Literature DB >> 31272478

A primate-specific short GluN2A-NMDA receptor isoform is expressed in the human brain.

Hannah Warming1, Chrysia-Maria Pegasiou1, Aleksandra P Pitera1, Hanna Kariis1, Steven D Houghton1, Ksenia Kurbatskaya1, Aminul Ahmed2, Paul Grundy2, Girish Vajramani1,2, Diederik Bulters1,2, Xavier Altafaj3, Katrin Deinhardt1, Mariana Vargas-Caballero4.   

Abstract

Glutamate receptors of the N-methyl-D-aspartate (NMDA) family are coincident detectors of pre- and postsynaptic activity, allowing Ca2+ influx into neurons. These properties are central to neurological disease mechanisms and are proposed to be the basis of associative learning and memory. In addition to the well-characterised canonical GluN2A NMDAR isoform, large-scale open reading frames in human tissues had suggested the expression of a primate-specific short GluN2A isoform referred to as GluN2A-S. Here, we confirm the expression of both GluN2A transcripts in human and primate but not rodent brain tissue, and show that they are translated to two corresponding GluN2A proteins present in human brain. Furthermore, we demonstrate that recombinant GluN2A-S co-assembles with the obligatory NMDAR subunit GluN1 to form functional NMDA receptors. These findings suggest a more complex NMDAR repertoire in human brain than previously thought.

Entities:  

Keywords:  Glutamatergic; Human; NMDA receptor; Neurosurgery; PSD-95; Primate; Resected; Synapses

Mesh:

Substances:

Year:  2019        PMID: 31272478      PMCID: PMC6610962          DOI: 10.1186/s13041-019-0485-9

Source DB:  PubMed          Journal:  Mol Brain        ISSN: 1756-6606            Impact factor:   4.041


Introduction

NMDA receptors are activated by coincident glutamate binding and intracellular depolarisation. Ca2+ entry via NMDARs can gate long-term biochemical and gene expression changes that alter synaptic strength, which are proposed as central to mechanisms of memory storage [17] and neurodegenerative processes [9]. Our current knowledge of NMDAR function is largely derived from the study of rodent receptors and heterologous expression of cloned rodent genes. Tetrameric NMDARs comprise two obligatory GluN1 subunits and two GluN2 or GluN3 subunits, and in the adult forebrain GluN1/GluN2A, GluN1/GluN2B diheteromers, and GluN1/GluN2A/GluN2B triheteromers are the most common [18, 19]. The subunit combination confers the distinct biophysical and pharmacological properties to the receptor channel. The developmentally and anatomically regulated gene expression of NMDAR subunits, together with diverse post-translational modification mechanisms and protein interactions, determines the assembly, trafficking, synaptic or extrasynaptic localisation and internalisation of NMDARs (Reviewed in [16]) and their correct functioning is necessary for human brain functions [5, 6, 21]. Homologous rodent and human NMDARs do share highly conserved subunit sequences and exhibit almost identical pharmacological properties [10]. However, large scale open reading frame studies performed with mRNA from a mix of human tissues [20, 28] have suggested that in addition to the conserved NMDAR canonical isoform of GluN2A in chordates, a shorter isoform is produced in humans (GluN2A-S) generated by alternative splicing of human GRIN2A (Fig. 1a). Here, we show that this alternative NMDAR isoform is expressed in the human and primate brain, and that it forms functional receptors together with the obligatory subunit GluN1 [15]. The presence of alternative NMDAR subunits not expressed in rodent model systems indicates the existence of unexplored neural mechanisms in human synapses with relevance to normal function, ageing and neurological disease.
Fig. 1

