Literature DB >> 31273192

Reduced P53 levels ameliorate neuromuscular junction loss without affecting motor neuron pathology in a mouse model of spinal muscular atrophy.

Natalie L Courtney1,2, Alannah J Mole1,2, Alison K Thomson1,2, Lyndsay M Murray3,4.   

Abstract

Spinal Muscular Atrophy (SMA) is a childhood motor neuron disease caused by mutations or deletions within the SMN1 gene. At endstages of disease there is profound loss of motor neurons, loss of axons within ventral roots and defects at the neuromuscular junctions (NMJ), as evidenced by pathological features such as pre-synaptic loss and swelling and post-synaptic shrinkage. Although these motor unit defects have been widely described, the time course and interdependancy of these aspects of motor unit degeneration are unclear. Recent reports have also revealed an early upregulation of transcripts associated with the P53 signalling pathway. The relationship between the upregulation of these transcripts and pathology within the motor unit is also unclear. In this study, we exploit the prolonged disease timecourse and defined pre-symptomatic period in the Smn2B/- mouse model to perform a temporal analysis of the different elements of motor unit pathology. We demonstrate that NMJ loss occurs prior to cell body loss, and coincides with the onset of symptoms. The onset of NMJ pathology also coincides with an increase in P53-related transcripts at the cell body. Finally, using a tamoxifen inducible P53 knockout, we demonstrate that post-natal reduction in P53 levels can reduce NMJ loss, but does not affect other aspects of NMJ pathology, motor neuron loss or the phenotype of the Smn2B/- mouse model. Together this work provides a detailed temporal description of pathology within motor units of an SMA mouse model, and demonstrates that NMJ loss is a P53-dependant process. This work supports the role for P53 as an effector of synaptic and axonal degeneration in a die-back neuropathy.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31273192      PMCID: PMC6609617          DOI: 10.1038/s41419-019-1727-6

Source DB:  PubMed          Journal:  Cell Death Dis            Impact factor:   8.469


Introduction

Spinal Muscular Atrophy (SMA) is a childhood form of motor neuron disease that is caused by homozygous loss of the SMN1 gene[1,2]. The most common form of this disease has an onset of less than 6 months of age and a life expectancy of under 2 years without significant respiratory support. The classic morphological features of motor unit pathology in SMA have been extensively characterised and widely used to assess outcome in pre-clinical testing[3]. They include a loss and cytoplasmic shrinkage of motor neuron cell bodies, loss of axons in the ventral roots and pathology at the neuromuscular junctions (NMJ), including denervation, pre-synaptic accumulation of neurofilaments, endplate abnormalities, and muscle fibre atrophy[4,5]. Such defects have been consistently observed in both patients and animal models of SMA at symptomatic stages of disease. How these pathologies throughout the motor unit are temporally related to each other, and to the onset of symptoms, is currently less clear. It is thought that motor neurons degenerate in a ‘die-back’ manner, as the pre-synaptic terminal appears to withdraw from the post-synaptic endplate, leaving partially occupied endplates[6]. Furthermore, ventral root axon loss appears to be more severe than motor neuron cell body loss, which is indicative of distal to proximal degeneration of the motor neuron[7]. NMJ defects occur prior to symptom onset in mouse models of SMA suggesting that the NMJ is an ‘early pathological target’ in SMA[6,8]. However, the temporal and causative relationship of NMJ degeneration to the loss of motor neuron cell bodies is unknown. It may be suggested that the observed defects at the NMJ in SMA mosue models are reflective of a requirement for Smn in the axon or synapse. However it is currently unclear whether synaptic pathology is a cause or effect of motor neuron death, and it remains possible that synaptic and axonal pathology observed are morphlogical evidence of cell death, as the motor neuron retracts its most distal processes. This idea is supported by the osbervation that there is an increase in transcripts associated with the P53 signalling pathway in motor neuron cell bodies at pre-symptomatic time points in SMA mouse models[8]. As this upregulation is more prominent in selectively vulnerable motor neurons, P53 may play a role in the breakdown of the motor unit[8,9]. P53 plays a crucial role in co-ordinating the cellular response to stress. Initially characterised as a transcription factor, more recent work indicates it can also act as a translational regulator and interact with regulatory RNAs[10-12]. P53 is activated in response to a variety of cues including cell stress and DNA damage, and directs cellular responses, including senescence, DNA repair and apoptosis[13]. Although best characterised as a tumour suppressor, P53 has also been strongly implicated in a range of neurodegenerative disorders, including the adult onset motor neuron disease amyotrophic lateral sclerosis (ALS)[14-19]. An increase in P53 has been reported in postmortem patient spinal cord[20] and an increase in transcripts associated with the P53 signalling pathway have been widely reported in motor neurons and spinal cord tissue from SMA model mice[8,21-24]. The cause and consequence of P53 upregulation in SMA motor neurons is currently unclear. Given its well-established involvement in pro-apoptotic pathways, it is tempting to speculate that this upregulation is reflective of the onset of cell death pathways at the motor neuron. However, a direct interaction between Smn and P53 has also been observed, which was suggestive of an anti-apoptotic role for Smn[25]. The increase in the P53 signalling pathway may therefore be reflective of a primary defect caused by reduced Smn levels. However, since P53 activity appears restricted to selectively vulnerable motor neurons, it is also possible that P53 acts downstream of Smn, in mediating the breakdown of selectively vulnerable motor neuron pools. P53 has also been shown to localise to the synapse where it plays a role in mitochondrial dysfunction and oxidative stress following DNA damage[26]. P53 has also been shown to regulate a range of synaptic genes and that synaptic activity can regulate P53 levels[27,28]. It is therefore unclear what, if any, role P53 has in the onset and progression of motor unit pathology in SMA. Here, we use the Smnmouse model of SMA to demonstrate that the onset of NMJ degeneration precedes motor neuron cell body loss, thus confirming that motor neurons degenerate in a distal to proximal manner. We demonstrate that the first evidence of pre-synaptic swelling at the NMJ coincides with an increase in P53 associated transcripts in the spinal cord. In order to investigate the causal effects of P53 pathway activation, we have crossed the Smnmouse model with a mouse carrying a tamoxifen inducible P53 knockout. Postnatal knockout of P53 led to a reduction in NMJ loss, with no benefit observed upon any other features of NMJ pathology, motor neuron loss or mouse phenotype. In summary, we show that NMJ loss is a consequence of P53 pathway activation, and that partially preserving the structure of the NMJ confers no benefit to the overall health of the motor neuron or mouse. P53 therefore appears to play a role in the breakdown and degeneration of synaptic connections, but does not appear to be central to the motor unit pathology caused by depleted Smn levels.

