| Literature DB >> 31288377 |
Mohammed Nimir1,2, Yafeng Ma1,2, Sarah A Jeffreys1,3, Thomas Opperman1,2, Francis Young1,2, Tanzila Khan1,3, Pei Ding1,3,4, Wei Chua4, Bavanthi Balakrishnar4, Adam Cooper1,3,4, Paul De Souza1,3,4,5, Therese M Becker6,7,8.
Abstract
Detection of androgen receptor (AR) variant 7 (AR-V7) is emerging as a clinically important biomarker in castrate resistant prostate cancer (CRPC). Detection is possible from tumor tissue, which is often inaccessible in the advanced disease setting. With recent progress in detecting AR-V7 in circulating tumor cells (CTCs), circulating tumor RNA (ctRNA) and exosomes from prostate cancer patients, liquid biopsies have emerged as an alternative to tumor biopsy. Therefore, it is important to clarify whether these approaches differ in sensitivity in order to achieve the best possible biomarker characterization for the patient. In this study, blood samples from 44 prostate cancer patients were processed for CTCs and ctRNA with subsequent AR-V7 testing, while exosomal RNA was isolated from 16 samples and tested. Detection of AR and AR-V7 was performed using a highly sensitive droplet digital PCR-based assay. AR and AR-V7 RNA were detectable in CTCs, ctRNA and exosome samples. AR-V7 detection from CTCs showed higher sensitivity and has proven specificity compared to detection from ctRNA and exosomes. Considering that CTCs are almost always present in the advanced prostate cancer setting, CTC samples should be considered the liquid biopsy of choice for the detection of this clinically important biomarker.Entities:
Keywords: AR; AR-V7; CTC; ctRNA; exosome; prostate cancer
Year: 2019 PMID: 31288377 PMCID: PMC6678978 DOI: 10.3390/cells8070688
Source DB: PubMed Journal: Cells ISSN: 2073-4409 Impact factor: 6.600
Figure 1Work flow of the study. PC: prostate cancer, PBMC: peripheral blood mononuclear cells, ctRNA: circulating tumor ribonucleic acid, CTC: circulating tumor cell, cDNA: complementary deoxyribonucleic acid.
Patient Characteristics.
| Patient | |
|---|---|
| Mean age (years) | 77 (55–94) |
| Gleason score (%) | |
| ≥7 | 34 (77%) |
| <7 | 4 (9%) |
| N.A. | 6 (14%) |
| Metastatic status (%) | 41 (93%) |
| Bone metastases | 35 (79%) |
| Lymph metastases | 22 (50%) |
| Visceral metastases | 13 (29%) |
| Definitive therapy (%) | |
| Radical Prostatectomy | 12 (27%) |
| Radiotherapy | 12 (27%) |
| Both | 2 (4%) |
| None | 22 (50%) |
| Past systemic therapy (%) | |
| None | 2 (4%) |
| ADT | 42 (95%) |
| Chemotherapy | 17 (38%) |
| Novel antiandrogens | |
| Enzalutamide | 14 (31%) |
| Abiraterone | 9 (20%) |
| Both | 4 (9%) |
N.A.: data not available, ADT: androgen deprivation therapy.
GAPDH ddPCR primers and probe.
| Name | Sequence |
|---|---|
| GAPDH-fwrd | CGGGAAGCTTGTCATCAATGG |
| GAPDH-rev | CTCCACGACGTACTCAGCG |
| GAPDH-probe | FAM-5′-TCTTCCAGGAGCGAGATCCCT-3-BQ1 |
Figure 2Circulating tumor cells (CTC) counts. CTCs were isolated using the IsoFlux CTC platform and enumerated. The range of CTC counts/9 mL blood for 12 HSPC and 32 CRPC patients is depicted. There is no significant difference of CTC numbers between HSPC and CRPC patients (p value = 0.59).
Figure 3Detection of AR-FL (left) and AR-V7 (right) transcripts. Comparison of AR-FL and AR-V7 detection in CTC RNA and ctRNA from the same blood draw illustrated by mirrored scatter blot for the 44 patient samples (sorted in relation to detection in CTCs); summarized data are tabled below. *, ** indicate significance p-value ≤ 0.5 and ≤ 0.01, respectively.
AR-FL/AR-V7 status in 16 patients tested from CTC, ctRNA and exosomal samples.
| Patient | Status | AR-FL CTCs | AR-V7 CTCs | AR-FL ctRNA | AR-V7 ctRNA | AR-FL Exosomal | AR-V7 Exosomal |
|---|---|---|---|---|---|---|---|
| 1 | CRPC | − | − | − | − | + | − |
| 2 | CRPC | + | − | + | − | − | − |
| 3 | CRPC | + | − | + | − | − | − |
| 4 | CRPC | + | + | + | − | − | − |
| 5 | CRPC | − | + | + | − | + | + |
| 6 | CRPC | − | + | − | − | + | − |
| 7 | CRPC | + | + | + | − | + | + |
| 8 | CRPC | + | + | − | − | − | − |
| 9 | CRPC | + | − | + | − | − | − |
| 10 | HSPC | + | − | − | − | + | − |
| 11 | HSPC | + | − | + | − | − | − |
| 12 | HSPC | − | − | + | − | − | − |
| 13 | HSPC | − | + | + | − | − | − |
| 14 | HSPC | − | + | − | + | − | − |
| 15 | HSPC | − | − | + | − | + | − |
| 16 | HSPC | − | − | + | − | − | − |
AR-V7 positive patients by CTC analysis are highlighted in grey.
Figure 4Comparison of AR-FL and AR-V7. AR-FL and AR-V7 detection in ctRNA (44 PC patients, 5 healthy controls) and exosomal RNA samples (16 PC patients and 5 healthy controls) indicates high background of AR transcript in plasma impacting specificity of tumor-derived AR-FL and AR-V7 detection. There is no significant difference of AR-FL and AR-V7 copy numbers detected in ctRNA and exosomal RNA between patients and healthy controls (p values: AR-FL ctRNA = 0.4; AR-FL exosomal = 0.32; AR-V7 ctRNA = 0.58; AR-V7 exosomal = 0.85).