The GRIN2A gene has two transcript variants in human and primate but not mouse brain. a A short isoform of GRIN2A transcript was predicted by open reading frame studies. The published sequence of GRIN2A-S suggests that the final exon (exon 13) is missing two nucleotide regions compared to the canonical transcript: firstly, the lack of 343 nucleotides generates a putative exon 14 in GRIN2A-S (splice site shown in Ai) and the final 206 nucleotides of the canonical form are lost altogether. We designed primers to amplify the region of variance between the two isoforms (Fig. 1, Fw1/Rv1) generating an amplicon of 474 bp in GRIN2A and 131 bp in GRIN2A-S. A second reverse primer was designed to amplify canonical GRIN2A selectively (Fig. 1a, Rv2) generating an amplicon of 380 bp. b-f RT-PCR amplification end products. Control conditions indicate no cDNA template was used in PCR b In human cDNA, only the short form of GRIN2A was observed likely due to preferential amplification in PCR, whereas only a long product of 474 bp was seen in mouse using either human or mouse specific primers. c The Fw1/Rv2 primer pair was used to confirm expression of canonical GRIN2A in the same human sample as shown in (B). d 3 other human cortical samples with GRIN2A-S amplified. e Both the short and long amplicons were observed in human foetal cDNA. f GRIN2A-S was observed in primate (Rhesus) brain cDNA. g Sequencing of human and primate RT-PCR short amplicons confirmed the presence of the putative splice site shown in Ai

The GRIN2A gene has two transcript variants in human and primate but not mouse brain. a A short isoform of GRIN2A transcript was predicted by open reading frame studies. The published sequence of GRIN2A-S suggests that the final exon (exon 13) is missing two nucleotide regions compared to the canonical transcript: firstly, the lack of 343 nucleotides generates a putative exon 14 in GRIN2A-S (splice site shown in Ai) and the final 206 nucleotides of the canonical form are lost altogether. We designed primers to amplify the region of variance between the two isoforms (Fig. 1, Fw1/Rv1) generating an amplicon of 474 bp in GRIN2A and 131 bp in GRIN2A-S. A second reverse primer was designed to amplify canonical GRIN2A selectively (Fig. 1a, Rv2) generating an amplicon of 380 bp. b-f RT-PCR amplification end products. Control conditions indicate no cDNA template was used in PCR b In human cDNA, only the short form of GRIN2A was observed likely due to preferential amplification in PCR, whereas only a long product of 474 bp was seen in mouse using either human or mouse specific primers. c The Fw1/Rv2 primer pair was used to confirm expression of canonical GRIN2A in the same human sample as shown in (B). d 3 other human cortical samples with GRIN2A-S amplified. e Both the short and long amplicons were observed in human foetal cDNA. f GRIN2A-S was observed in primate (Rhesus) brain cDNA. g Sequencing of human and primate RT-PCR short amplicons confirmed the presence of the putative splice site shown in Ai

Results and discussion

To test whether the GluN2A-S mRNA (GRIN2A) is expressed in human brain, we designed primers (Fw1/Rv1) flanking the region of exon 13 containing the 343 base pairs (bp) present only in GRIN2A (Fig. 1a). We predicted two distinct amplicons (474 bp and 131 bp) that would distinguish the GRIN2A and GRIN2A-S transcripts, respectively (Fig. 1a). Following PCR using cDNA from human brain (Table 1) as template, we observed the presence of a ~ 131 bp amplicon. In contrast, in mouse we observed one product of 474 bp, corresponding to the canonical isoform, using Fw1/Rv1 primers and a pair of primers modified to exactly match mouse Grin2A at the same location (mFw1/mRv1, Fig. 1b). If both short and long GRIN2A cDNAs are present in the human sample, the synthesis of shorter cDNA could overwhelm the early PCR cycles [27] and only generate the short amplicon. Using an additional GRIN2A specific reverse primer (Rv2), we confirmed the presence of canonical GRIN2A in this human cDNA sample (Fig. 1c). We observed the 131 bp band in further adult brain cDNAs tested with Fw1/Rv1 primer pair (Fig. 1d, two further samples not shown). Although its expression levels increase developmentally, GluN2A is expressed throughout the life course [2]. We tested foetal human brain cDNA and confirmed the expression of both GRIN2A and GRIN2A-S (Fig. 1e). Thus, our data confirm the presence of both canonical GRIN2A and the novel GRIN2A-S transcripts in human brain tissue samples.
Table 1