Results

NMJ pathology precedes motor neuron cell body loss in the Smn− mouse model

To investigate the correlation between NMJ and cell body pathology, we have performed a detailed temporal analysis of the NMJ and motor neuron cell body throughout disease in the Smnmouse model of SMA[29]. The aim of this work was to give insight into the causal relationship between pathology in these distinct parts of the motor neuron. In our hands, the Smnmouse model displays a significant reduction in body weight from around P10, and motor deficits (as evidenced by an increase in the time taken to self right) which are evident at around P9 (Supplementary Fig. 1). It has a life expectancy of around 20 days. NMJ pathology was assessed in the transversus abdominis muscle (TVA), a muscle which has demonstrated significant defects across all mouse models of SMA which have been studied to date[6,29,30]. Consistent with previous reports[29], analysis of the TVA muscle at P15 revealed significant pre-synaptic pathology, as evidenced by a decrease in the percentage of fully occupied endplates and significant increase the percentage of NMJs displaying mild, moderate or severe swelling (Fig. 1a–c). A timecourse analysis of these markers of pre-synaptic pathology revealed that the earliest time point at which they could be detected was at P10. This was the first time point at which denervation could be detected, as evidenced by a small but significant increase in the percentage of partially occupied endplates. There was also a significant increase in the percentage of NMJs with mild or moderate pre-synaptic swelling. There was a trend towards a decrease in endplate size at P10, which was statistically significant by P15 (Fig. 1a–d). Overall, this data suggests that the onset of NMJ pathology occurs after P5 but is present by P10.
Fig. 1

The onset of NMJ pathology is between P5 and P10 in the Smn mouse model of SMA.

a Representative confocal images showing maximum intensity projection of confocal z-stack of NMJs in the TVA of Smn and Smn mice at P1, P5, P10 and P15. Note that white arrowheads show no pre-synaptic swelling, yellow arrowheads show mild pre-synaptic swelling while blue arrowheads show moderate pre-synaptic swelling. Vacant endplates (red arrowhead) are seen at P15 in the Smn mouse model of SMA. The grayscale images show, from top to bottom, BTX and NF/SV2. Scale bar = 20 μm. b Bar chart (mean ± SEM) compares the percentage of full, partial and vacant endplates in Smn mice compared to Smn controls. At P1 and P5, 100% of endplates in Smn and Smn mice were fully occupied by the pre-synaptic terminal. At P10, there is significant increase in the percentage of partially occupied endplates and at P15, there is a significant increase in the percentage of both vacant and partially occupied endplates in Smn compared to Smn mice (by Mann–Whitney-U test, *p < 0.05, **p < 0.01; n = 4 mice per genotype). c Bar chart (mean ± SEM) compares the stages of pre-synaptic swelling in Smn and Smn mice. There is no significant difference in the level of swelling in Smn mice compared to controls at P1 and P5. At P10, there is a significant increase in the percentage of NMJs with stage 2 and stage 3 swelling in Smn mice. At P15, there is a significant increase in the percentage of pre-synaptic terminals with stage 2, 3 and 4 swelling in Smn mice compared to Smn controls (by Mann–Whitney-U test, *p < 0.05; n = 4 mice per genotype). d The graph (mean ± SEM) compares the average size of endplates in the TVA of Smn mice compared to controls. At P1 and P10 there is no significant difference in the area of post synaptic endplates in Smn mice compared to Smn controls. At P5, there is a small but significant increase in endplate area in Smn mice. At P15 there is a significant decrease in the size of endplates in Smn mice compared to controls (unpaired t-test, *p < 0.05, **p < 0.01; n = 4 mice per genotype)

The onset of NMJ pathology is between P5 and P10 in the Smn mouse model of SMA.

a Representative confocal images showing maximum intensity projection of confocal z-stack of NMJs in the TVA of Smn and Smn mice at P1, P5, P10 and P15. Note that white arrowheads show no pre-synaptic swelling, yellow arrowheads show mild pre-synaptic swelling while blue arrowheads show moderate pre-synaptic swelling. Vacant endplates (red arrowhead) are seen at P15 in the Smn mouse model of SMA. The grayscale images show, from top to bottom, BTX and NF/SV2. Scale bar = 20 μm. b Bar chart (mean ± SEM) compares the percentage of full, partial and vacant endplates in Smn mice compared to Smn controls. At P1 and P5, 100% of endplates in Smn and Smn mice were fully occupied by the pre-synaptic terminal. At P10, there is significant increase in the percentage of partially occupied endplates and at P15, there is a significant increase in the percentage of both vacant and partially occupied endplates in Smn compared to Smn mice (by Mann–Whitney-U test, *p < 0.05, **p < 0.01; n = 4 mice per genotype). c Bar chart (mean ± SEM) compares the stages of pre-synaptic swelling in Smn and Smn mice. There is no significant difference in the level of swelling in Smn mice compared to controls at P1 and P5. At P10, there is a significant increase in the percentage of NMJs with stage 2 and stage 3 swelling in Smn mice. At P15, there is a significant increase in the percentage of pre-synaptic terminals with stage 2, 3 and 4 swelling in Smn mice compared to Smn controls (by Mann–Whitney-U test, *p < 0.05; n = 4 mice per genotype). d The graph (mean ± SEM) compares the average size of endplates in the TVA of Smn mice compared to controls. At P1 and P10 there is no significant difference in the area of post synaptic endplates in Smn mice compared to Smn controls. At P5, there is a small but significant increase in endplate area in Smn mice. At P15 there is a significant decrease in the size of endplates in Smn mice compared to controls (unpaired t-test, *p < 0.05, **p < 0.01; n = 4 mice per genotype) As hindlimb weakness is a prominent feature of this mouse model, we also analysed the tibialis anterior muscle. At P10, there was no evidence of denervation (Supplementary Fig. 2). This confirms that, although there is evidence of NMJ swelling in the P10, it is not more affected than the TVA muscle. To investigate how pre-synaptic pathology is associated with a loss of motor neuron cell bodies, we quantified the number of motor neurons in the thoracic spinal cord. The first decrease in motor neuron cell body number could be detected at P15, where a 48.4% decrease in motor neuron number was observed (Fig. 2b). Prior to this time point, there was no decrease in the number of motor neurons and indeed, an intriguing trend towards an increase in the number of motor neurons at P5, in the Smn model compared to controls. There was also a significant decrease in motor neuron cell body area at P15, with no observable difference at P10 or younger (Fig. 2c).
Fig. 2

Alterations in MNCB number and size occur between P10 and P15 in the Smn mouse model of SMA.

