Rapamycin at P12 OIR, a decreased neovascular area and vascular endothelial growth factor (VEGF) protein expression were observed at P17 OIR. In addition, whereas the increased expression of glial fibrillary acidic protein (GFAP) was reversed at P26 OIR, the functional alterations persisted. Using a similar therapeutic schedule, we analyzed the effect of anti-VEGF therapy on autophagy flux. Like Rapamycin, VEGF inhibitor treatment not only reduced the amount of neovascular tufts, but also activated autophagy flux at P17 OIR, mainly in ganglion cell layer and inner nuclear layer. Finally, the effects of the disruption of autophagy by Spautin-1, were evaluated at vascular, glial, and neuronal levels. After a single dose of Spautin-1, Western blot analysis showed a significant decrease in LC3B II and p62 protein expression at P13 OIR, returning both autophagy markers to OIR control levels at P17. In addition, neither gliosis nor functional alterations were attenuated. In line with these results, TUNEL staining showed a slight increase in the number of positive cells in the outer nuclear layer at P17 OIR. Overall, our results demonstrate that all treatments of induction or inhibition of the autophagic flux reduced neovascular area but were unable to completely reverse the neuronal damage. Besides, compared to current treatments, rapamycin provides a more promising therapeutic strategy as it reduces both neovascular tufts and persistent gliosis.
Hypoxia is one of the main insults in proliferative retinopathies, leading to neovascularization and neurodegeneration. To maintain homeostasis, neurons require efficient degradation and recycling systems. Autophagy participates in retinal cell death, but it is also a cell survival mechanism. Here, we analyzed the role of autophagy at the three characteristic time periods in the oxygen-induced retinopathy (OIR) mouse model and determined if its modulation can improve vascular and non-vascular alterations. Experiments were performed with chloroquine (CQ) in order to monitor autophagosome accumulation by lysosomal blockade. Post natal day (P)17 OIR mouse retinas showed a significant increase in autophagy flux. In particular, an intense LC3B and p62 staining was observed in inner layers of the retina, mainly proliferating endothelial cells. After a single intraocular injection of Rapamycin at P12 OIR, a decreased neovascular area and vascular endothelial growth factor (VEGF) protein expression were observed at P17 OIR. In addition, whereas the increased expression of glial fibrillary acidic protein (GFAP) was reversed at P26 OIR, the functional alterations persisted. Using a similar therapeutic schedule, we analyzed the effect of anti-VEGF therapy on autophagy flux. Like Rapamycin, VEGF inhibitor treatment not only reduced the amount of neovascular tufts, but also activated autophagy flux at P17 OIR, mainly in ganglion cell layer and inner nuclear layer. Finally, the effects of the disruption of autophagy by Spautin-1, were evaluated at vascular, glial, and neuronal levels. After a single dose of Spautin-1, Western blot analysis showed a significant decrease in LC3B II and p62 protein expression at P13 OIR, returning both autophagy markers to OIR control levels at P17. In addition, neither gliosis nor functional alterations were attenuated. In line with these results, TUNEL staining showed a slight increase in the number of positive cells in the outer nuclear layer at P17 OIR. Overall, our results demonstrate that all treatments of induction or inhibition of the autophagic flux reduced neovascular area but were unable to completely reverse the neuronal damage. Besides, compared to current treatments, rapamycin provides a more promising therapeutic strategy as it reduces both neovascular tufts and persistent gliosis.
Retinal neovascular pathologies are still leading causes of blindness worldwide in middle age (DR) and pediatric [retinopathy of prematurity (ROP)] population (Campochiaro, 2015; Rubio and Adamis, 2016). Currently, there is a wide spectrum of treatments available for these diseases including laser photocoagulation and, more recently the intraocular injections of anti-VEGF agents (Evans et al., 2014; Diabetic Retinopathy Clinical Research Network et al., 2015; Tah et al., 2015). Independently of the etiology, retinal neovascular pathologies are characterized by an increase in cytoplasmic HIF-1α levels, a subsequent dimerization with HIF-1β and translocation to the nucleus (Semenza, 2012). Vascular endothelial growth factor is one of the most critical target genes of HIF, and a well-known key player in neovascularization (NV) (Nagy et al., 2008). This trophic factor has pleiotropic functions over neurons and ECs in health and disease (Saint-Geniez et al., 2008; Zhang et al., 2009). In hypoxic environment VEGF levels largely increase and is the main responsible of ECs survival, migration, and proliferation (Gerhardt, 2008). Nowadays, anti-VEGF therapies are the most recommended treatment for retinal NV as they have proved high efficacy in animal models and clinical trials (Tah et al., 2015). Although anti-VEGF treatment has shown better outcomes than alternative treatments, ophthalmologists have detected unequal response of patients to the same administration scheme. Moreover, they have observed that some patients lost visual acuity after the chronic treatment (Osaadon et al., 2014; Yang et al., 2016). There are two main explanations that shed light on these events. On one hand, other proteins involved in NV, inflammation, vascular tone and metabolism have critical roles, whereby, VEGF inhibition would result insufficient to restore retinal homeostasis and regresses NV in the hypoxic milieu. On the other hand, VEGF is also a neuroprotective factor and its further depletion has deleterious effects over neuronal survival.Consequently, many researchers have designed new pharmacological strategies to cope with NV through the modulation of different proteins or molecular pathways. Based on multiple studies carried out in the field of cancer angiogenesis, recently, it has been proposed that autophagy flux would have an important role as a potential therapeutic tool in clinical medicine (Mizushima and Komatsu, 2011). Autophagy is a catabolic intracellular mechanism that provides recycling of its components through the engulfment of damaged proteins and organelles in a double membrane vesicle (Levine et al., 2015). As it participates in retinal cell death but it is also a cell survival mechanism, its modulation may be either beneficial or deleterious depending on the retinal cell type involved or the disease context (Boya et al., 2016; Chai et al., 2016; Rosa et al., 2016; Amato et al., 2018). In this work, we intend to unravel the role of autophagy on retinal pathological NV and neurodegeneration in mice with oxygen-induced retinopathy (OIR), an animal model of proliferative ischemic retinopathy, and determine if its modulation can improve retinal functionality, gliosis, and avoid neuronal cell death.
Materials and Methods
C57BL/6J mice were handled according to guidelines of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Experimental procedures were designed and approved by the Institutional Animal Care and Use Committee (CICUAL) of the Faculty of Chemical Sciences, National University of Córdoba (Res. HCD 1216/18). All efforts were made to reduce the number of animals used.
