| Literature DB >> 31264664 |
Jinming Ma1, Zhongzhe Lv1, Jianchuan Wang1, Jianmin Lu1.
Abstract
BACKGROUND To investigate the relation between interleukin-10 (IL-10) gene rs1800871 (A/G) polymorphism and spinal tuberculosis. MATERIAL AND METHODS A total of 129 patients with spinal tuberculosis (spinal tuberculosis group) and 106 healthy subjects receiving physical examination (control group) were enrolled in this study. The general data of these subjects were collected, and the C-reactive protein, erythrocyte sedimentation rate (ESR) and baseline hematologic function were examined. The rs1800871 (A/G) polymorphism in IL-10 gene was detected by TaqMan-MGB probe method. RESULTS The C-reactive protein, ESR, white blood cell count, absolute neutrophil count and relative neutrophil count in spinal tuberculosis group were higher than those in control group, while the absolute lymphocyte count and relative lymphocyte count were lower than those in control group (p<0.05). Compared with AA genotype, GG and AG+GG genotypes showed statistically significant difference in distribution frequency (p<0.05), but no significant difference was detected between AG genotype and AA genotype (p>0.05). In spinal tuberculosis group, the frequency of G allele was higher than that of A allele (p<0.01). The C-reactive protein, ESR, white blood cell count and relative neutrophil count in GG genotype were increased compared with those in AG+GG genotype (p<0.05). CONCLUSIONS The rs1800871 (A/G) polymorphism in IL-10 gene is related to the susceptibility to spinal tuberculosis. Moreover, carrying G allele increases the risk of spinal tuberculosis.Entities:
Year: 2019 PMID: 31264664 PMCID: PMC6618335 DOI: 10.12659/MSM.914039
Source DB: PubMed Journal: Med Sci Monit ISSN: 1234-1010
TaqMan®-MGB probe information at locus rs1800871 of in IL-10 gene.
| SNP reference | rs1800871 |
|---|---|
| Assay ID | C___1747362_10 |
| Protein ID | NP_000563.1 |
| Single nucleotide polymorphism (SNP) Type | Intron |
| Context sequence | AGTGAGCAAACTGAGGCACAGAGAT[A/G]TTACATCACCTGTACAAGGGTACAC |
Comparisons of basic data between the two groups (χ̄±s).
| Group | n | Age (years old) | Male/Female |
|---|---|---|---|
| Spinal tuberculosis group | 129 | 36.32±10.50 | 66/63 |
| Control group | 106 | 40.80±6.54 | 50/56 |
| 1.592 | 0.371 | ||
| 0.213 | 0.542 |
Comparisons of blood examination indicators between the two groups (χ̄±s).
| Index | Spinal tuberculosis group | Control group | t | p |
|---|---|---|---|---|
| C-reactive protein (mg/L) | 24.5±1.5 | 3.0±1.1 | 5.21 | 0.001 |
| ESR (mm/h) | 54.4±11.3 | 3.59±2.1 | 7.58 | 0.000 |
| White blood cell count (×109) | 8±2.317 | 6±2.324 | 2.459 | 0.032 |
| Absolute neutrophil count (×109) | 6±1.609 | 4±1.594 | 1.164 | 0.049 |
| Relative neutrophil count (%) | 67.11±7.04 | 56.86±5.04 | 2.428 | 0.031 |
| Absolute lymphocyte count (×109) | 1±4.187 | 2±5.649 | 2.578 | 0.029 |
| Relative lymphocyte count (%) | 22.57±7.49 | 33.29±5.87 | 2.743 | 0.018 |
| Absolute monocyte count (×109) | 5±2.365 | 5±1.879 | 0.137 | 0.876 |
| Relative monocyte count (%) | 8.17±2.36 | 7.65±1.79 | 0.536 | 0.612 |
Genetic equilibrium test of rs1800871genotypes in IL-10 gene.
| Group | n | AA | AG | GG | χ2 | ||||
|---|---|---|---|---|---|---|---|---|---|
| Actual frequency | Theoretical frequency | Actual frequency | Theoretical frequency | Actual frequency | Theoretical frequency | ||||
| Spinal tuberculosis group | 129 | 30 | 28.84 | 62 | 64.31 | 37 | 35.84 | 0.17 | 0.92 |
| Control group | 106 | 40 | 37.44 | 46 | 51.11 | 20 | 17.44 | 1.06 | 0.59 |
Comparisons of rs1800871genotypes in IL-10 gene [n (%)].
| Genotype | Spinal tuberculosis group | Control group | OR (95% CI) | p |
|---|---|---|---|---|
| AA | 30 (23.26) | 40 (37.74) | ||
| AG | 62 (48.06) | 46 (43.40) | 0.556 (0.303–1.022) | 0.058 |
| GG | 37 (28.68) | 20 (18.86) | 0.405 (0.197–0.834) | 0.013 |
| AG+GG | 99 (76.74) | 66 (62.26) | 0.500 (0.284–0.881) | 0.016 |
Comparison of allele distribution in IL-10 gene rs1800871A/G between the two groups [n (%)].
| Group | n | Allele [n (%)] | χ2 | ||
|---|---|---|---|---|---|
| A | G | ||||
| Spinal tuberculosis group | 129 | 122 (47.29) | 136 (52.71) | 6.890 | 0.009 |
| Control group | 106 | 126 (59.43) | 86 (40.57) | ||
Correlation analyses of rs1800871A/G genotypes in IL-10 gene and quantitative data in spinal tuberculosis group.
| Item | GG | AG+GG | χ2 | |
|---|---|---|---|---|
| C-reactive protein (mg/L) | 28.5±1.7 | 26.4±1.2 | 2.447 | 0.011 |
| ESR (mm/h) | 64.4±10.7 | 60.6±12.3 | 1.823 | 0.042 |
| White blood cell count (×109) | 9±2.816 | 9±1.517 | 2.067 | 0.048 |
| Absolute neutrophil count (×109) | 6±1.816 | 6±1.709 | 1.354 | 0.178 |
| Relative neutrophil count (%) | 69.16±7.89 | 67.17±6.14 | 1.878 | 0.041 |
| Absolute lymphocyte count (×109) | 1±4.276 | 1±4.383 | 0.046 | 0.927 |
| Relative lymphocyte count (%) | 22.32±7.75 | 22.48±6.97 | 1.345 | 0.176 |