a Representative images showing MNCBs from Smn and Smn control mice at P1, P5, P10 and P15. Note the comparable size difference between Smn and Smn mice at P15. The grayscale images shown below each coloured image are the separate channels and show, from left to right, ChAT, Nissl and DAPI staining. Scale bar = 20 µm. b The graph shows the absolute number of MNCBs counted in the ventral horn of the thoracic spinal cord of Smn and control mice. At P1, P5 and P10 there is no significant difference between Smn and Smn pairs. At P15 there is a significant decrease in the number of MNCBs in Smn mice compared to Smn controls (by unpaired student's t-test, *p < 0.05, n = 3 mice per genotype, per time point). c The graph (mean ± SEM) shows that at P1, P5 and P10 there is no significant difference in the average area of MNCBs in the ventral horn of the spinal cord of Smn and Smn mice. However, there is a significant decrease in the average area of MNCBs in Smn mice compared to Smn mice at P15 (by Unpaired t-test, ns > 0.05, *p < 0.05, n = 4 mice per genotype)

Alterations in MNCB number and size occur between P10 and P15 in the Smn mouse model of SMA.

a Representative images showing MNCBs from Smn and Smn control mice at P1, P5, P10 and P15. Note the comparable size difference between Smn and Smn mice at P15. The grayscale images shown below each coloured image are the separate channels and show, from left to right, ChAT, Nissl and DAPI staining. Scale bar = 20 µm. b The graph shows the absolute number of MNCBs counted in the ventral horn of the thoracic spinal cord of Smn and control mice. At P1, P5 and P10 there is no significant difference between Smn and Smn pairs. At P15 there is a significant decrease in the number of MNCBs in Smn mice compared to Smn controls (by unpaired student's t-test, *p < 0.05, n = 3 mice per genotype, per time point). c The graph (mean ± SEM) shows that at P1, P5 and P10 there is no significant difference in the average area of MNCBs in the ventral horn of the spinal cord of Smn and Smn mice. However, there is a significant decrease in the average area of MNCBs in Smn mice compared to Smn mice at P15 (by Unpaired t-test, ns > 0.05, *p < 0.05, n = 4 mice per genotype) Together with the data above, this demonstrates that NMJ pathology, which was first observed at P10, precedes motor neuron cell body shrinkage and loss, which was first observed at P15. This would suggest that motor neuron pathology does indeed progress in a distal to proximal manner, with NMJ loss preceding motor neuron cell body loss.

NMJ pathology coincides with an increase in P53 related transcripts at the cell body

The data above indicate that NMJ pathology starts between P5 and P10. Previous work has shown that in this mouse model, at P10 there is an increase in transcripts associated with the P53 signalling pathway, including Fas, Pmaip and Cdkn1a[8]. Given the known links between the P53 signalling pathway and the onset of apoptosis, we have previously hypothesised that the increase in these transcripts was associated with the onset of motor neuron cell death. As we have now also observed that NMJ pathology first appears around the same time, it is possible that NMJ pathology is a consequence of P53 pathway activation at the cell body. We were therefore keen to explore the temporal relationship between an increase in transcripts associated with the P53 signalling pathway, and the onset of NMJ pathology. We first aimed to further narrow down the time point at which NMJ pathology could be first seen. We therefore analysed NMJs in the TVA muscle from P7 mice (Fig. 3a–c). This revealed no evidence of denervation, but a significant increase in NMJs with mild pre-synaptic swelling. From this, we conclude denervation starts between P7 and P10 and is preceded by pre-synaptic swelling, which starts between P5 and P7.
Fig. 3

Activation of the P53 signalling pathway coincides with the onset of NMJ pathology.

a Representative images of NMJs in the TVA of P7 Smn and Smn mice. White arrowheads show stage 1 swelling and yellow arrowheads show stage 2 pre-synaptic swelling. Scale bar = 20 µm. b Bar chart (mean ± SEM) shows that at P7, 100% of endplates in the TVA of Smn and Smn mice were fully occupied by the pre-synaptic terminal of an axon. (Mann–Whitney-U test, ns > 0.05; n = 4 mice per genotype). c Bar chart (mean ± SEM) compares the stages of pre-synaptic swelling in Smn mice compared to Smn controls. There is a significant decrease in the percentage of pre-synaptic terminals with stage 1 swelling and increase in stage 2 swelling in the TVA of Smn mice compared to Smn controls at P7. (Mann Whitney-U test, **p < 0.01; n = 4 mice per genotype). d The bar chart (mean ± SEM) shows that there is no significant difference in the expression of transcripts involved in the P53 signalling pathway in the thoracic spinal cord of Smn mice compared to Smn mice at P5 (by Mann–Whitney-U test; ns > 0.05; n = 4 per genotype). e The bar chart (mean ± SEM) shows that there is a significant increase in the expression of transcripts involved in the P53 signalling pathway, specifically in Cdkn1A and Pmaip1, in the thoracic spinal cord of Smn mice compared to Smn mice at P7 (by Mann–Whitney-U test; ns > 0.05; n = 4 per genotype)

Activation of the P53 signalling pathway coincides with the onset of NMJ pathology.

a Representative images of NMJs in the TVA of P7 Smn and Smn mice. White arrowheads show stage 1 swelling and yellow arrowheads show stage 2 pre-synaptic swelling. Scale bar = 20 µm. b Bar chart (mean ± SEM) shows that at P7, 100% of endplates in the TVA of Smn and Smn mice were fully occupied by the pre-synaptic terminal of an axon. (Mann–Whitney-U test, ns > 0.05; n = 4 mice per genotype). c Bar chart (mean ± SEM) compares the stages of pre-synaptic swelling in Smn mice compared to Smn controls. There is a significant decrease in the percentage of pre-synaptic terminals with stage 1 swelling and increase in stage 2 swelling in the TVA of Smn mice compared to Smn controls at P7. (Mann Whitney-U test, **p < 0.01; n = 4 mice per genotype). d The bar chart (mean ± SEM) shows that there is no significant difference in the expression of transcripts involved in the P53 signalling pathway in the thoracic spinal cord of Smn mice compared to Smn mice at P5 (by Mann–Whitney-U test; ns > 0.05; n = 4 per genotype). e The bar chart (mean ± SEM) shows that there is a significant increase in the expression of transcripts involved in the P53 signalling pathway, specifically in Cdkn1A and Pmaip1, in the thoracic spinal cord of Smn mice compared to Smn mice at P7 (by Mann–Whitney-U test; ns > 0.05; n = 4 per genotype) Previous work has shown the transcripts Fas, Pmaip and Cdkn1a are significantly increased at P10 in this mouse model[8]. We therefore analysed spinal cords at P5 and P7. This revealed no increase in transcripts at P5, but a significant increase in Fas and Pmaip at P7 (Fig. 3d, e). Together this data shows a remarkable temporal correlation between the onset of NMJ swelling and the increase in transcripts associated with the P53 signalling pathway.