Oxygen-Induced Retinopathy (OIR) Mouse Model
In the OIR mouse model (Smith et al., 1994), litters of mice pups and their mothers were exposed to high oxygen concentration (75 ± 2%) from P7 to P12 (hyperoxic period) in an incubator chamber. Oxygen was checked twice daily with an oxygen analyzer (Teledyne Analytical Instruments, Industry, CA, United States). Then, mice were brought to room air (RA) for additional 5 or 14 days. Age-matched control C57BL/6 mice were kept continuously at RA. Animals were maintained in clear plastic cages with standard light cycles (12 h light/12 h dark). At P12, OIR mice were intravitreally injected with a 1.0 μl of solution containing a specific treatment: (a) Rapamycin: 0.5 μg/ml (R0395 Sigma Aldrich, St. Louis, MO, United States); (b) Anti-VEGF mAb: 1.25 μg anti-VEGF diluted 1/20 with phosphate buffered saline (PBS) (Bevacizumab; Genentech, San Francisco, CA, United States) as previously reported (Ridano et al., 2017); (c) Spautin-1 200 μM (SML0440, Sigma Aldrich, St. Louis, MO, United States). Vehicle (DMSO/PBS or PBS)/-injected mice were used as controls. Rapamycin and Spautin-1 concentrations were selected according to in vitro assays (Chen et al., 2014; Russo et al., 2018) and concentrations 10 folds higher than in cell cultures were used (taking in account the dilution of the drug in the vitreous cavity). Briefly, pups were locally anesthetized with one drop of proparacaine hydrochloride 0.5% (Anestalcon, Alcon), exophthalmia was induced with one drop of tropicamide 1% (Midril, Alcon, Buenos Aires, Argentina) and eyes were injected at the upper nasal limbus as described previously (Barcelona et al., 2011). Some mice were sacrificed at three typical times in the OIR mouse model: P12 (maximum vaso-obliteration, VO), P17 (maximum NV) and P26 (vascular alteration resolution) (Smith et al., 1994). To evaluate the effect of Rapamycin or Spautin-1mice were sacrificed 24 h after the injection (P13). In order to analyze the autophagy flux, some mice received an intraperitoneal (i.p.) injection of chloroquine (CQ) 60 mg/kg (Sigma Aldrich, St. Louis, MO, United States) diluted in sterile PBS 4 h before sacrifice. Eyes or retinas of sacrificed mice with CQ pre-treatment were collected and processed for Western blot and immunofluorescence assays and without CQ pre-treatment for quantitative real-time PCR (qRT-PCR), immunohistochemistry, or flat-mount assays. At least six mice per group were used for each condition at each survival time examined. Data were collected from both males and females as there were no apparent sex differences. All mice were sacrificed at the same time of day in order to avoid the circadian effects and to reduce the mouse-to-mouse variability in autophagy markers and flux. Lysosomal analyses were carried out with intraocular injection of 1 μl of red DQ-BSA (1 mg/ml dissolved in PBS pH 7.2; D12051, Invitrogen). The reagent is taken up by every cell and then the red dye is detected in acidic compartments, where DQ is hydrolyzed from albumin. Mice were sacrificed 4 h after DQ injection (without CQ pre-treatment), fixed with 4% paraformaldehyde (PFA) and dehydrated by sucrose gradient for further cryosection.
Electroretinography (ERG)
Electroretinographic activity was assessed as previously described (Ridano et al., 2017). Briefly, after overnight (ON) dark adaptation and under dim red illumination, mice were anesthetized via i.p. injections with a solution containing ketamine (90 mg/kg)/xilacine (8 mg/kg). The pupils were dilated with 1% tropicamide and the cornea was lubricated with gel drops of 0.4% polyethyleneglycol 400 and 0.3% propylene glycol (Systane, Alcon, Buenos Aires, Argentina) to prevent damage. Mice were exposed to stimuli at a distance of 20 cm. A reference electrode was inserted on the back in the neck, a grounding electrode was attached to the tail, and a gold electrode was placed in contact with the central cornea. Electroretinograms were simultaneously recorded from both eyes and 10 responses to flashes of unattenuated white light (5 cd.s/m2, 0.2 Hz) from a photic stimulator (light-emitting diodes) set at maximum brightness were amplified, filtered (1.5-Hz low-pass filter, 1000 high-pass filter, notch activated) and averaged (Akonic BIO-PC, Argentina). The a-wave was measured as the difference in amplitude between the recording at onset and trough of the negative deflection, and the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave. The latencies of the a- and b-waves were measured from the time of flash presentation to the trough of the a-wave or the peak of the b-wave, respectively. Responses were averaged across the two eyes for each mouse.
Labeling of Flat-Mount Retinas
Mice were euthanized at P17 and eyes were enucleated and fixed with freshly prepared 4% PFA for 1–2 h at room temperature (RT). Corneas were removed with scissors along the limbus and the whole retinas were dissected. Then, they were blocked and permeabilized in Tris-buffered saline (TBS) containing 5% BovineSerum Albumin (BSA) and 0.1% Triton-X-100 during6 h at 4°C. After that, retinas were incubated ON with 0.01 μg/μl of Isolectin IB4 Alexa fluor-488 conjugate (GSA-IB4) from Molecular Probes, Inc. (Eugene, OR, United States) and anti-GFAP (1/200; Dako, Carpinteria, CA, United States) or anti- microtubule-associated protein-1 light-chain 3 (LC3) B (1:100; L7543, Sigma). Retinas were then washed with TBS containing 0.1% Triton-X-100, stored in PBS at 4°C and examined by confocal laser-scanning microscopy (Olympus FluoView FV1200; Olympus, Corp., New York, NY, United States).
Retinal Cryosection, Protein Extract, and RNA Sample Preparation
For cryosection, enucleated eyes were fixed during 2 h with 4% PFA at RT, and incubated ON in 10, 20, and 30% of sucrose in PBS at 4°C. Then, they were embedded in optimum cutting temperature (OCT) (Tissue-TEK, Sakura) compound, and 10 μm-thick radial sections were obtained by using a cryostat, as described (Sanchez et al., 2006). Retinal cryosections were stored at -20°C under dry conditions until immunohistochemical analysis.Neural retinas were dissected from RPE/choroid layers for Western blot and qRT-PCR analysis. Protein extracts were obtained from retinas after homogenization with a lysis buffer containing 20 mM Tris-HCl pH 7.5, 137 mM NaCl, 2 mM EDTA pH 8, 1% Nonidet P40, 1 mM phenylmethylsulfonyl fluoride (PMSF), 2 mM sodium ortovanadate and protease inhibitor cocktail (Sigma Aldrich, St. Louis, MO, United States) (Sanchez et al., 2006), and were sonicated during 20 s at 40% amplitude. In addition, some neural retinas were disrupted in 500 μL Trizol (Invitrogen) and were stored at -80°C until RNA extraction. All the assays were performed in triplicate and results are representative of at least three independent experiments (animals in each group).
Immunofluorescence
Immunostaining was performed as described previously (Ridano et al., 2017). Briefly, mouse cryosections were washed in PBS, blocked with 2% of BSA in PBS containing 0.1% Tween-20, for 1 h and then incubated ON at 4°C with the following primary antibodies, respectively: rabbit polyclonal anti-LC3B (1/100; L7543, Sigma Aldrich), mouse monoclonal anti-p62 (1/100; ab56416, Abcam), rabbit polyclonal anti- GS (1/100; ab16802, Abcam), rat monoclonal anti- LAMP1 (1/350; ab25245, Abcam), mouse monoclonal anti- GS (1/100; MAB 302, Millipore), mouse monoclonal anti-CD31 (1/50; Abcam, Inc., Cambridge, MA, United States) and rabbit polyclonal anti-NG-2 (1/100; AB5320, Millipore). Then, sections were washed with TBS 0.1% Triton-X-100 and incubated with secondary antibodies including goat against rabbit or mouse IgG conjugated with Alexa Fluor 488 and 594 (1/250; Molecular Probes, Eugene, OR, United States) and goat anti rat IgG conjugated with Alexa Fluor 594 (1/200; ab150160, Abcam), during 1 h at RT. The sections were also counterstained with Hoechst 33258 (1:3000; Molecular Probes) for 7 min. After a thorough rinse, the sections were mounted with Fluor Save (Calbiochem, La Jolla, CA, United States) and cover slipped. The labeling was visualized using a confocal laser-scanning microscope (Olympus Fluvial FV300 or FV1200; Olympus, Corp., New York, NY, United States). Finally, images were processed with Image J 2 software (National Institutes of Health, Bethesda, MD, United States), including spatial deconvolution, vesicle quantification and colocalization. Negative controls without incubation with primary antibody were carried out to detect unspecific staining (data not shown).