Details of resected human brain tissue samples

Case NumberSexAgeReason for Surgery
004M52Hippocampal sclerosis
007F21DNET
008M71Glioblastoma
010M28Hippocampal sclerosis
011F42Glioma
014M32Hippocampal sclerosis
016F36Hippocampal sclerosis
017F62Hippocampal sclerosis
018M30Cavernous malformation
019M19Arteriovenous malformation
020F70Arteriovenous malformation
021M49Hippocampal sclerosis
022F58Subarachnoid haemorrhage
024F50Cavernous malformation
026M27Mesial temporal DNET with signal changes in the hippocampus
028F38Epilepsy
030M40Cortical dysplasia
032F29Tumour resection
037M52Glioma
039F58Tumour resection
041M41Hippocampal sclerosis

M Male, F Female, DNET Dysembryoplastic neuroepithelial tumour

Details of resected human brain tissue samples M Male, F Female, DNET Dysembryoplastic neuroepithelial tumour A BLAST search of the 131 bp sequence amplified by primers Fw1/Rv1 provided primate-specific predictive hits. To confirm whether GRIN2A-S transcript is present in primate brain, we tested Rhesus macaque brain cDNA with Fw1/Rv1 primers and confirmed the presence of GRIN2A-S (Fig. 1f). We sequenced the shorter PCR products for both the adult human and primate samples and confirmed the presence of the exact splice site reported in the European Nucleotide Archive (Coding: AAI17132.1; [20] (Fig. 1a,g). Furthermore, we aimed to evaluate whether the GRIN2A and GRIN2A-S transcripts were translated into the corresponding proteins. To this end, we hypothesised that if both transcripts are translated into proteins, two protein bands corresponding to GluN2A and GluN2A-S in human homogenate would be immunodetected by a GluN2A antibody targeting an epitope conserved between the canonical and short GluN2A isoforms (Fig. 2a,b). Importantly, Western blot analysis from human brain homogenates confirmed the presence of two immunoreactive bands with a molecular weight corresponding to the predicted GluN2A and GluN2A-S isoforms. On the contrary, a single immunoreactive band with the high molecular weight (corresponding to the canonical GluN2A) was detected in mouse brain lysates (Fig. 2b). Furthermore, using an antibody specifically detecting a carboxy terminal epitope (exclusively present in the canonical GluN2A isoform), we detected the presence of a single band, with a molecular weight corresponding to the canonical GluN2A subunit (Fig. 2a, b). To confirm the identity of the low molecular weight band, we immunoprecipitated GluN2A from human tissue homogenates with an antibody against the conserved N-terminal domain and analysed the primate-specific band (Band 2, Fig. 2c) by mass spectrometry. This unbiased method allowed the identification of 14 unique peptides located within GluN2A residues 81–1022, confirming that this low molecular band contains the proximal part of GluN2A, and thus discarding the potential cross-reactivity of anti-GluN2A N-terminal antibody (Fig. 2d). To assess the relative levels of GluN2A-S vs. total GluN2A, human cortical homogenates from fresh-frozen tissue resected from individuals 27–61 years of age were analysed by Western blot and the quantification showed that GluN2A-S immunoreactivity accounts for 34 ± 4% of canonical GluN2A protein in cortical human brain homogenate (Table 1) and this fraction remains constant across age (Fig. 2ei).
Fig. 2

Two GluN2A protein bands are observed in human but not mouse brain. a Topology of the GluN2A subunit of the NMDA receptor and of GluN2A-S predicted from human mRNA studies. A spliced region is retained in canonical GluN2A leading to an alteration of the reading frame to generate a diverging C-terminal sequence (red) with early truncation. Epitopes for the antibodies used are shown in green and are numbered. b Immunoblots with specific antibodies against the canonical GluN2A and putative GluN2A-S protein in human and mouse cortical lysates. c GluN2A proteins were pulled down with an N-terminal antibody. Band 2 was cut from Coomassie-stained polyacrylamide gel and analysed by mass spectrometry. IP, immunoprecipitate. FT, flowthrough d A set of 14 peptides were confirmed to be present in this band. Figure shows tryptic peptides from band 2 coverage to either canonical GluN2A amino acid sequence (Uniprot: Q12879) or GluN2AS (Q12879–2, predicted) confirming band 2 contains GluN2A protein. e Homogenate from freshly frozen cortical human tissue probed with the GluN2A antibody Abcam 133,265 (select blots shown on top) and quantification of GluN2A-S / GluN2A immunoreactivity (bottom). See Table 1 for human tissue sample details. f Recombinant GluN2A-S co-expressed with GluN1 in HEK293 cells produces functional NMDARs as demonstrated by a typical J-shaped curve in response to 40 mM NMDA in response to a slow ramp of voltage (− 70 to + 50 mV, 3 s)