Inhibition of the P53 signalling pathway reduces NMJ loss without affecting phenotype of the Smn mouse model

Thus far we show that NMJ pathology precedes cell body loss, but coincides with the increase in transcripts associated with the P53 signalling pathway. To investigate the relationship between P53 pathway activation and NMJ pathology, we aimed to inhibit the P53 signalling pathway by generating an inducible P53 knockout mouse on an SMA model background. We generated this model by introducing a P53 gene flanked by loxP sites (P53fl/fl) as well as cre-recombinase under the control of the oestrogen receptor promoter (CAG-Cre) onto the Smn background. The resultant Smn; P53; CAG-Cre mice are equivalent to the original Smn mouse model, however upon the administration of tamoxifen, the Cre-recombinase causes the recombination of the P53 gene to render it non-functional. For these experiments we have four genotypes of mice: Smn control mice who have the P53 gene but do not carry CAG-Cre (Smn; P53); Smn mice who have the P53 gene but do not carry CAG-Cre (Smn; P53+/+); Smncontrol mice who have the P53 gene and CAG-Cre (Smn2B/+; P53−/−); and Smn mice who have the P53 gene and CAG-Cre (Smn; P53−/−) (Fig. 4a). Upon administration of tamoxifen, the P53 gene in only the latter two groups of mice will undergo recombination and essentially be ‘knocked out’. Tamoxifen (75 mg/kg) was administered at P4 and P5. This time point was selected as it was prior to any evidence of P53 pathway activation in the spinal cord. Quantitative PCR results on cDNA from spinal cord from P15 mice revealed P53 levels were reduced by around 50% in both Smn; P53 and Smn; P53 mice compared to their respective controls (Fig. 4b).
Fig. 4

Reduction in P53 levels does not ameliorate the phenotype of the Smn2B/− mouse model.

a Representative images of mice with the various genotypes within experimental litters at P15. Scale bar = 1 cm. b Bar chart (mean ± SEM) shows that there is a significant decrease in P53 at the transcript level in the spinal cord of Smn; P53 mice compared to Smn; P53 mice and in Smn; P53 mice compared to Smn; P53 mice (by Mann–Whitney-U test, *p < 0.05, **p < 0.001; n = 3 for Smn; P53, n = 4 for all other genotypes). c The graph (mean ± SEM) shows body weight in Smn; P53 and Smn; P53 on the left and Smn; P53 and Smn; P53 on the right. There is a significant reduction of weight in mice that are P53 in both Smn and Smn groups, compared to P53 mice. Two-way ANOVA with multiple comparison *P < 0.05; *P < 0.001 (d, e) Graphs (mean ± SEM, with individual data points showing mean of three trials for individual animals) shows performance in the time to right test (d) and the time to turn around test (e) for Smn; P53, Smn; P53, Smn; P53 and Smn; P53 at P8 and P10 (d) and between P12 and P15 (e). In both tests, at all-time points, there is no significant difference in motor performance between Smn; P53 and Smn; P53 mice. At P13, 14 and 15, Smn; P53 displayed a significantly longer time to turn around than Smn; P53 controls. (Kruskal Wallis with Dunn’s multiple comparison test; ns > 0.05, *p < 0.05, **p < 0.01, n = 5 for Smn; P53 and Smn; P53; n = 4 for Smn; P53; n = 3 for Smn; P53 for all time points except P15 where n = 4 for Smn; P53 and Smn; P53; n = 6 for Smn; P53 and n = 5 for Smn; P53

Reduction in P53 levels does not ameliorate the phenotype of the Smn2B/− mouse model.

a Representative images of mice with the various genotypes within experimental litters at P15. Scale bar = 1 cm. b Bar chart (mean ± SEM) shows that there is a significant decrease in P53 at the transcript level in the spinal cord of Smn; P53 mice compared to Smn; P53 mice and in Smn; P53 mice compared to Smn; P53 mice (by Mann–Whitney-U test, *p < 0.05, **p < 0.001; n = 3 for Smn; P53, n = 4 for all other genotypes). c The graph (mean ± SEM) shows body weight in Smn; P53 and Smn; P53 on the left and Smn; P53 and Smn; P53 on the right. There is a significant reduction of weight in mice that are P53 in both Smn and Smn groups, compared to P53 mice. Two-way ANOVA with multiple comparison *P < 0.05; *P < 0.001 (d, e) Graphs (mean ± SEM, with individual data points showing mean of three trials for individual animals) shows performance in the time to right test (d) and the time to turn around test (e) for Smn; P53, Smn; P53, Smn; P53 and Smn; P53 at P8 and P10 (d) and between P12 and P15 (e). In both tests, at all-time points, there is no significant difference in motor performance between Smn; P53 and Smn; P53 mice. At P13, 14 and 15, Smn; P53 displayed a significantly longer time to turn around than Smn; P53 controls. (Kruskal Wallis with Dunn’s multiple comparison test; ns > 0.05, *p < 0.05, **p < 0.01, n = 5 for Smn; P53 and Smn; P53; n = 4 for Smn; P53; n = 3 for Smn; P53 for all time points except P15 where n = 4 for Smn; P53 and Smn; P53; n = 6 for Smn; P53 and n = 5 for Smn; P53 To determine the effect of P53 knockout on the phenotype of the Smn mouse, weight and motor performance were assessed daily following administration of tamoxifen at P4 and P5. Knockout of P53 did not improve the phenotype of Smn mice (Fig. 4c–e). Indeed, both groups with reduced P53 levels displayed a small but significant decrease in body weight. There was a trend towards poorer performance in the time to right test for both Smn groups at P8, but there was no significant difference between Smn; P53 and Smn; P53 at either P8 or P10. Furthermore, in the ‘turn around’ test, although Smn;P53 mice performed significantly worse at P13, 14 and 15 compared to Smn; P53 controls, there was no significant difference between Smn; P53 and Smn; P53 mice. This data demonstrate that reduction of P53 confers no benefit to the motor performance of Smn mice, and if anything, makes it worse. We next assessed the impact of reduced P53 levels on motor neuron cell body loss. Reduced P53 levels did not affect motor neuron cell body loss or shrinkage. Quantification of the number of motor neurons in the T4–T8 segments of the spinal cord at P15 revealed a loss of 55.2 ± 9.6% and 52.0 ± 1.7% in Smn; P53 and Smn; P53 compared to their respective controls (Fig. 5b). There was no significant difference between Smn; P53and Smn; P53 mice. There was a trend for motor neurons from Smn; P53 and Smn; P53 mice to be smaller compared to their respective controls but again there was no significant difference between Smn; P53 and Smn; P53 mice (Fig. 5c). Overall, in the Smn mouse model, reduced P53 levels do not appear to reduce motor neuron cell body loss or shrinkage.
Fig. 5