Western Blot
Protein concentration of retinal extracts were determined by a BCA kit (Pierce, Buenos Aires, Argentina) and 10–20 μg of proteins were electrophoresed in 15% SDS-PAGE. After electrophoresis, proteins were transferred to nitrocellulose membranes (Amersham Hybond ECL; GE Healthcare Bio-Sciences AB, Uppsala, Sweden). To prevent non-specific binding, membranes were blocked with 5% milk in TBS containing 0.1% Tween-20 (TBST) during at least 1 h at RT. Then, blots were incubated with primary antibodies diluted in TBST or 5% BSA in TBST for 1 h at RT or overnight at 4°C, according to the antibody. The following antibodies were used: rabbit polyclonal anti-LC3 (1/1000; L7543, Sigma Aldrich), mouse monoclonal anti p62 (1/1000; ab56416, Abcam) mouse monoclonal anti- VEGF (1/500; R&D system), rabbit polyclonal anti-GFAP (1/1000; Dako, Carpinteria, CA, United States), mouse monoclonal anti-GS (1/500; MAB 302, Millipore Corporation MA, United States), rabbit polyclonal anti-caspase 3 (1/300; HPA 002643, Sigma Aldrich) and mouse monoclonal anti-β-actin (1/2000; ab8226, Abcam). Blots were incubated with IRDye 800 CW donkey anti-rabbit Ig, or IRDye 800 CW donkey anti-mouse IgG antibodies (1/15000 in TBS with 5% BSA) for 1 h, protected from light. After washing with TBST, membranes were visualized and quantified using the Odyssey Infrared Imaging System (LI-COR, Inc., Lincoln, NE, United States).
Quantitative Real-Time Polymerase Chain Reaction
Total RNA was extracted from neural retinas using Trizol (Invitrogen), according to the manufacturer’s instructions and was processed as previously reported (Ridano et al., 2017). Briefly, 1 μg of total RNA was reverse-transcribed in a total volume of 20 μl using random primers (Invitrogen, Buenos Aires, Argentina) and 50 U of M-MLV reverse transcriptase (Promega, Corp.). Then, cDNA was mixed with 1x SYBR Green PCR Master Mix (Applied Biosystems) and forward and reverse primers: Beclin1 forward: ATGGAGGGGTCTAAGGCGTC/ Beclin 1 reverse: TGGGCTGTGGTAAGTAATGGA; ATG5 forward: TGTGCTTCGAGATGTGTGGTT/ ATG5 reverse: GTCAAATAGCTGACTCTTGGCAA; MAPLC3 forward: CGCTTGCAGCTCAATGCTAAC/ MAPLC3 reverse: TCGTACACTTCGGAGATGGG; P62 forward: TGTGGAACATGGAGGGAAGAG/ P62 reverse: TGTGCCTGTGCTGGAACTTTC. qPCR were carried out on an Applied Biosystems 7500 Real-Time PCR System with Sequence Detection Software v1.4. The cycling conditions included a hot start at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 60°C for 1 min. Specificity was verified by melting curve analysis. Results were normalized to β-actin (Forward: GGCTGTATTCCCCTCCATCG/ Reverse: CCAGTTGGTAACAATGCCATGT). Relative gene expression was calculated according to the 2-ΔΔCt method. Each sample was analyzed in triplicate. No amplification was observed in PCRs using as template water during the cDNA synthesis (data not shown).
TUNEL Assay
Cell death was examined by terminal deoxynucleotidyltransferase biotin dUTP nick end labeling (TUNEL) assay (Roche, Mannheim, Germany), which contain an anti-dUTP antibody labeled with peroxidase (POD), according to manufacturer’s instructions. Slides were counterstained with methyl green to visualize total nuclei and then mounted with DPX Mounting Media (Sigma Aldrich, St. Louis, MO, United States). Negative controls without enzyme were processed in order to avoid false positive results (data not shown). Images were obtained under a light microscope (Nikon Eclipse TE2000-E, United States).
Statistical Analysis
Statistical analysis was performed using the GraphPad Prism 5.0 software. A p-value < 0.05 was considered statistically significant. Parametric or non-parametric tests were used according to variance homogeneity evaluated by F or Barlett’s tests. Two-tailed unpaired t or Mann–Whitney tests were used in analysis of two groups. One-way analysis of variance (ANOVA) followed by Dunnett´s multiple comparison post-test or Kruskal–Wallis followed by Dunn’s multiple comparison post-test were used to determine statistical significance among more than two different groups. Two-way ANOVA followed by Bonferroni post-test was used in comparisons between groups when two variables were affecting the dependent variable. Mean ± standard error (SEM) are shown in graphs analyzed with parametric tests and median with interquartile range are shown when data were analyzed with non-parametric test.
Results
Hypoxia Induced Autophagy During Neovascular Stage in the OIR Mouse Model
Autophagy is a strictly regulated process that plays a vital role in cell growth, transition, and death (Kimura et al., 2017). In the nervous system it is a matter of intense investigation as these pathways are often missregulated during neovascular and neurodegenerative conditions (Harris and Rubinsztein, 2011; Du et al., 2012; Liu et al., 2016). In this regard, the mouse model of OIR offers an opportunity to examine the role of hypoxia in the pathogenesis of retinal NV, neuroinflammation, oxidative stress, and neurovascular cross-talk (Kim et al., 2016). Thus, in order to study autophagy flux, we determined the expression of classical autophagy markers at the three relevant time points in the OIR mouse model (Figure 1A). As we expected, GSA-IB4 lectin-labeled blood vessels in flat-mount retinas showed, at P17 OIR, a central zone of VO in addition to the characteristic vitreoretinal neovascular tufts, which were not observed in P17RA controls (Figure 1B). Post-mitotic cells, especially neurons, are highly dependent on intracellular degradation systems because they provide adequate waste products elimination. The retina is known to have a fast autophagy flux due to the constant exposure to light and increased production of reactive oxygen species (Trachsel-Moncho et al., 2018). Therefore, we decided to block the autophagosome fusion with lysosomes and degradation with an i.p. injection of CQ to evaluate the accumulation of autophagosomes. Retinal levels for LC3B and p62 protein expression, at each temporal point, were measured in both RA and OIR mice by Western blot assays (Figure 1C). Quantitative analysis revealed a slight increase in LC3B II protein expression level at P12 in OIR mice, which was markedly upregulated in P17, returning to baseline levels at P26. In our experimental conditions, upregulation of LC3B II in retinal extracts at P17 OIR was associated with an increase, although not statistically significant, in p62 protein expression (Figure 1D). To gain more insight into autophagy regulation at the time point where most changes have been observed (P17), additional Western blot assays in mice injected with vehicle or CQ were performed (Figure 1E). Quantitative analysis showed an increase, although not statistically significant, in both LC3B II and p62 levels at P17 OIR compared to RAmice retinas injected with vehicle, which were further enhanced after CQ treatment (Figure 1F). Our data showed that the augmentation of LC3B II by hypoxic injury is due to the enhancement of autophagic flux rather than impaired clearance of autophagosomes.