Two GluN2A protein bands are observed in human but not mouse brain. a Topology of the GluN2A subunit of the NMDA receptor and of GluN2A-S predicted from human mRNA studies. A spliced region is retained in canonical GluN2A leading to an alteration of the reading frame to generate a diverging C-terminal sequence (red) with early truncation. Epitopes for the antibodies used are shown in green and are numbered. b Immunoblots with specific antibodies against the canonical GluN2A and putative GluN2A-S protein in human and mouse cortical lysates. c GluN2A proteins were pulled down with an N-terminal antibody. Band 2 was cut from Coomassie-stained polyacrylamide gel and analysed by mass spectrometry. IP, immunoprecipitate. FT, flowthrough d A set of 14 peptides were confirmed to be present in this band. Figure shows tryptic peptides from band 2 coverage to either canonical GluN2A amino acid sequence (Uniprot: Q12879) or GluN2AS (Q12879–2, predicted) confirming band 2 contains GluN2A protein. e Homogenate from freshly frozen cortical human tissue probed with the GluN2A antibody Abcam 133,265 (select blots shown on top) and quantification of GluN2A-S / GluN2A immunoreactivity (bottom). See Table 1 for human tissue sample details. f Recombinant GluN2A-S co-expressed with GluN1 in HEK293 cells produces functional NMDARs as demonstrated by a typical J-shaped curve in response to 40 mM NMDA in response to a slow ramp of voltage (− 70 to + 50 mV, 3 s) Finally, to test whether GluN2A-S can be incorporated into functional NMDARs, we co-transfected HEK293 cells with plasmids expressing GluN2A-S and GluN1 subunits [15]. A slow voltage ramp delivered during local perfusion with 40 μM NMDA and 10 μM glycine elicited a typical J-shaped curve (Fig. 2fi), and subtraction of responses without agonist (leak subtraction) revealed a typical NMDA current with reversal potential near 0 mV (Fig. 2eii). This confirms that GluN2A-S subunits are able to assemble with GluN1 subunits and become inserted into the plasma membrane to form a functional NMDAR that likely plays a role in human neural function. Here we describe for the first time the brain expression of an uncharacterised, primate-specific NMDAR subunit. The splice site for GluN2A-S suggests that it will contain a diverging 19 aa sequence in its extreme C-terminal domain (Fig. 2a), in addition to lacking the distal carboxy terminal domain (183 amino acids) that contains PKC/SFK phosphorylation sites, two PDZ binding motifs that allow synaptic localisation [4, 12, 14], and a dileucin clathrin adaptor motif involved in receptor internalisation [13]. Following many lines of published evidence, these differences suggest that the dynamic regulation of GluN2A-S in response to stimuli could diverge from GluN2A subunit-containing NMDARs. This could impact the number of receptors present synaptically or extrasynaptically, the insertion of new receptors into the membrane, their lateral diffusion and clustering into synapses and their active removal. The potential changes in human synapses compared to mouse neurons void of GluN2A-S could result in distinct mechanisms involved in activity-dependent plasticity of synapses, which will highly depend upon its triheteromeric partners [1, 8, 19]. Together, our data suggest that GluN2A-S is a primate-specific NMDAR subunit and a substantial component of functional NMDARs in the adult human brain. Many neuronal mechanisms discovered in mice have been successfully recapitulated in humans. However, mounting evidence suggests that there are important differences between rodent and human neurons that result in distinct signal integration properties [22, 23, 26] and proteomic composition of synapses [3]. Species differences may ultimately impact the way in which human neural circuits can be computationally modelled [7], and the translation of pre-clinical findings into approved therapies [24]. Further analyses of GluN2A-S spatio-temporal gene expression and synaptic/ extrasynaptic localisation will enhance our knowledge of their functional role and may uncover NMDAR trafficking mechanisms present only in primates and diverging sequences may uncover novel therapeutic targets.