Reducing P53 levels in Smn mice does not alter the number or size of MNCBs in the ventral horn of the spinal cord at P15.

a Representative images showing MNCBs in the ventral horn of the spinal cord at P15of Smn; P53 and Smn; P53 mice and Smn; P53 and Smn; P53 mice. White arrowheads point out MNCBs. The grayscale images shown below each coloured image are the sperate channels and show, from left to right, ChAT, Nissl and DAPI staining. Scale bar = 40 μm. b The graph (mean ± SEM) shows that when P53 is reduced there is no significant difference in the number of MNCBs in the ventral horn of both Smn and Smn spinal cords at P15. There is a significant difference in the loss of MNCBs in Smn mice compared to Smn mice (by one-way ANOVA; ns > 0.05, ****p < 0.001; n = 3 mice per genotype). c The graph (mean ± SEM) shows that when P53 is reduced there is no significant difference in the area of MNCBs in the ventral horn of both Smn and Smn spinal cords (by one-way ANOVA; ns > 0.05; n = 3 mice per genotype)

Reducing P53 levels in Smn mice does not alter the number or size of MNCBs in the ventral horn of the spinal cord at P15.

a Representative images showing MNCBs in the ventral horn of the spinal cord at P15of Smn; P53 and Smn; P53 mice and Smn; P53 and Smn; P53 mice. White arrowheads point out MNCBs. The grayscale images shown below each coloured image are the sperate channels and show, from left to right, ChAT, Nissl and DAPI staining. Scale bar = 40 μm. b The graph (mean ± SEM) shows that when P53 is reduced there is no significant difference in the number of MNCBs in the ventral horn of both Smn and Smn spinal cords at P15. There is a significant difference in the loss of MNCBs in Smn mice compared to Smn mice (by one-way ANOVA; ns > 0.05, ****p < 0.001; n = 3 mice per genotype). c The graph (mean ± SEM) shows that when P53 is reduced there is no significant difference in the area of MNCBs in the ventral horn of both Smn and Smn spinal cords (by one-way ANOVA; ns > 0.05; n = 3 mice per genotype) Finally, we assessed the effect of reduced P53 levels of NMJ pathology. This revealed that reduced P53 levels decreased NMJ loss (Fig. 6). Quantification of the percentage of fully occupied endplates at P15 in Smn; P53 mice revealed a significant increase (Fig. 6b). This was accompanied by a significant decrease in the percentage of vacant endplates (Fig. 6c). Interestingly, examination of pre-synaptic swelling, endplate maturation and endplate area revealed no improvement in Smn; P53 compared to Smn; P53 (Fig. 6d–f). Together this data suggest that NMJ loss is a consequence of P53 pathway activation, and dissociates NMJ loss from other markers of pathology at the NMJ, which are P53 independent.
Fig. 6

Reduction in P53 reduces NMJ loss but does not affect other morphological signs of degeneration.

a Representative images showing NMJs from the TVA of Smn; P53 and Smn; P53 mice. Note that the white arrowheads point out vacant endplates. Scale bar = 40 μm. b The graph (mean ± SEM) shows that a reduction in P53 decreases denervation in the TVA muscle, with Smn; P53 mice showing a significant increase in the percentage of fully occupied endplates compared to Smn; P53 mice (by Mann–Whitney-U test; **p < 0.01; n = 6 muscles per genotype). c In addition, this graph (mean ± SEM) shows a significant decrease in the percentage of vacant endplates in Smn; P53 mice compared to Smn; P53 mice (by Mann–Whitney-U test; *p < 0.05; n = 6 muscles per genotype). d The graph (mean ± SEM) shows that there is no significant difference in the level of pre-synaptic swelling in the TVA of Smn; P53 and Smn; P53 mice (by Mann–Whitney-U test; ns > 0.05; n = 6 muscles per genotype). e The graph (mean ± SEM) shows that there is no significant difference in the maturity of endplates in the TVA of Smn; P53 and Smn; P53 mice (by Mann–Whitney-U test; ns > 0.05; n = 6 muscles per genotype). f The graph (mean ± SEM) shows that there is a small but significant decrease in the area of endplates in the TVA of Smn; P53 and Smn; P53 mice (by Unpaired T-test; *p < 0.05; n = 6 muscles per genotype)

Reduction in P53 reduces NMJ loss but does not affect other morphological signs of degeneration.

a Representative images showing NMJs from the TVA of Smn; P53 and Smn; P53 mice. Note that the white arrowheads point out vacant endplates. Scale bar = 40 μm. b The graph (mean ± SEM) shows that a reduction in P53 decreases denervation in the TVA muscle, with Smn; P53 mice showing a significant increase in the percentage of fully occupied endplates compared to Smn; P53 mice (by Mann–Whitney-U test; **p < 0.01; n = 6 muscles per genotype). c In addition, this graph (mean ± SEM) shows a significant decrease in the percentage of vacant endplates in Smn; P53 mice compared to Smn; P53 mice (by Mann–Whitney-U test; *p < 0.05; n = 6 muscles per genotype). d The graph (mean ± SEM) shows that there is no significant difference in the level of pre-synaptic swelling in the TVA of Smn; P53 and Smn; P53 mice (by Mann–Whitney-U test; ns > 0.05; n = 6 muscles per genotype). e The graph (mean ± SEM) shows that there is no significant difference in the maturity of endplates in the TVA of Smn; P53 and Smn; P53 mice (by Mann–Whitney-U test; ns > 0.05; n = 6 muscles per genotype). f The graph (mean ± SEM) shows that there is a small but significant decrease in the area of endplates in the TVA of Smn; P53 and Smn; P53 mice (by Unpaired T-test; *p < 0.05; n = 6 muscles per genotype)

Discussion

Here we have shown that pathology at the NMJ precedes loss or shrinkage of motor neurons at the level of the cell body. A loss of NMJs was first observed at P10, whereas motor neuron loss was not observed until P15. This first evidence of NMJ swelling appears to coincide with an increase in transcripts associated with the P53 signalling pathway in the spinal cord. Importantly, post-natal ‘knockout’ of P53 led to a reduction in NMJ loss, without affecting other aspects of NMJ pathology, motor neuron loss or affecting the phenotype of the mouse. Together the work provides a detailed temporal description of pathology within the motor units of an SMA mouse model, and demonstrates that NMJ loss is a P53-dependent process. This work supports the role for P53 as an effector of synaptic and axonal degeneration in a die-back neuropathy.