FIGURE 1
Effect of hypoxia on the autophagic flux during NV and neurodegeneration in OIR mouse retinas. (A) Scheme representing the OIR mouse model with hallmark time points during experimental disease development. Neonatal mice and their nursing mother are kept in room air from birth to P7. At P7, they are exposed to 75% oxygen, which inhibits retinal vessel growth and causes significant VO. Mice are returned to RA at P12; the avascular retina becomes hypoxic, eliciting both normal vessel regrowth and pathological neovascular response. NV reaches its maximum at P17. Shortly thereafter, it spontaneously regresses and the vascular alterations resolve by P25. (B) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in RA and OIR mice. Areas with VO and NV are indicated. Scale bar: 500 μm. (C,D) Representative Western blot and quantification data of autophagy markers LC3B II and p62 from neural retinal extracts of RA and OIR at P12, P17, and P26. Mice were injected i.p. with CQ 4 h before sacrifice. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (E,F) Representative Western blot and quantification data of autophagy markers, LC3B II and p62, from neural retinal samples of RA and OIR mice injected with vehicle or CQ at P17, and evaluated 4 h after administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (G) Beclin-1, ATG5, LC3, and p62 mRNA levels were quantified by qRT-PCR in neurosensory retinas of P17 OIR and RA mice. Results were normalized to β-actin and expressed according to the 2-ΔΔCt method using as calibrator the mRNA level obtained from P17 RA mouse retinas. (H) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of RA and OIR mice injected with CQ at P12, P17, or P26 and evaluated 4 h after administration. Cell nuclei were counterstained with Hoechst 33258 (blue). (I) Representative labeling of LC3B (green) in cryosections of RA and OIR mouse retinas at P17, 4 h after CQ administration. Images were taken with oil 60X objective in the best confocal resolution condition. Cell nuclei were counterstained with Hoechst 33258 (blue) Scale bar: 5 μm. (J) Quantification of LC3B puncta per area or cell with ImageJ analyze particles software. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Effect of hypoxia on the autophagic flux during NV and neurodegeneration in OIR mouse retinas. (A) Scheme representing the OIR mouse model with hallmark time points during experimental disease development. Neonatal mice and their nursing mother are kept in room air from birth to P7. At P7, they are exposed to 75% oxygen, which inhibits retinal vessel growth and causes significant VO. Mice are returned to RA at P12; the avascular retina becomes hypoxic, eliciting both normal vessel regrowth and pathological neovascular response. NV reaches its maximum at P17. Shortly thereafter, it spontaneously regresses and the vascular alterations resolve by P25. (B) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in RA and OIR mice. Areas with VO and NV are indicated. Scale bar: 500 μm. (C,D) Representative Western blot and quantification data of autophagy markers LC3B II and p62 from neural retinal extracts of RA and OIR at P12, P17, and P26. Mice were injected i.p. with CQ 4 h before sacrifice. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (E,F) Representative Western blot and quantification data of autophagy markers, LC3B II and p62, from neural retinal samples of RA and OIR mice injected with vehicle or CQ at P17, and evaluated 4 h after administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (G) Beclin-1, ATG5, LC3, and p62 mRNA levels were quantified by qRT-PCR in neurosensory retinas of P17 OIR and RAmice. Results were normalized to β-actin and expressed according to the 2-ΔΔCt method using as calibrator the mRNA level obtained from P17RAmouse retinas. (H) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of RA and OIR mice injected with CQ at P12, P17, or P26 and evaluated 4 h after administration. Cell nuclei were counterstained with Hoechst 33258 (blue). (I) Representative labeling of LC3B (green) in cryosections of RA and OIR mouse retinas at P17, 4 h after CQ administration. Images were taken with oil 60X objective in the best confocal resolution condition. Cell nuclei were counterstained with Hoechst 33258 (blue) Scale bar: 5 μm. (J) Quantification of LC3B puncta per area or cell with ImageJ analyze particles software. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.Next, we examined the transcript expression of molecules involved in nucleation (Beclin-1), elongation (ATG-5), and structure (LC3) of the autophagosome (Yin et al., 2016), and also the autophagy substrate p62 at the peak of NV. Beclin-1, ATG-5 and LC3 mRNA levels did not showed changes at P17, whereas expression of p62 mRNA was increased ∼1.8-fold at this time point (Figure 1G).By immunostaining of retinal cryosections we confirmed the increase in LC3B and p62 protein expression at P17 OIR (Figure 1H). Given that there is a tissue gradient of hypoxia in OIR retinas (Rodrigues et al., 2013), we decided to evaluate whether variations in autophagy flux were similar in every retinal layer. The analysis revealed an intense LC3B and p62 signal in the inner limiting membrane (ILM) at P17 OIR (Figure 1I). As neurons in the INL and GCL are severely affected by hypoxia (Ridano et al., 2017), quantification evidenced an increase in LC3B puncta mainly in these areas. At the same time, no modification in the autophagy marker puncta was observed in the ONL (Figure 1I,J).Finally, we explored in more detail the presence of autophagosomes in the ILM, a region where vascular and macroglial cells actively interact. In cryosections, we identified Müller glial cells (MGCs) and vascular cells by staining with GS and CD31 respectively, whereas in retinal flat-mounts ECs were isolectin IB4+ cells (Figure 2, upper panel). Both macroglial and ECs showed, at P17 OIR, a slight increase in LC3B vesicles within the cells (Figure 2A,B). However, in neovascular tufts, ECs showed the great number of autophagic vesicles (Figure 2C).
FIGURE 2
Effect of hypoxia on LC3B expression and distribution in P17 mouse retinas. Double labeling using: (A) a mouse monoclonal antibody for LC3B (red) and a MGC marker, anti-GS (green). Representative merged fluorescence confocal images of entire z-stack (XY) with orthogonal views, XZ and YZ of a mouse retina. Arrows are indicating autophagosomes in MGCs. Scale bar: 5 μm; (B) a mouse monoclonal antibody for LC3B (green) and an EC-specific marker, anti-CD31 (red). Cell nuclei were counterstained with Hoechst 33258 (blue). Arrows are indicating autophagosomes in ECs. Scale bar: 50 μm. (C) High magnification confocal micrograph of the representative P17 OIR retina showing a typical neovascular tuft (GSA-IB4, green) staining with LC3B (red). Images were taken with oil 60X objective in the best confocal resolution condition. Representative merged fluorescence confocal images of entire z-stack (XY) with orthogonal views, XZ and YZ. Scale bar: 15 μm (D) Representative immunofluorescence analysis of LAMP1 (red) and LC3B (green) in cryosections of P17 RA and OIR mice. Scale bar: 50 μm. (E) Representative immunofluorescence analysis of LAMP1 (red) and LC3B (green) in cryosections of P17 RA and OIR mice. Images were taken with oil 60X objective and zoom 5x in the best confocal resolution condition. Cell nuclei were counterstained with Hoechst 33258 (blue) Scale bar: 5 μm. (F) Quantification of LC3B/LAMP1 vesicles per area (ILM) or cell (GCL and INL) with ImageJ JACoP software. Pearson values were compared statistically. Statistical t-test was performed. (G) Representative immunofluorescence analysis of LAMP1 (red) in cryosections of RA and OIR mice injected with CQ at P17, and evaluated 4 h after administration. Scale bar: 50 μm. (H) Quantification of LAMP1 puncta per area or cell with ImageJ analyze particles software. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (I) Representative TUNEL-labeled cryosections of P17 RA and OIR mice and cryosections of mice intravitreally injected with bovine serum albumin derivate DQ-BSA and co stained with anti-LC3B (green). Arrows are indicating DQ-BSA staining in ECs. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; NV, neovascularization.
Effect of hypoxia on LC3B expression and distribution in P17mouse retinas. Double labeling using: (A) a mouse monoclonal antibody for LC3B (red) and a MGC marker, anti-GS (green). Representative merged fluorescence confocal images of entire z-stack (XY) with orthogonal views, XZ and YZ of a mouse retina. Arrows are indicating autophagosomes in MGCs. Scale bar: 5 μm; (B) a mouse monoclonal antibody for LC3B (green) and an EC-specific marker, anti-CD31 (red). Cell nuclei were counterstained with Hoechst 33258 (blue). Arrows are indicating autophagosomes in ECs. Scale bar: 50 μm. (C) High magnification confocal micrograph of the representative P17 OIR retina showing a typical neovascular tuft (GSA-IB4, green) staining with LC3B (red). Images were taken with oil 60X objective in the best confocal resolution condition. Representative merged fluorescence confocal images of entire z-stack (XY) with orthogonal views, XZ and YZ. Scale bar: 15 μm (D) Representative immunofluorescence analysis of LAMP1 (red) and LC3B (green) in cryosections of P17RA and OIR mice. Scale bar: 50 μm. (E) Representative immunofluorescence analysis of LAMP1 (red) and LC3B (green) in cryosections of P17RA and OIR mice. Images were taken with oil 60X objective and zoom 5x in the best confocal resolution condition. Cell nuclei were counterstained with Hoechst 33258 (blue) Scale bar: 5 μm. (F) Quantification of LC3B/LAMP1 vesicles per area (ILM) or cell (GCL and INL) with ImageJ JACoP software. Pearson values were compared statistically. Statistical t-test was performed. (G) Representative immunofluorescence analysis of LAMP1 (red) in cryosections of RA and OIR mice injected with CQ at P17, and evaluated 4 h after administration. Scale bar: 50 μm. (H) Quantification of LAMP1 puncta per area or cell with ImageJ analyze particles software. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01. (I) Representative TUNEL-labeled cryosections of P17RA and OIR mice and cryosections of mice intravitreally injected with bovineserum albumin derivate DQ-BSA and co stained with anti-LC3B (green). Arrows are indicating DQ-BSA staining in ECs. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; NV, neovascularization.In order to determine if the degradative pathway is activated at P17 OIR, we performed immunofluorescence assays using a combination of LC3B antibody along with the late endosomal compartments and lysosomes marker LAMP1 antibody (Figure 2D). Fusion of LC3B and LAMP1 positive vesicles was observed in ILM, GCL, and INL in OIR and RA neural retinas (Figure 2E). Our statistical analysis did not found differences in colocalization quantification in absence of CQ, probably due to the fast flux in the retina (Figure 2F). Through the injection of CQ, we could detect an increase of LAMP-1 vesicles, suggesting that lysosomes and late endosomes are following the degradation pathway properly (Figure 2G,H). To further examine the lysosomal activity, mice were intravitreally injected with bovineserum albumin derivate DQ-BSA (Frost et al., 2017). Confocal images showed an increased DQ-BSA staining in ECs at the time when the NV peaks in the OIR mice, compared to RA control retinas (Figure 2I), correlating with the observed in Figure 2E. However, this increase was not observed in the retinal layers where death was increased (Figure 2I). Collectively, our results showed an increase in autophagy flux mainly in proliferating ECs, and inner layers of the retina whereas neurons from the ONL did not showed modifications in autophagic flux at P17 OIR.