Materials and methods

Human brain tissue samples

All samples consisted of cortical tissue resected for access to deeper brain lesions such as sclerotic hippocampus in epileptic patients (the pathological tissue for these lesions was not used). Informed consent was obtained from all patients to use surgically-resected putatively non-pathological tissue not required for diagnostic purposes (see ethical approval declaration). Briefly, resected tissue was obtained from temporal cortex of patients undergoing surgery for the removal of deeper structures. Tissue was collected in ice cold artificial cerebrospinal fluid [26] then taken to the laboratory, frozen and kept at − 80 °C. Transfer time was of the order of 10–15 min.

Mouse brain tissue

Mice were decapitated following isoflurane anaesthesia (see ethical approval declaration). Brains were extracted in ice-cold ACSF and sliced or snap-frozen. All brain tissue samples were stored in the -80C freezer until lysed.

RNA extraction and cDNA synthesis

Total RNA was isolated from human and mouse tissue using Trizol and then purified using the RNeasy Mini kit (QIAGEN) following the manufacturer’s instructions. cDNA was synthesised immediately from 200 ng of total RNA per reaction using the SuperScript IV reverse transcriptase and cDNA synthesis kit (INVITROGEN) according to the manufacturer’s instructions. The cDNA obtained was stored at − 80 °C. Human foetal cDNA was obtained from Takara (Normal brain tissue cDNA, pooled from 59 spontaneously aborted male/female Caucasian fetuses, ages: 20–33 weeks). Rhesus macaque cDNA was obtained from Amsbio (Normal brain tissue, Female, 4.5 years).

PCR conditions and primers

PCR was performed on 1μg of cDNA using primers and REDTaq® Readymix™ PCR Reaction Mix (Sigma-Aldrich) for 40 cycles. DNA was denatured at 95 degree C and extended at 72 degree C for 45 s each cycle. Products were separated on a 1.5% agarose gel. The following primers were used: Fw1: ATTCAGGCCACTTCACCATGAG, Rv1: ATCTCCCAATAACCAAGCGTTG, Rv2: CTTGCTGTCCTCCAGACCTTGG mFw1: ACTCAGGCCACTTTACCATGAG, and mRv1: ATCTCCCAATAACTAAGCGTTG.

Plasmids

pEYFP-NR1a was a gift from Stefano Vicini (Addgene plasmid # 17928; [15]). GRIN2A-S plasmid from Broad Institute, was acquired from Source Bioscience (Transcript NM_001134408.2).

Western blotting

Equal amounts of protein (28 μg) were separated in 7.5% acrylamide gels by SDS-PAGE and transferred onto nitrocellulose membranes. Membranes were blocked in 5% (w/v) non-fat milk for 1 h at room temperature and incubated overnight at 4 C in 5% (w/v) bovine serum albumin (BSA) containing 0.1% (v/v) Tween-20 and one of the following primary antibodies: anti-NMDAR2A (ab133265; 1:1000; Abcam); and GAPDH (D16H11; 1:1000; CST) actin. Membranes were washed 3 times with Tris-buffered saline (TBS) containing 0.1% Tween-20 (TBS-T) and probed with fluorophore-conjugated goat anti-mouse/−rabbit secondary antibody (1:10000; LI-COR). Proteins were visualised using the Odyssey infrared scanner (LI-COR) using Image Studio Light Software.

GluN2A pulldown

GluN2A was pulled down from 1 mg of protein homogenate (in RIPA buffer) using 2 μg of Alomone antibody AGG-002 beads. Eluate was run in SDS page and stained with Coomassie dye. The lighter band corresponding to putative GluN2A-S was cut and analysed by LC-MS/MS [11].