Temporal and mechanistic dissociation of motor unit pathology in SMA

The protracted lifespan of the Smn mouse, compared to the majority of other commonly used mouse models, has allowed us to examine the evolution of different aspects of motor unit pathology, and revealed a temporal dissociation between them. Motor neuron loss and shrinkage is one of the last detectable morphological abnormalities and evident only after symptom onset. Swelling of the pre-synaptic terminal preceded NMJ loss and post-synaptic changes, and also preceded the emergence of symptoms. This is in agreement with studies on the SOD1G93A mouse model of adult onset motor neuron disease in which pre-synaptic defects were shown to coincide with symptom onset, and motor neuron cell body loss was observed as a late event[31]. Swelling appeared to coincide with the earliest time point that increased levels of Fas, and Pmaip can be detected. Given the known links of these transcripts with the P53 signalling pathway, this suggests that there is a correlation between the onset of NMJ abnormalities and P53 pathway activation. Together this data suggest that, with regards to motor unit pathology, the first detectable abnormality is swelling of NMJs, which coincides with transcriptional changes at the cell body. This is then followed by denervation, then by post-synaptic shrinkage and loss and shrinkage of the motor neuron cell body. The reduction in P53 levels allows us to more carefully dissect the interdependency of these early events. Reduced P53 levels had no effect on swelling, but did reduce denervation. This shows that pre-synaptic swelling is a P53-independent event, whilst denervation is a P53-dependant event. Thereby, whilst the pathology present at the NMJ is not dependent upon the P53 pathway, the actual process of pre-synaptic withdrawal is.

A role for P53 in mediating synaptic and axonal degeneration

The data presented here demonstrate that knockout of P53 can reduce NMJ loss, and therefore suggest that axon and synaptic degeneration in SMA is a P53-dependant process. P53 has been identified in synaptosomes of cortical neurons[26]. Synaptosomes from P53 knockout mice displayed reduced levels of reactive oxygen species and preserved mitochondrial membrane potential following exposure to the topoisomerase-II inhibitor etoposide[26]. Furthermore, mitochondria in isolated synaptosomes from P53 knockout mice showed greater resistance to excitotoxic or oxidative insults, and inhibition of P53 decreased synapse loss in hippocampal neuron cultures following treatment with etoposide. This clearly shows that P53 can have a local role in mediating synapse loss and mitochondrial dysfunction. An increase in P53 phosphorylation has also been observed following trophic withdrawal, a stimulus known to result in axon pruning[32]. How then, might P53 mediate the removal of axonal and synaptic compartments of the cell? A significant body of work has implicated pro-apoptotic proteins and pathways in the process of axon degeneration[33]. Interestingly, this includes developmental axon pruning, which demonstrates that the activation of apoptotic cascades can be compartment specific and that mediating removal of axonal and synaptic parts of the neuron allow the motor neuron to persist. Indeed, it has been suggested that as P53 has the ability to regulate both pro- and anti-apoptotic transcripts, it can serve as a key regulator for compartmental degeneration in neurons[32,34]. Further work is clearly required to identify the molecular effectors of P53-dependant synaptic degeneration in SMA, and determine whether P53 is an important mediator of axonal and synaptic degeneration in other neurodegenerative contexts.

P53 independent motor neuron loss in SMA

An upregulation of transcripts associated with the P53 signalling pathway has been consistently observed in response to reduced Smn levels[8,21-24]. Due to the well-established links between P53 and caspase mediated apoptosis, this has led to the suggestion that motor neurons in SMA are dying by a P53 mediated form of apoptosis. In this canonical pathway, an increase in cell stress, brought about by a variety of triggers, causes the phosphorylation and activation of P53, which in turn act as a transcription factor for a number of pro-apoptotic transcripts including Bax, Bak and Pmaip. These factors cause an increase in the permeability of the mitochondrial membrane, resulting in a release of pro-apoptotic factors, leading to the activation of effector caspases. This includes caspase 3, which mediates the cleavage of cellular components and is essential for the chromatin condensation and DNA fragmentation, all of which are morphological hallmarks of apoptosis. The data presented here demonstrate that inhibition of P53 does not reduce motor neuron loss, suggesting that motor neuron loss in this mouse model is P53 independent. Although this is in contrast to recent reports showing P53 inhibition could reduce motor neuron loss in the Smn; SMN2; SMNΔ7 mouse model of SMA, this finding is in agreement with previous work showing knockout of P53 has no beneficial effect on a mouse model of SMA[9,35]. There are also interesting parallels to work on the SODG93A mouse model of ALS, showing knockout of P53 has no effect upon motor neuron loss[36], despite the observation that P53 levels are elevated in postmortem tissue, cellular models and mouse models of ALS[16,17,19,37-40]. Whilst this could be due to a degree of redundancy between P53 and related pathways, it does demonstrate that motor neurons in SMA can die by a P53 independent mechanism. Studies detailing apoptotic motor neurons in SMA are notably lacking. Although some have reported features consistent with apoptosis in postmortem and cellular and animal models, work using immunohistochemical approaches to label apoptotic revealed no difference between SMA and control patients in either fetal or newborn individuals with SMA[20,35,41,42]. However, knockout of the pro-apoptotic protein Bax in a mouse model of SMA did reduce motor neuron loss[43]. More work is required to define whether motor neurons in SMA are degenerating via a caspase dependant apoptosis, and investigate P53 independent up-stream regulators of this process. Identifying this mechanism will be of fundamental importance if we are to gain a thorough understanding of motor unit pathogenesis in SMA.

Materials and methods

Mouse maintenance

Smn (originating from the Kothary Laboratory, Ottawa Hospital Research Institute) mice were crossed with Smn (Strain: 10921, Jackson Laboratories) to produce Smn experimental mice and Smn controls. Smn mice were crossed with mice carrying the P53 and CAG-Cre alleles (generously donated by Dr Luke Boulter, Kevin Myant and You-Ying Chou, University of Edinburgh) to obtain Smn; P53; CAG-Cre mice. Smn mice were interbred with mice carrying the P53 allele to obtain Smn; P53 mice. Smn; P53; CAG-Cre and Smn; P53 mice were interbred to produce Smn; P53; CAG-Cre, Smn; P53, Smn; P53; CAG-Cre and Smn; P53 mice. All genotyping was performed using standard PCR protocols. Homozygosity for the P53fl allele was confirmed using q-PCR. All mice were maintained at the University of Edinburgh animal facilities on a C57Bl6 background. Mice aged over P10 were sacrificed by overdose of inhalation anaesthetic or a rising CO2 and death was confirmed by exsanguination from the carotid artery. Mice under P10 were decapitated under terminal anaesthesia and death was confirmed by exsanguination from the carotid artery. Endstage of disease was defined by over 10% loss of weight over a period of 48 h. Since no phenotypic differences have been noted between male and female mice, experiments were not controlled for gender. All experiments were performed in accordance with the UK Home Office.