Rapamycin Promoted Autophagy, Prevented NV and Improved Gliosis in the OIR Mice Model
Rapamycin is a potent inhibitor of the complex mTORC1. One of the functions of this multi-protein complex is to prevent the formation of new autophagosomes by phosphorylation of ATG13. In this sense, Rapamycin acts as an autophagy inductor and its different pharmacological formulations (everolimus, sirolimus, among others) have shown beneficial effects in cancer therapies (Li et al., 2014). On the other hand, mTORC1 phosphorylation increase VEGF synthesis, a trophic factor required for vessel survival, proliferation and migration (Wei et al., 2016). New insights in retinal neurodegeneration pointed Rapamycin as a promising therapy as it could both activate autophagy and decrease angiogenesis (Zhu and Du, 2018). Hence, we decided to evaluate neovascular and neurodegenerative processes in the OIR mouse model after Rapamycin treatment (Figure 3A). After a single intraocular injection at P12 OIR, we verified the increase in the autophagy flux 24 h later by Western blot assay (Figure 3B). In addition, as Yagasaki et al. (2014) demonstrated previously, Rapamycin decreased the NV in P17 OIR retinas. Quantitative analysis revealed a decrease of more than 75% of retinal NV area. However, the treatment was not able to attenuate other vascular alterations as avascular area, vessel dilatation and tortuosity (Figure 3C,D). In line with these observations, our next goal was to determine the protein expression levels of VEGF after Rapamycin treatment. Our results demonstrate that Rapamycin injection at P12 OIR significantly reduced VEGF protein expression in P17, respect to vehicle-injected OIR mouse samples (Figure 3E). Pericytes are mesenchymal cells that make important contributions to the microvascular tree in both normal and pathologic tissues (Gerhardt and Betsholtz, 2003). To determine the effect of Rapamycin on pericytes, retinal cryosections at P17 OIR were analyzed by immunofluorescence assay. Confocal microscopy analysis revealed no significant changes in NG-2 (a pericyte marker) staining after Rapamycin injection at P12 among both conditions (Figure 3F).
FIGURE 3
Effect of Rapamycin on the vascular alterations in the OIR mouse retinas. (A) Rapamycin treatment schedule. Rapamycin (0,5 μg/ml) or vehicle was intravitreally injected at P12 and evaluated at P13, P17, or P26 after 4 h of CQ administration. (B) Representative Western blot and quantification data of autophagy markers, LC3B II and p62, from neural retinal extracts of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P13, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in OIR-vehicle and OIR-Rapamycin mice. Areas with VO and NV are indicated. Scale bar: 500 μm. (D) The VO (%) was quantified as the ratio of central avascular area to whole retinal area, the NV (%) was quantified as a percentage of whole retinal area. In mayor vessels of the retina, diameter was quantified by tracing a transversal line to the vessel. The tortuosity was obtained by drawing a line along the vessel and comparing it to a straight line traced from the optic nerve to the first branching point. (E) Representative Western blot and quantification data of VEGF from neural retinal extracts in OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (F) Representative immunofluorescence analysis of NG-2 (green) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01.
Effect of Rapamycin on the vascular alterations in the OIR mouse retinas. (A) Rapamycin treatment schedule. Rapamycin (0,5 μg/ml) or vehicle was intravitreally injected at P12 and evaluated at P13, P17, or P26 after 4 h of CQ administration. (B) Representative Western blot and quantification data of autophagy markers, LC3B II and p62, from neural retinal extracts of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P13, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in OIR-vehicle and OIR-Rapamycinmice. Areas with VO and NV are indicated. Scale bar: 500 μm. (D) The VO (%) was quantified as the ratio of central avascular area to whole retinal area, the NV (%) was quantified as a percentage of whole retinal area. In mayor vessels of the retina, diameter was quantified by tracing a transversal line to the vessel. The tortuosity was obtained by drawing a line along the vessel and comparing it to a straight line traced from the optic nerve to the first branching point. (E) Representative Western blot and quantification data of VEGF from neural retinal extracts in OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (F) Representative immunofluorescence analysis of NG-2 (green) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01.Persistent glial activation is considered a bad prognosis sign, as macroglial reactive cells frequently secrete cytokines and chemokines, contributing to the proinflammatory environment and mediating neuronal death (Subirada et al., 2018). Recently, we have demonstrated that P17 OIR mouse retinas showed the highest neovascular profile and exhibited neuro-glial injury as well as retinal functional loss, which persisted until P26 OIR (Ridano et al., 2017). Herein, we further analyzed if the inhibition of mTORC1 improved gliosis. By Western blot assays we observed comparable protein expression of GFAP in Rapamycin and vehicle-injected P17 OIR retinas (Figure 4A,B), which was corroborated by confocal microscopy analysis of flat mounts retinas (Figure 4C). However, the quantification at P26 evidenced a significant decrease of the GFAP protein expression after Rapamycin injection at P12. At the same time, we evaluated glial ability to prevent excitotoxicity by analyzing GS protein expression. Quantification of protein levels of the detoxifying enzyme indicated that it was not modified after Rapamycin treatment neither at P17 nor at P26 (Figure 4A,B), although a slight increase in the inner layers was detected by immunofluorescence staining (Figure 4D).