HEK293T cell recordings

HEK293T cells were cultured at 37 C with 5% CO2 in Dulbecco’s Modified Eagle Medium with glucose, L-glutamine and pyruvate, 10% FBS and 1% Pen-Strep and seeded at low density onto poly-L-lysine coated glass coverslips for electrophysiology. Adherent cells were transfected using JetPEI reagent with NR1a and GluN2A-S plasmids at a 1:1 ratio and recorded after 48 h. Borosilicate glass micropipettes were pulled to produce a resistance of 4–6 mOhm and filled with intracellular recording solution containing in mM: Gluconic acid 70, Caesium chloride 10, sodium chloride 5, BAPTA 10, HEPES 10, GTP 0.3 ATP 4 and pH balanced to 7.3 with caesium hydroxide. Cells were perfused with aCSF throughout recording containing, in mM: sodium chloride 126, calcium dichloride 2, glucose 10, magnesium sulfate 2, potassium chloride 3, NaH2PO4 1.25 and NaHCO3 26.4, and glycine 10 μM and pH regulated by continuous bubbling of 95% oxygen, 5% CO2. Recordings with or without addition of NMDA 40 μM were made in whole-cell voltage clamp and Matlab software and amplified using an Axopatch 200B as previously described [28].
  28 in total

Review 1.  Synaptic plasticity and memory: an evaluation of the hypothesis.

Authors:  S J Martin; P D Grimwood; R G Morris
Journal:  Annu Rev Neurosci       Date:  2000       Impact factor: 12.449

2.  Preferential PCR amplification of alleles: mechanisms and solutions.

Authors:  P S Walsh; H A Erlich; R Higuchi
Journal:  PCR Methods Appl       Date:  1992-05

3.  Mechanisms underlying the rules for associative plasticity at adult human neocortical synapses.

Authors:  Matthijs B Verhoog; Natalia A Goriounova; Joshua Obermayer; Jasper Stroeder; J J Johannes Hjorth; Guilherme Testa-Silva; Johannes C Baayen; Christiaan P J de Kock; Rhiannon M Meredith; Huibert D Mansvelder
Journal:  J Neurosci       Date:  2013-10-23       Impact factor: 6.167

4.  Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.

Authors:  Robert L Strausberg; Elise A Feingold; Lynette H Grouse; Jeffery G Derge; Richard D Klausner; Francis S Collins; Lukas Wagner; Carolyn M Shenmen; Gregory D Schuler; Stephen F Altschul; Barry Zeeberg; Kenneth H Buetow; Carl F Schaefer; Narayan K Bhat; Ralph F Hopkins; Heather Jordan; Troy Moore; Steve I Max; Jun Wang; Florence Hsieh; Luda Diatchenko; Kate Marusina; Andrew A Farmer; Gerald M Rubin; Ling Hong; Mark Stapleton; M Bento Soares; Maria F Bonaldo; Tom L Casavant; Todd E Scheetz; Michael J Brownstein; Ted B Usdin; Shiraki Toshiyuki; Piero Carninci; Christa Prange; Sam S Raha; Naomi A Loquellano; Garrick J Peters; Rick D Abramson; Sara J Mullahy; Stephanie A Bosak; Paul J McEwan; Kevin J McKernan; Joel A Malek; Preethi H Gunaratne; Stephen Richards; Kim C Worley; Sarah Hale; Angela M Garcia; Laura J Gay; Stephen W Hulyk; Debbie K Villalon; Donna M Muzny; Erica J Sodergren; Xiuhua Lu; Richard A Gibbs; Jessica Fahey; Erin Helton; Mark Ketteman; Anuradha Madan; Stephanie Rodrigues; Amy Sanchez; Michelle Whiting; Anup Madan; Alice C Young; Yuriy Shevchenko; Gerard G Bouffard; Robert W Blakesley; Jeffrey W Touchman; Eric D Green; Mark C Dickson; Alex C Rodriguez; Jane Grimwood; Jeremy Schmutz; Richard M Myers; Yaron S N Butterfield; Martin I Krzywinski; Ursula Skalska; Duane E Smailus; Angelique Schnerch; Jacqueline E Schein; Steven J M Jones; Marco A Marra
Journal:  Proc Natl Acad Sci U S A       Date:  2002-12-11       Impact factor: 11.205

5.  Triheteromeric NR1/NR2A/NR2B receptors constitute the major N-methyl-D-aspartate receptor population in adult hippocampal synapses.