Tamoxifen

Tamoxifen (Sigma-Aldrich) was dissolved in corn oil to a concentration of 20 mg/ml. Tamoxifen solution was administered to litters of mice at P4 and P5 using oral gavage at a dose of 75 mg/kg.

Phenotypic analysis

The ‘time to right’ test was carried out on mice at P8 and P10. Mice were placed on their back and the time it took for them to right themselves (turn to be on all four paws) was noted, with a maximum of 30 sec and an average of three attempts. The ‘turn around test’ was used on mice daily aged over P12. This test involved placing mice, head down on a gridded cage top that was at a 45o angle. The time it took for mice to turn 180o to face up was noted, with a maximum of 30 sec and an average of three attempts.

Neuromuscular junction labelling and quantification

Muscles were immediately dissected from recently sacrificed mice and fixed in 4% Paraformaldehyde (PFA; Electron Microscopy Science) in PBS for 15 min. Post-synaptic AChRs were labelled with α-bungarotoxin (BTX, 1:250; tetramethylrhodimine conjugate, Life Technologies) for 2 h. Muscles were permeabilised in 2% Triton X-100 in PBS for 30 min, then blocked in 4% bovine serum albumin (BSA)/1% Triton X-100 in PBS for 30 min before incubation overnight in primary antibodies [Neurofilament, 1:50 (NF; 2H3)—Developmental Studies Hybridoma Bank; synaptic vesicle protein 2, 1:100 (SV2)—Developmental Studies Hybridoma Bank] and visualised with secondary antibodies [AlexaFluor-488 rabbit anti-mouse at 1:250, Jackson]. Muscles were then whole-mounted in Mowiol (Sigma). All images were quantified using a Leica inverted fluorescent microscope using single and dual wavelength filter sets allowing separate and simulations visualisation of red and green channels. The percentage of fully occupied endplates was determined by classifying each endplate in a given field of view either fully occupied (pre-synaptic terminal (SV2 and NF) completely overlies endplate (BTX)), partially occupied (pre-synaptic terminal only partially covers endplate (BTX)), or vacant (no pre-synaptic label overlies endplate). For pre-synaptic swelling, all NMJs were classified as having no swelling, mild (evidence of some axonal swelling and/or pre-synaptic swelling that does not obscure the endplate), moderate (evidence of clear axonal swelling and significant pre-synaptic swelling that is beginning to obscure the endplate) or severe (significant and obvious swelling along the length of the axon and severe swelling around the pre-synaptic terminal, which obscures the endplate). Endplate size was quantified using ImageJ software. Endplate maturation was quantified using a stage 1–4 categorisation, where stage 4 endplates are immature and have a plaque-like appearance, stage 3 endplates are developing from a plaque-like structure with folds visible on the plaque, stage 2 endplates are developing into a pretzel-like structure with folds and perforations visible and stage 1 endplates have a mature pretzel-like structure. At least three fields of view were analysed per muscle totalling >80 endplates per muscle. All Quantification was performed with researcher blind to genotype of material. All example images are z-stack projections and were obtained using a Nikon confocal microscope at ×40 magnification and images had pixel size of 1024 × 1024.

Motor neuron immuno-fluorescence and quantification

Spinal cords were removed from recently sacrificed mice and fixed in 4% PFA (Electron Microscopy Science) for 4 h. They were immersed in 30% sucrose for 48 h prior to embedding in 50% OCT; 15% Sucrose in PBS mixture. For temporal analysis of Smn mice, the ventral horn of thoracic (T1-T12) spinal cords were sectioned longitudinally at 10 µM and alternate sections were subjected to Nissl/ChAT labelling. For analysis of P53fl/fl mice, thoracic (T4-T8) spinal cords were sectioned coronally at 10 µM and every tenth section was subjected to Nissl/ChAT labelling. Sections were washed in PBS, permeabilised in 0.3% Triton X-100 in PBS for 30 min and blocked in 0.1% Power Block (100× , Biogenex Laboratories, HK085–5K) in PBS for 10 min. Sections were incubated in ChAT (Goat anti-choline acetyl-transferase; Merck Millipore; 1:100) primary antibody in 0.3% Triton X-100; 1% Bovine Serum Albumin (BSA) in PBS at 4 °C, for three nights. Secondary antibody (AlexaFluor 555 Donkey anti-Goat; Life Technologies; 1:250) was applied for 2 h at a dilution of 1:250 at room temperature. Sections were then stained with DAPI (Life Technologies; 1:1000) and fluorescent Nissl stain (NeuroTrace; Life Technologies: 1:100). Sections were mounted in Mowiol (Sigma). For quantification of motor neuron number, the number of ChAT positive cells with a visible nucleolus were quantified in each section. For Fig. 2, this was done on longitudinal section, quantifying every second section. For Fig. 5, this was done on coronal section, for every 30th section. For motor neuron cell body area, images were captured on a standard fluorescent microscope (Leica DM8) and the perimeter of each cell was traced using ImageJ software. All data was assembled in Microsoft Excel and analysed using GraphPad Prism.

qRT-PCR

RNA was extracted using a micro RNeasy Kit (Qiagen) and 1 µg of RNA was used to perform reverse transcriptase using the RT[2] First Strand Kit (Qiagen). SYBR gene based Q-RT-PCR was performed using pre-optimised primers purchased from Qiagen. Amplification was performed using KAPA SYBR fast universal PCR mastermix as per manufacturer's instructions on a BioRad CFX connect real-time PCR detection system. Relative gene expression was calculated using the 2−ΔΔcT formula[44]. Relative levels are expressed normalised to Actin (F: CCGTCAGGCAGCTCATAGCTCTTC; R: CTGAACCCTAAGGCCAACCGT), GusB (F: GGCTGGTGACCTACTGGATTT; R: TTGGCACTGGGAACCTGAAGT) and YWHAZ (F: TTGATCCCCAATGCTTCGC; R:: CAGCAACCTCGGCCAAGTAA). Supplementary Figure 1. Supplementary Figure 2. Supplementary figure legends.
  44 in total

Review 1.  p53, a translational regulator: contribution to its tumour-suppressor activity.