FIGURE 4
Effect of Rapamycin on the glial reactivity, neuronal functionality, and autophagy markers in OIR mouse retinas. (A) Representative Western blot of GS and GFAP from neural retina extracts of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. β-Actin is shown as a loading control. (B) Levels of GS and GFAP were quantified by densitometry and normalized to β-actin. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GFAP staining in OIR-vehicle and OIR-Rapamycin mice. Scale bar: 500 μm. (D) Representative immunofluorescence analysis of GS (green) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. (E) Amplitudes and latencies of a- and b-waves from scotopic ERG were recorded at P17 and P26 in RA and OIR mice injected at P12 with vehicle or Rapamycin. Data show the average of responses of both eyes with eight mice per condition. (F) Representative TUNEL-labeled cryosections of RA and OIR mice injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26. Scale bar: 50 μm. (G,H) Representative Western blot and quantification data of total caspase-3, LC3B II and p62 from neural retina samples of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (I) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
Effect of Rapamycin on the glial reactivity, neuronal functionality, and autophagy markers in OIR mouse retinas. (A) Representative Western blot of GS and GFAP from neural retina extracts of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. β-Actin is shown as a loading control. (B) Levels of GS and GFAP were quantified by densitometry and normalized to β-actin. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GFAP staining in OIR-vehicle and OIR-Rapamycinmice. Scale bar: 500 μm. (D) Representative immunofluorescence analysis of GS (green) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. (E) Amplitudes and latencies of a- and b-waves from scotopic ERG were recorded at P17 and P26 in RA and OIR mice injected at P12 with vehicle or Rapamycin. Data show the average of responses of both eyes with eight mice per condition. (F) Representative TUNEL-labeled cryosections of RA and OIR mice injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26. Scale bar: 50 μm. (G,H) Representative Western blot and quantification data of total caspase-3, LC3B II and p62 from neural retina samples of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (I) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or Rapamycin at P12 and evaluated at P17 and P26, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.In retinal neovascular pathologies there is a direct relationship between vascular changes and neuronal dysfunction (Kern, 2014). Thus, we performed ERG studies in both OIR groups (vehicle and Rapamycin) and recorded the intensity (amplitude) and the speed (latency) of the neuronal response after light stimuli. Results demonstrated that neurodegeneration associated to NV was not prevented by the injection at P12 of Rapamycin as ERG signals at P17 and P26 did not show differences after treatment (Figure 4E). In line with this result, TUNEL assay (Figure 4F) and Western blot quantification of total caspase-3, in retinal extracts of OIR mice (Figure 4G,H), were similar in Rapamycin-injected respect to vehicle-injected OIR mouse samples.We also evaluated changes in autophagy flux at P17 and P26 OIR after Rapamycin treatment. As shown in Figure 4G,H, increased levels of LC3B II and p62 expression persisted up to P17. Immunofluorescence assays (Figure 4I), were consistent with the Western blot results demonstrating LC3B and p62 staining mainly at GCL and INL. Together, these results indicate that a single injection of Rapamycin was able to prevent the formation of neovessels at P17 OIR by decreasing VEGF protein expression and ameliorate gliosis at P26. By contrast, other vascular and neuronal abnormalities were not reverted.
Anti-VEGF Treatment Increased the Autophagy Flux in OIR Mouse Retinas
In recent years, several studies have shown that VEGF inhibitors can lead to the activation of autophagy, including ranibizumab, bevacizumab, and several other vascular inhibitors (Liang et al., 2015; Lytvynchuk et al., 2015; Liu et al., 2016). Thus, we decided to determine whether the classical anti-angiogenic treatment was able to modulate the autophagic flux. For this purpose, using a similar treatment schedule (Figure 5A), we verified the anti-VEGF effect on vascular alteration in flat-mount retinas, where a significant reduction in neovascular and avascular areas was observed (Figure 5B). In addition, as expected, the administration of anti-VEGF mAb at P12 significantly reduced VEGF protein expression in P17 respect to vehicle-injected OIR mouse samples (Figure 5C,D).
FIGURE 5
Effect of Anti-VEGF treatment on autophagy markers in the OIR mouse retinas. (A) Anti-VEGF mAb treatment schedule. Anti-VEGF mAb (1.25 μg) or vehicle was intravitreally injected at P12 and evaluated a P17 or P26, 4 h after CQ administration. (B) Representative images of flat-mount retinas at P17 OIR showing GSA-IB4 vascular staining in vehicle or anti-VEGF-injected eyes. Areas with VO and NV are indicated. Scale bar: 500 μm. (C) Representative Western blot of VEGF from P17 neural retinal extracts of OIR mice injected at P12 with vehicle or anti-VEGF mAb. β-Actin is shown as a loading control. (D) Levels of VEGF were quantified by densitometry and normalized to β-actin. Graph shows results of three independent experiments. (E) Representative Western blot of LC3B II and p62 from neural retina extracts of OIR mice intravitreally injected with vehicle or anti-VEGF mAb at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. (F) Levels of LC3B II and p62 were quantified by densitometry and normalized to β-actin. Graph shows results of four independent experiments. (G) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or anti-VEGF mAb at P12 and evaluated at P17, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗∗p < 0.01.
Effect of Anti-VEGF treatment on autophagy markers in the OIR mouse retinas. (A) Anti-VEGF mAb treatment schedule. Anti-VEGF mAb (1.25 μg) or vehicle was intravitreally injected at P12 and evaluated a P17 or P26, 4 h after CQ administration. (B) Representative images of flat-mount retinas at P17 OIR showing GSA-IB4 vascular staining in vehicle or anti-VEGF-injected eyes. Areas with VO and NV are indicated. Scale bar: 500 μm. (C) Representative Western blot of VEGF from P17 neural retinal extracts of OIR mice injected at P12 with vehicle or anti-VEGF mAb. β-Actin is shown as a loading control. (D) Levels of VEGF were quantified by densitometry and normalized to β-actin. Graph shows results of three independent experiments. (E) Representative Western blot of LC3B II and p62 from neural retina extracts of OIR mice intravitreally injected with vehicle or anti-VEGF mAb at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. (F) Levels of LC3B II and p62 were quantified by densitometry and normalized to β-actin. Graph shows results of four independent experiments. (G) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or anti-VEGF mAb at P12 and evaluated at P17, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗∗p < 0.01.To determine the effect of anti-VEGF treatment on the autophagic process in the OIR mouse model we first examined the classical autophagy markers by Western blot assays. Quantitative analysis revealed a slight but significantly increase in LC3B II levels at P17 OIR (Figure 5E,F). This increase was corroborated by immunofluorescence assays where LC3B was detected mainly in GCL and INL (Figure 5G). These findings demonstrated that targeting VEGF prevented vascular alterations and also increased the autophagic flux in P17 OIR retinas.
Spautin-1 Inhibited Autophagy, Reduced NV but Did Not Prevented Neurodegeneration in the OIR Mouse Model
As autophagy seemed a key feature during NV, we next decided to decrease the autophagy flux by a single administration of Spautin-1 at P12 and to evaluate vascular, neuronal, and glial parameters at P17 and P26, respectively (Figure 6A). Western blot analysis showed a significant decrease in LC3B II expression at P13 (Figure 6B). Quantitative analysis of flat-mounts labeled with GSA-IB4 lectin showed a significant reduction of more than 70% in neovascular area after Spautin-1 treatment. However, other vascular alterations did not improved in OIR Spautin-1mice, suggesting that autophagy is important for NV and that the activation in the OIR mouse is not mediating physiological revascularization (Figure 6C,D). In addition, a slight decrease in NG-2 staining was observed in Spautin-1mice at P17 OIR (Figure 6E).
FIGURE 6
Effect of the Spautin-1 on the NV in OIR mouse retinas. (A) Spautin-1 treatment schedule. Spautin-1 (200 μM) or vehicle was intravitreally injected at P12 and evaluated at P17 or P26, 4 h after of CQ administration. (B) Representative Western blot and quantification data of autophagy marker LC3B II from neural retinal extracts of OIR mice intravitreally injected with Spautin-1 or vehicle at P12 and evaluated at P13, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in OIR-vehicle and OIR-Spautin-1 mice. Areas with VO and NV are indicated. Scale bar: 500 μm. (D) The VO (%) was quantified as the ratio of central avascular area to whole retinal area, the NV (%) was quantified as a percentage of whole retinal area. In mayor vessels of the retina, diameter was quantified by tracing a transversal line to the vessel. The tortuosity was obtained by drawing a line along the vessel and comparing it to a straight line traced from the optic nerve to the first branching point. (E) Representative immunofluorescence analysis of NG-2 (green) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01.
Effect of the Spautin-1 on the NV in OIR mouse retinas. (A) Spautin-1 treatment schedule. Spautin-1 (200 μM) or vehicle was intravitreally injected at P12 and evaluated at P17 or P26, 4 h after of CQ administration. (B) Representative Western blot and quantification data of autophagy marker LC3B II from neural retinal extracts of OIR mice intravitreally injected with Spautin-1 or vehicle at P12 and evaluated at P13, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (C) Representative images of flat-mount retinas at P17 showing GSA-IB4 vascular staining in OIR-vehicle and OIR-Spautin-1mice. Areas with VO and NV are indicated. Scale bar: 500 μm. (D) The VO (%) was quantified as the ratio of central avascular area to whole retinal area, the NV (%) was quantified as a percentage of whole retinal area. In mayor vessels of the retina, diameter was quantified by tracing a transversal line to the vessel. The tortuosity was obtained by drawing a line along the vessel and comparing it to a straight line traced from the optic nerve to the first branching point. (E) Representative immunofluorescence analysis of NG-2 (green) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ∗p < 0.05, ∗∗p < 0.01.After Spautin-1 or vehicle treatment, no changes in GFAP levels were detected by Western blot of neural retinas samples (Figure 7A,B) or in flat-mount of retinas (Figure 7C). Similarly, no statistically differences in the expression of GS protein were found by Western blot (Figure 7A,B) or immunofluorescence (Figure 7D) after Spautin-1 treatment neither at P17 nor at P26.