Authors:  Claudia Rauner; Georg Köhr
Journal:  J Biol Chem       Date:  2010-12-29       Impact factor: 5.157

6.  Molecular pharmacology of human NMDA receptors.

Authors:  Maiken Hedegaard; Kasper B Hansen; Karen T Andersen; Hans Bräuner-Osborne; Stephen F Traynelis
Journal:  Neurochem Int       Date:  2011-12-17       Impact factor: 3.921

7.  Diagnostic exome sequencing in persons with severe intellectual disability.

Authors:  Joep de Ligt; Marjolein H Willemsen; Bregje W M van Bon; Tjitske Kleefstra; Helger G Yntema; Thessa Kroes; Anneke T Vulto-van Silfhout; David A Koolen; Petra de Vries; Christian Gilissen; Marisol del Rosario; Alexander Hoischen; Hans Scheffer; Bert B A de Vries; Han G Brunner; Joris A Veltman; Lisenka E L M Vissers
Journal:  N Engl J Med       Date:  2012-10-03       Impact factor: 91.245

8.  Delineation of additional PSD-95 binding domains within NMDA receptor NR2 subunits reveals differences between NR2A/PSD-95 and NR2B/PSD-95 association.

Authors:  S L Cousins; A V Kenny; F A Stephenson
Journal:  Neuroscience       Date:  2008-01-19       Impact factor: 3.590

9.  High bandwidth synaptic communication and frequency tracking in human neocortex.

Authors:  Guilherme Testa-Silva; Matthijs B Verhoog; Daniele Linaro; Christiaan P J de Kock; Johannes C Baayen; Rhiannon M Meredith; Chris I De Zeeuw; Michele Giugliano; Huibert D Mansvelder
Journal:  PLoS Biol       Date:  2014-11-25       Impact factor: 8.029

10.  Unique membrane properties and enhanced signal processing in human neocortical neurons.

Authors:  Guy Eyal; Matthijs B Verhoog; Guilherme Testa-Silva; Yair Deitcher; Johannes C Lodder; Ruth Benavides-Piccione; Juan Morales; Javier DeFelipe; Christiaan Pj de Kock; Huibert D Mansvelder; Idan Segev
Journal:  Elife       Date:  2016-10-06       Impact factor: 8.140

View more
  6 in total

Review 1.  Structure, Function, and Pharmacology of Glutamate Receptor Ion Channels.

Authors:  Kasper B Hansen; Lonnie P Wollmuth; Derek Bowie; Hiro Furukawa; Frank S Menniti; Alexander I Sobolevsky; Geoffrey T Swanson; Sharon A Swanger; Ingo H Greger; Terunaga Nakagawa; Chris J McBain; Vasanthi Jayaraman; Chian-Ming Low; Mark L Dell'Acqua; Jeffrey S Diamond; Chad R Camp; Riley E Perszyk; Hongjie Yuan; Stephen F Traynelis
Journal:  Pharmacol Rev       Date:  2021-10       Impact factor: 18.923

Review 2.  Targeting NMDA receptors in neuropsychiatric disorders by drug screening on human neurons derived from pluripotent stem cells.

Authors:  Wenbo Zhang; P Joel Ross; James Ellis; Michael W Salter
Journal:  Transl Psychiatry       Date:  2022-06-09       Impact factor: 7.989

3.  Splicing and editing of ionotropic glutamate receptors: a comprehensive analysis based on human RNA-Seq data.

Authors:  Robin Herbrechter; Nadine Hube; Raoul Buchholz; Andreas Reiner
Journal:  Cell Mol Life Sci       Date:  2021-06-08       Impact factor: 9.261

4.  Robust Expression of Functional NMDA Receptors in Human Induced Pluripotent Stem Cell-Derived Neuronal Cultures Using an Accelerated Protocol.

Authors:  Jacob B Ruden; Mrinalini Dixit; José C Zepeda; Brad A Grueter; Laura L Dugan
Journal:  Front Mol Neurosci       Date:  2021-11-26       Impact factor: 5.639

Review 5.  Protein quality control of N-methyl-D-aspartate receptors.

Authors:  Taylor M Benske; Ting-Wei Mu; Ya-Juan Wang
Journal:  Front Cell Neurosci       Date:  2022-07-22       Impact factor: 6.147

Review 6.  Regulation of the NMDA receptor by its cytoplasmic domains: (How) is the tail wagging the dog?

Authors:  Yevheniia Ishchenko; Melissa G Carrizales; Anthony J Koleske
Journal:  Neuropharmacology       Date:  2021-06-20       Impact factor: 5.273

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.