Authors:  V Marcel; F Catez; J-J Diaz
Journal:  Oncogene       Date:  2015-03-02       Impact factor: 9.867

2.  p53 prevents neurodegeneration by regulating synaptic genes.

Authors:  Paola Merlo; Bess Frost; Shouyong Peng; Yawei J Yang; Peter J Park; Mel Feany
Journal:  Proc Natl Acad Sci U S A       Date:  2014-12-01       Impact factor: 11.205

3.  Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy.

Authors:  Christian M Simon; Ya Dai; Meaghan Van Alstyne; Charalampia Koutsioumpa; John G Pagiazitis; Joshua I Chalif; Xiaojian Wang; Joseph E Rabinowitz; Christopher E Henderson; Livio Pellizzoni; George Z Mentis
Journal:  Cell Rep       Date:  2017-12-26       Impact factor: 9.423

4.  Complete dissociation of motor neuron death from motor dysfunction by Bax deletion in a mouse model of ALS.

Authors:  Thomas W Gould; Robert R Buss; Sharon Vinsant; David Prevette; Woong Sun; C Michael Knudson; Carol E Milligan; Ronald W Oppenheim
Journal:  J Neurosci       Date:  2006-08-23       Impact factor: 6.167

5.  Correlates of p53- and Fas (CD95)-mediated apoptosis in Alzheimer's disease.

Authors:  S M de la Monte; Y K Sohn; J R Wands
Journal:  J Neurol Sci       Date:  1997-11-06       Impact factor: 3.181

6.  Rescue of gene-expression changes in an induced mouse model of spinal muscular atrophy by an antisense oligonucleotide that promotes inclusion of SMN2 exon 7.

Authors:  John F Staropoli; Huo Li; Seung J Chun; Norm Allaire; Patrick Cullen; Alice Thai; Christina M Fleet; Yimin Hua; C Frank Bennett; Adrian R Krainer; Doug Kerr; Alexander McCampbell; Frank Rigo; John P Carulli
Journal:  Genomics       Date:  2015-01-31       Impact factor: 5.736

7.  Selective vulnerability of motor neurons and dissociation of pre- and post-synaptic pathology at the neuromuscular junction in mouse models of spinal muscular atrophy.

Authors:  Lyndsay M Murray; Laura H Comley; Derek Thomson; Nick Parkinson; Kevin Talbot; Thomas H Gillingwater
Journal:  Hum Mol Genet       Date:  2007-12-08       Impact factor: 6.150

8.  p53 is present in synapses where it mediates mitochondrial dysfunction and synaptic degeneration in response to DNA damage, and oxidative and excitotoxic insults.

Authors:  Charles P Gilman; Sic L Chan; Zhihong Guo; Xiaoxiang Zhu; Nigel Greig; Mark P Mattson
Journal:  Neuromolecular Med       Date:  2003       Impact factor: 4.103

Review 9.  P53 Dysfunction in Neurodegenerative Diseases - The Cause or Effect of Pathological Changes?

Authors:  Aleksandra Szybińska; Wiesława Leśniak
Journal:  Aging Dis       Date:  2017-07-21       Impact factor: 6.745

10.  Alternative splicing events are a late feature of pathology in a mouse model of spinal muscular atrophy.

Authors:  Dirk Bäumer; Sheena Lee; George Nicholson; Joanna L Davies; Nicholas J Parkinson; Lyndsay M Murray; Thomas H Gillingwater; Olaf Ansorge; Kay E Davies; Kevin Talbot
Journal:  PLoS Genet       Date:  2009-12-18       Impact factor: 5.917

View more
  8 in total

1.  Motor unit recovery following Smn restoration in mouse models of spinal muscular atrophy.

Authors:  Laura H Comley; Rachel A Kline; Alison K Thomson; Victoria Woschitz; Eric Villalón Landeros; Erkan Y Osman; Christian L Lorson; Lyndsay M Murray
Journal:  Hum Mol Genet       Date:  2022-09-10       Impact factor: 5.121

2.  Synaptic withdrawal following nerve injury is influenced by postnatal maturity, muscle-specific properties, and the presence of underlying pathology in mice.

Authors:  Alannah J Mole; Sarah Bell; Alison K Thomson; Kosala N Dissanayake; Richard R Ribchester; Lyndsay M Murray
Journal:  J Anat       Date:  2020-04-20       Impact factor: 2.610

3.  Suppression of the necroptotic cell death pathways improves survival in Smn 2B/- mice.

Authors:  Lucia Chehade; Marc-Olivier Deguise; Yves De Repentigny; Rebecca Yaworski; Ariane Beauvais; Sabrina Gagnon; Niko Hensel; Rashmi Kothary
Journal:  Front Cell Neurosci       Date:  2022-08-03       Impact factor: 6.147

4.  Neuromuscular denervation and deafferentation but not motor neuron death are disease features in the Smn2B/- mouse model of SMA.

Authors:  Maria J Carlini; Marina K Triplett; Livio Pellizzoni
Journal:  PLoS One       Date:  2022-08-01       Impact factor: 3.752

5.  Mouse models of SMA show divergent patterns of neuronal vulnerability and resilience.

Authors:  Victoria Woschitz; Irene Mei; Eva Hedlund; Lyndsay M Murray
Journal:  Skelet Muscle       Date:  2022-09-12       Impact factor: 5.063

6.  Spinal motor neuron loss occurs through a p53-and-p21-independent mechanism in the Smn2B/- mouse model of spinal muscular atrophy.

Authors:  Emily J Reedich; Martin Kalski; Nicholas Armijo; Gregory A Cox; Christine J DiDonato
Journal:  Exp Neurol       Date:  2020-12-28       Impact factor: 5.330

Review 7.  In Search of a Cure: The Development of Therapeutics to Alter the Progression of Spinal Muscular Atrophy.

Authors:  Kristine S Ojala; Emily J Reedich; Christine J DiDonato; Stephen D Meriney
Journal:  Brain Sci       Date:  2021-02-05

8.  Motor transmission defects with sex differences in a new mouse model of mild spinal muscular atrophy.

Authors:  Marc-Olivier Deguise; Yves De Repentigny; Alexandra Tierney; Ariane Beauvais; Jean Michaud; Lucia Chehade; Mohamed Thabet; Brittany Paul; Aoife Reilly; Sabrina Gagnon; Jean-Marc Renaud; Rashmi Kothary
Journal:  EBioMedicine       Date:  2020-04-24       Impact factor: 8.143

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.