FIGURE 7
(A) Effect of Spautin-1 on the glial reactivity, neuronal functionality and autophagy markers in OIR mouse retinas. Representative Western blot of GFAP and GS from neural retina extracts of OIR mice intravitreally injected with Spautin-1 or vehicle at P12 and evaluated at P17, 4 h after CQ treatment. β-Actin is shown as a loading control. (B) Levels of GFAP and GS were quantified by densitometry and normalized to β-actin. Graph shows results of four independent experiments. (C) Representative images of flat-mount retinas at P17 showing GFAP staining in OIR-vehicle and OIR-Spautin-1 mice. Scale bar: 500 μm. (D) Representative immunofluorescence analysis of GS (green) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. (E) Amplitudes and latencies of a- and b-waves from scotopic ERG were recorded at P17 and P26 in RA and OIR mice injected at P12 with vehicle or Spautin-1. Data show the average of responses in both eyes with eight mice per condition. (F) Representative TUNEL-labeled cryosections of RA and OIR mice injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26. Scale bar: 50 μm. (G,H) Representative Western blot and quantification data of total caspase-3, LC3B II and p62 from neural retina samples of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (I) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ns, non-significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.
(A) Effect of Spautin-1 on the glial reactivity, neuronal functionality and autophagy markers in OIR mouse retinas. Representative Western blot of GFAP and GS from neural retina extracts of OIR mice intravitreally injected with Spautin-1 or vehicle at P12 and evaluated at P17, 4 h after CQ treatment. β-Actin is shown as a loading control. (B) Levels of GFAP and GS were quantified by densitometry and normalized to β-actin. Graph shows results of four independent experiments. (C) Representative images of flat-mount retinas at P17 showing GFAP staining in OIR-vehicle and OIR-Spautin-1mice. Scale bar: 500 μm. (D) Representative immunofluorescence analysis of GS (green) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17, 4 h after CQ administration. Scale bar: 50 μm. (E) Amplitudes and latencies of a- and b-waves from scotopic ERG were recorded at P17 and P26 in RA and OIR mice injected at P12 with vehicle or Spautin-1. Data show the average of responses in both eyes with eight mice per condition. (F) Representative TUNEL-labeled cryosections of RA and OIR mice injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26. Scale bar: 50 μm. (G,H) Representative Western blot and quantification data of total caspase-3, LC3B II and p62 from neural retina samples of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26, 4 h after CQ administration. β-Actin is shown as a loading control. Graph shows results of three independent experiments. (I) Representative immunofluorescence analysis of LC3B (green) and p62 (red) in cryosections of OIR mice intravitreally injected with vehicle or Spautin-1 at P12 and evaluated at P17 and P26, 4 h after CQ administration. Cell nuclei were counterstained with Hoechst 33258 (blue). Scale bar: 50 μm. ILM, inner limiting membrane; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer. Data are presented as mean ± SEM. ns, non-significant, ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001.In regard to neuronal functionality, the amplitude of the a-wave showed a tendency to decrease in OIR Spautin-1mice at P17. In accordance, a later response (increased latency) was detected in photoreceptors as well as in inner neurons after autophagy inhibition (Figure 7E). Quantitative analysis of a-wave and b-wave amplitudes and latencies evidence no significant changes in neuronal functionality at P26. In line with these results, TUNEL staining showed a slight increase in the number of positive cells in the ONL after Spautin-1 treatment at P17 OIR (Figure 7F). Activation of apoptosis, measured by a reduction in total caspase 3 protein levels was not significantly different at both time points evaluated (Figure 7G,H). Finally, we evaluated protein expression of LC3B and p62 5 days (P17) or 14 days (P26) after Spautin-1 treatment. Quantitative analysis of Western blot assays (Figure 7G,H) and confocal microscopy images (Figure 7I) evidenced that both autophagy markers returned to OIR levels. These results showed that the inhibition of autophagy by Spautin-1 was harmful for the functionality and survival of photoreceptors in P17 OIR retinas.
Discussion
Preretinal NV is a common feature in many diseases, including ROP, DR and Sickle cell retinopathy. Even though their pathophysiology is different, this family of retinopathies is characterized by the decrease in oxygen tension at a certain stage. The immediate response is the increase in VEGF synthesis, a trophic factor responsible of the proliferation of ECs that originate fragile and immature vascular tufts (Campochiaro, 2015; Rubio and Adamis, 2016). Simultaneously, other events take place in the retina as gliosis and neurodegeneration, which can be developed by the hypoxic stimulus or another primary injury (Ridano et al., 2017). Coincidentally, proliferative retinopathies treatments are palliative and aim to manage NV. However, ongoing inflammation, neuronal death, and impaired oxygen supply frequently lead to neovascular recurrence. Thus, previous studies indicated that a more appropriate therapy should encompass the normalization of both vascular and non-vascular alterations in proliferative retinopathies (Liang et al., 2012).Modulation of autophagy flux results an attractive target, as this intracellular process occurs in every cell and has proven relationship with neurodegeneration, angiogenesis, and inflammation (Boya et al., 2016). Several research studies have demonstrated that inhibition or stimulation of the autophagic flux is able to reverse the alterations of multiple chronic or acute pathologies, including visual disturbances (Mitter et al., 2012; Russo et al., 2013; Chinskey et al., 2014; Frost et al., 2014; Chai et al., 2016; Rosa et al., 2016; Amato et al., 2018). Rapamycin, rapalogs and CQ are the most habitual choice for experimental design as they have been approved by FDA for a specific treatment (Nalbandian et al., 2015; Kezic et al., 2018) and it would be easier to execute clinical trials for second uses of these drugs.Therefore, we initially explored changes in the autophagy flux in the OIR mouse model. To note, OIR model very closely recapitulates the pathologic events occurring in ROP and some aspects of proliferative DR (Smith et al., 1994). Treatments were carried out at different postnatal days when pups were still in developmental phase, where autophagy plays a crucial role (Boya et al., 2016). Indeed, Western blot assays in RA showed a decrease of LC3B II and p62 protein levels from P12 to P26, indicating a high autophagy flux early after birth. In contrast, OIR mice showed an increase in LC3B II and p62 protein levels at P17 OIR, compared to RA controls demonstrating a rise in autophagosomes in the cytosol of retinal cells. Transcriptional activity of autophagy proteins revealed a significant increase in p62 mRNA levels at P17OIR. Upon induction of the flux, p62 is degraded into the autophagosome and it would be necessary to synthesize more protein. This result would indicate that the increase in p62 protein levels at this time point is a consequence of the increased protein synthesis but not of its accumulation.Physiological vascularization of the retina completes at P21 in mice, when the provisional hyaloid vasculature is replaced by the definite one following a hypoxic gradient. Firstly, the superficial plexus is formed by the radial sprouting of vessels from the optic nerve. Later, the deep plexus is formed by transversal outgrowth of superficial vessels and the retinal vasculature achieves completion with the formation of the intermediate plexus (Stahl et al., 2010). Due to the fact that there is an irregular oxygen supply in the different layers of the retina, the sensing of the hypoxic stimulus could vary along the neural retina and therefore the cellular response (Rodrigues et al., 2013). Confocal images showed that areas near the vascular plexus, GCs and neurons residing in the INL increased LC3B protein expression in P17 OIR mice, whereas autophagy markers were not modified in ONL neurons. Unchanged autophagic flux in photoreceptors could be explained by the provision of oxygen by the choroid vasculature to rods and cones, preventing severe hypoxia in this layer. Although photoreceptors are damaged in OIR model, a reduced cell death rate is observed (Ridano et al., 2017). Nearby to the ILM, both MGCs and ECs showed an increase in LC3B staining. Interestingly, at P17 OIR, LC3B-positive vesicles were found inside ECs in neovascular tufts, suggesting an increased autophagic flux in proliferating cells.We further confirmed the activation in autophagy flux at P17 OIR by observing a greater number of LC3B/LAMP1 double labeled vesicles, indicating an increase in amphisomes in the inner layers of the retina compared to control mice. An increase in LAMP1 structures was observed after blockade of the flux with CQ, mainly in the ILM, evidencing that the degradation pathway is activated. In addition, neovessels in the ILM hydrolyzed DQ-BSA in lysosomes in great proportion. By TUNEL assay, we demonstrate that cell viability is reduced in INL and GCL. Indeed, neurons undergoing cell death or high hypoxic stress could activate autophagy flux as a survival mechanism.Next we wonder if the administration of Rapamycin at P12 could improve vascular, glial, or neuronal alterations in OIR mice. We took into account that mTORC1 inhibition increases autophagy flux, but also modulates multiple intracellular pathways related to inflammation, angiogenesis and metabolism. A single intraocular injection of Rapamycin decreased the area occupied by neovessels, however the treatment did not promote physiological revascularization (evaluated by avascular area, vessel dilatation, and tortuosity). The normalization of the vascular plexus is essential for the proper irrigation of the retinal tissue and prevents future alterations derived from the turbulence in the blood flow or stasis of blood cells (Liang et al., 2012). The reduction in NV area was supported by the decrease in VEGF levels. It has been described that inhibition of mTORC1 decreases the synthesis of the transcription factor HIF-1α and consequently downregulates the expression of its target genes (Liu et al., 2015). Notably, in the retina VEGF is produced mainly in MGCs, astrocytes, GCs, retinal pigmented epithelium and ECs in a minor proportion (Wang et al., 2010). Then, it is possible that the modulation of the neovascular process is due to the direct effect of Rapamycin on other cells rather than endothelium. In fact, Rapamycin could be a more successful therapeutic strategy because it decreases the synthesis of VEGF, providing an adequate level of the trophic factor. The excessive inhibition of VEGF signaling would be detrimental for neurons. Under certain pathological conditions, increased autophagy flux can also induce cell death (Hirt et al., 2018). In our model, Rapamycin did not alter pericytes viability, one of the most susceptive cells in the vasculature. Persistence of mural cells is a good marker of vascular maturation, indicating that final stage of vasculogenesis is not altered and the newly formed vessels are functional.Related to gliosis, Rapamycin markedly reduced GFAP expression at P26 OIR, indicating a decrease in the glial response during the neovascular regression stage. This would contribute to the reduction in the persistent pro-inflammatory response that promotes damage in the retinal tissue. Unfortunately, a single dose of Rapamycin was insufficient to increase neuronal functionality. Further studies would be necessary to evaluate if a prolonged administration schedule improves visual function.Previously, it has been reported that high dose of Rapamycin increases the avascular area (Yagasaki et al., 2014) which could be a result of reduced proliferation or increased cell death of ECs. Here, the induction in autophagy flux did not resulted in an increase of apoptosis, measured by total caspase 3, suggesting that the crosstalk between both pathways is not the responsible of the caspase mediated cell death. Our results showed that the increase in autophagy flux continue up to P17 OIR, indicating that Rapamycin has a relatively long half-life in the vitreous, as previously reported (Nguyen et al., 2018).In a comparative experiment, we analyzed the effect of the anti-VEGF therapy on the autophagy flux. Western blot analysis revealed a slight induction of the flux at P17 OIR. As confocal images showed an increase in the autophagy proteins, LC3B and p62, in GCL and INL, we consider that the deprivation of the trophic factor VEGF can activate survival mechanisms as autophagy. Previously, we reported that intravitreal administration of anti-VEGF does not improve neuronal functionality and gliosis (Ridano et al., 2017). Thereby, Rapamycin benefits over anti-VEGF therapy rely on the multiplicity of events modulated through the inhibition of mTORC1. Although both treatments reduced NV and activated autophagy, neither of them prevented neurodegeneration in our experimental conditions.To unravel the role of autophagy in the OIR mouse model, we injected at P12 a single dose of Spautin-1, an inhibitor of the ubiquitin-specific peptidases USP10 and USP13, which target the Beclin-1 subunit of Vps34 complexes (Liu et al., 2011). Remarkably, vascular effects were similar to those observed with Rapamycin. Spautin-1 decreased the neovascular area without modifying other vascular parameters. In this sense, confocal images of neovessels shed light on this result demonstrating that proliferating ECs, highly metabolic cells, showed a fast autophagy flux. Thus, the inhibition of this process would lead to vascular death or a decreased proliferation rate. The interaction between ECs and pericytes is critical for the formation of a structurally sound microvasculature. In this study, we found a reduced NG-2 staining in OIR mice retinas after Spautin-1 treatment indicating an apparent decrease in pericyte density, which may exacerbate vascular alterations.In regard to non-vascular cells, glial response remained unchanged as no modifications in GS and GFAP levels were detected after Spautin-1 treatment. Electroretinographic recording showed that photoreceptors functionality tend to decrease at P17 OIR in Spautin-1 treated mice. This result reinforces the idea that retinal layers with high autophagy flux at the neovascular peak activate this pathway as a survival mechanism. In this sense, the importance of the autophagic flow became more evident in the photoreceptors because it is the layer less affected in the OIR. Correlatively, an increase in TUNEL positive staining was observed in the ONL when autophagy was inhibited. Five days after Spautin-1 injection, LC3B II and p62 protein levels returned to OIR control levels, indicating a reduced half-life of the drug in the eye.Presumably, all retinal cells are intended to activate autophagy flux in hypoxic conditions. However, the ability to respond will depend on the status of the cell as well as the intensity and duration of the stimuli (Boya et al., 2016). Prior to the hypoxic stage in the OIR model, the hyperoxic phase induces several alterations in retinal cells originated by apoptotic events at P12 (Sennlaub et al., 2002; Vecino et al., 2004; Narayanan et al., 2011). Recently, it has been demonstrated that retinas of OIR mice are characterized by increased apoptosis and decreased autophagy from P13 to P15 (Cammalleri et al., 2017). Here, using the same in vivo model, we completed the analysis including, in addition to P12 and P17, the vascular regression stage (P26). Overall, our results demonstrate that all treatments of induction or inhibition of the autophagic flux reduced neovascular area but were unable to completely reverse the neuronal damage. Besides, compared to current treatments, rapamycin provides a more promising therapeutic strategy as it reduces both neovascular tufts and persistent gliosis.
Ethics Statement
C57BL/6J mice were handled according to guidelines of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Experimental procedures were designed and approved by the Institutional Animal Care and Use Committee (CICUAL) of the Faculty of Chemical Sciences, National University of Córdoba (Res. HCD 1216/18). All efforts were made to reduce the number of animals used.
Author Contributions
PS and MS designed the experiments. PS, MP, MR, and VL conducted the experiments. PS, MP, MR, VL, and MS interpreted the data. GC and CF contributed new reagents, analytic tools, and analyzed and discussed the available data. PS and MS wrote and edited the manuscript.
Conflict of Interest Statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong Journal: Autophagy Date: 2021-02-08 Impact factor: 13.391
Authors: Noemi Anna Pesce; Alessio Canovai; Flavia Plastino; Emma Lardner; Anders Kvanta; Maurizio Cammalleri; Helder André; Massimo Dal Monte Journal: J Cell Mol Med Date: 2021-10-08 Impact factor: 5.310
Authors: Paula V Subirada; María V Vaglienti; Mariana B Joray; María C Paz; Pablo F Barcelona; María C Sánchez Journal: Front Cell Dev Biol Date: 2022-03-01